Хронический колит диета: Хронический колит, симптомы, диета и лечение при хроническом катаральном колите кишечника у взрослых

Содержание

ХРОНИЧЕСКИЙ КОЛИТ КИШЕЧНИКА. СИМПТОМЫ ПРИЧИНЫ ЗАБОЛЕВАНИЯ ДИЕТА ПИТАНИЕ ПРОФИЛАКТИКА, цена

Хронический колит — это воспалительные, дистрофические и атрофические изменения слизистой толстой кишки, сопровождающиеся нарушениями ее моторики и секреции.

При написании страницы использовались материалы книги С. Н. Борисенко «Лечебно-профилактические программы».

у нашего генерального представителя — Наталья Евгеньевна

у нашего генерального представителя — Наталья Евгеньевна

Название Бад Указание к применению Механизм действия Бад
Ассимилятор за 30 минут перед едой — 1 капсула перед овощами и фруктами; до 3-х капсул — перед мясом и жареной пищей Повышает ферментативную активность кишечника. Оказывает противовоспалительное действие.
Очень важно
Мега Ацидофилус восстанавливает нормальную микрофлору кишечника. 1 капсула в день после еды
Алоэманнан 1 капсула 2 раза вдень во время еды оказывает регенеративное и противовоспалительное действие на кишечник.
Про-волокно 1 ч. л. на 1 стакан воды за 30-60 мин до еды, дополнительно запить стаканом воды или сока фитосорбент мягко очищает толстый кишечник, не повреждая слизистую.
Зеленое золото 1 капсула 2 раза в день в конце приема пищиобеспечивает организм витаминами А, D, К, препятствует кровотечениям, что особенно важно при неспецифическом язвенном колите.
Витамин Е с нанокластерами 1 капсула в день во время еды Улучшает эластичность сосудов.
Комплекс витаминов группы В 1-2 таблетки в день во время еды естественный синтез витаминов группы В микрофлорой кишечника нарушается при хроническом колите.
Полезно
Гидросель 8 капель на стакан жидкости Улучшает всасывание питательных веществ воспалительной слизистой кишечника.
Чеснок 1 капсула 3 раза в день во время еды Натуральный антибиотик. Снижает воспаление слизистой кишечника.
Коралловый кальций 1 пакетик на 1,5 литра воды в день между приемами пищи Восполняет дефицит минералов, возникающий из-за снижения их усваиваемости при колитах.
Кора муравьиного дерева, Поударка 1 капсула 3 раза в день Натуральный антибиотик и иммуномодулятор. Стимулирует защитные силы организма.
Омега 3/60 1 капсула в день во конце еды Мембраностабилизатор. Восстанавливает слизистую кишечника.
Экста-Си 1 капсула 1-2 раза в день во время еды Укрепляет стенки брыжеечных сосудов.

Лечение хронического колита в санатории имени М.И. Калинина, Ессентуки, комментарии

Хронический колит – распространенное заболевание толстого отдела кишечника, для которого характерно хроническое воспалительное поражение слизистой, под слизистой и мышечной оболочки толстой кишки, а также нарушение функции кишечника. Нарушение функции включает в себя моторный и секреторный компонент. Хронический колит нередко сочетается с воспалением в тонком отделе кишечника.

Предрасполагающим фактором для возникновения хронического колита служит нарушение диеты несбалансированное питание, неправильный режим питания, злоупотребление алкоголем, гипо и авитаминоз.

Для хронического колита характерны тупые, ноющие боли в разных отделах живота, схваткообразного характера, иногда боль разлитая без четкой локализации. Боль может усиливаться после еды, физической нагрузки, очистительной клизмы, и утихать после отхождения газов, опорожнения кишечника. Наблюдается чередование запоров и диареи, урчание, метеоризм (вздутие живота), ощущение неполного опорожнения кишечника, позывы к дефикации – тенезмы.

Противопоказания!

Санаторно-курортное лечение рекомендуется больным хроническим колитом, в стадии ремиссии. Курсовое лечение назначается индивидуально, согласно жалоб, анамнеза, сопутствующей патологии больного.

Обязательным компонентом курортной терапии является – диетотерапия.

Применяются:

  • Диета №4б (по энергоценности и химическому составу полноценная диета с небольшим увеличением белка, блюда протертые и измельченные, сваренные на пару).
  • Диета №4в (пища дается в не измельченном виде, варится в воде или запекается).
  • Диета №3 (с увеличенным содержанием послабляющих продуктов и блюд).

Питьевая минеральная вода Ессентуки № 4 , Ессентуки № 17 , Ессентуки Новая – назначается согласно моторной функции толстой кишки. Обязательно учитывается сопутствующая патология сердечно-сосудистой системы, почек и др. Питьевая минеральная вода, воздействуя содержащимися в ней микроэлементами, органическими веществами и газами на слизистую оболочку желудочно-кишечного тракта, оказывает противовоспалительное влияние, нормализует основные функции гастродуоденальной системы и тонкой кишки (секреторную, ферментативную, всасывательную), изменяет уровень обменных процессов в тканях и клетках слизистой.

Ессентукские минеральные воды используются и в виде ванн. Это углекисло-сероводородные ванны (УСВ). Из водных процедур назначаются ванны хвойно-жемчужные, йодо-бромные, обще-вихревые, пенные; гидропатия (души циркулярный, Шарко), подводный душ массаж.

Грязелечение применяется в виде грязевых аппликаций, ректальных тампонов.

Внимание!

Назначение противопоказано больным с новообразованиями любой локализации, в период обострения основного заболевания и сопутствующей патологии.

Из физиотерапевтических методов лечения применяются: переменное магнитное поле, ультразвуковая терапия, синусоидальные модулированные токи, Денс-терапия, магнитотурботрон, электрофорез с платифиллином, папаверином, новокаином.

Применяются микроклизмы, гидроколонотерапия (AMOK), а так же сифонные промывания кишечника минеральной водой, Буровая № 1 с травяными настоями, лекарственными веществам.

Важное место влечении занимает лечебная физкультура. Включающая в себя терренкуры, дозированную ходьбу, скандинавскую ходьбу, лечебное плавание в бассейне, спортивные игры, лечебную гимнастику.

Эффективность:

Ожидаемый результат: уменьшение или полное исчезновение клинических проявлений заболевания, улучшение общего самочувствия больного.

Колит – симптомы, лечение

 

Тема статьи очень важная: заболевание

колит — симптомы, лечение его. Для излечения колита очень важно лечебное питание!

 

 

Колит — воспаление толстой кишки.
Он может протекать остро и хронически.

 

Причины острого колита

 

  • бактериальная дизентерия
  • пищевые токсикоинфекции
  • пищевые отравления небактериальной природы
  • грубые погрешности в питании
  • аллергические заболевания
  • некоторые инфекции с первичной внекишечной локализацией (грипп, рожистые и септические состояния)

 

Причины хронического колита

 

  • грубые нарушения в питании
  • длительные и часто повторяющиеся задержки каловых масс в различных отделах толстой кишки вследствие спаек, сращений, дискинезий, перегибов, сужений просвета кишки
  • хронические отравления токсическими веществами (свинец, фосфор, ртуть, мышьяк), попадающими в организм извне и образующимися при некоторых заболеваниях (подагра, уремия)
  • паразитарные поражения кишечника (амебная дизентерия, глистная инвазия, лямблии, балантидии)
  • поражение кишечника, вызванные бактериальной дизентерией, сальмонеллезом, брюшным тифом, паратифами, туберкулезом, сифилисом, колиинфекцией

Выраженность и характер клинического проявления кишечных симптомов хронического колита

зависят от

  • локализации воспалительного процесса
  • степени тяжести болезни
  • иммунобиологической реактивности организма

*** Хронический колит встречается чаще острых! Может наблюдаться изолированно или совместно с энтеритами, иногда являются следствием перехода острого процесса в хронический.

Хронический колит — симптомы

 

 
  • тупые и коликообразные боли в животе, преимущественно в нижних его отделах
  • чередованием поносов и запоров
  • позывами на дефекацию и тенезмами
  • слизисто-гнойным или кровянистым стулом
  • явлениями общей интоксикации (повышением температуры тела, слабостью, головной болью и т. п.)

Больные хроническим колитом страдают

    • нарушениями вегетативной и центральной нервной системы, что проявляется

 

— раздражительностью
— быстрой утомляемостью
— бессонницей
— канцерофобией
— депрессивным состоянием

Также возможны

 

  • проявление кишечно-кардинального синдрома
  • кишечно-сосудистого синдрома (боли и перебои в области сердца, сердцебиение, головокружение, гипотония)

 

Периодические обострения колита

возникают под воздействием ряда неблагоприятных факторов

  • сопутствующих инфекционных заболеваний (грипп, ангина)
  • психо-эмоциональных перегрузок
  • перегревания на солнце
  • переохлаждения
  • аллергизации организма и т.п.

 

Колит — лечение

Заключается в

  • медикаментозном лечении,
  • санаторно-курортном лечении
  • и витаминотерапии.

Лечебные мероприятия назначаются комплексно, но строго ИНДИВИДУАЛЬНО!

В комплексном лечении колитов основное значение имеет лечебное питание, диетотерапия.

От правильного применения диет во многом зависит выздоровление больных.

Колит – симптомы, лечение его, как вы убедились, сложный процесс, но успех будет гарантирован при соблюдении предписаний врача и диет!

Не забывайте никогда о том, что нельзя заниматься самолечением!
Лечение должно проводиться под контролем врача!

 

Колиты — Клиника “Виромед”

Диагностика колита кишечника

Диагностика колита начинается со сбора анамнеза, в котором учитываются перенесенные заболевания больного, которые могут спровоцировать развитие колита. Обязательным является пальпация живота, которая позволит врачу определить болезненные участки толстого кишечника и наличие вздутия.

Важную роль в диагностике колита играют лабораторные исследования.

Обязательным к выполнению являются следующие тесты:

  • общий анализ крови;
  • биохимический анализ крови;
  • анализ кала.

Данные анализы позволяют определить как общее состояние здоровья человека, так и специфические признаки заболевания, как например:

  • наличие в кале слизи,
  • крови,
  • яиц гельминтов
  • признаки воспаления с определением возбудителей.

Кроме того, очень часто диагностику колита проводят с помощью инструментальных методов обследования. К инструментальным методам диагностики относят: эндоскопию; ректороманоскопию; ирригоскопию; колоноскопию.

Лечение колита кишечника

Определение точного диагноза напрямую влияет на успех терапии. Лечение колита кишечника у взрослых зависит от локализации воспалительного процесса, от вида и формы колита, от сопутствующих заболеваний. В любом случае необходимо в первую очередь устранить причину заболевания, а в дальнейшем проводить терапию, направленную на поддержание и восстановление здоровья человека.

Важную роль в лечении колита кишечника играет диета. Так, больным показана диета №4, которая подразумевает отказ от жирной, жареной, слишком соленой или острой пищи. Диета позволяет не перегружать ЖКТ и не провоцировать дальнейшее развитие воспаления. Конечно, на время лечения стоит отказаться от приема алкоголя в любых количествах.

Хирургическое лечение колитов применяется в редких случаях язвенного колита у взрослых, а также в случае ишемического колита при образовании тромбов в ветвях брюшной аорты.

В нашей клинике «ВироМед» ведут прием лучшие проктологи Уфы, которые помогут определить причину возникновения проблемы и предложить оптимальный метод ее решения. В клинике «ВироМед» успешно проводится лечение колитов и других заболеваний. Основными методами лечения, применяемыми в клинике «ВироМед», являются правильно подобранное медикаментозное лечение, оперативное лечение. Также в нашей клинике успешно применяется Радиоволновая хирургия – инновационный, бесконтактный, нетравматичный метод лечения, уверенно набирающий все большую популярность в  хирургии.

Специалисты клиники «ВироМед» подбирают индивидуальный курс терапии для каждого пациента. Это обеспечивает высокую эффективность лечения на любой стадии заболевания. Перед оперативным вмешательством обязательно проводится комплексный осмотр, для выявления сопутствующих заболеваний, которые могут существенно повлиять на результаты операции.

Диета при хроническом колите с запорами и поносами

Хронический колит — это воспалительно-дистрофическое заболевание слизистой оболочки толстой кишки, при котором нарушаются ее двигательная (моторная) функция, всасывание воды и выделение каловых масс.

 

Характеристика хронического колита

В развитии хронического колита имеют значение острые кишечные инфекции (дизентерия, сальмонеллез, иерсиниоз и др.), после которых могут длительно оставаться воспалительные реакции слизистой оболочки и интоксикация. Причиной хронического колита нередко является:

  • нерегулярное, бессистемное питание,
  • злоупотребление острой, жареной, раздражающей, рафинированной пищей,
  • недостаток овощей, фруктов в питании, а также
  • глистные инвазии (аскариды, свиной и бычий цепень и др.).

Также могут вызвать это заболевание:

  • токсические воздействия свинца, ртути, мышьяка, висмута (особенно если они являются факторами профессиональной вредности),
  • длительный прием некоторых медикаментов (антибиотики, сульфаниламиды, слабительные),
  • пищевая аллергия.

Обычно хронический колит протекает с повторяющимися обострениями, во время которых наибольшее беспокойство у больного вызывает боль в животе, связанная прежде всего с повышением тонуса и усилением двигательной активности (перистальтики) кишок.

Боль, как правило, ноюще-давящая, коликоподобная, начинается примерно через 30 минут после приема острой, раздражающей пищи, пива, алкоголя или перед стулом. Боль локализуется в боковых отделах, в средней и нижней части живота, иногда в правом или левом подреберье или не имеет четкой локализации. Она может усиливаться при тряской езде, прыжках, при тепловом лечении (парафин, грязи, горячая грелка) и после клизм, уменьшается после стула и отхождения газов.

Самый характерный признак хронического колита — нарушения стула. Чаще всего больные длительно страдают запорами, стул у них, как правило, малыми порциями, кусковидный, плотный, иногда со слизью. Реже наблюдается «неустойчивый» стул, когда поносы сменяются запорами. Многие больные отмечают вздутие и урчание в животе, неприятный вкус во рту, отрыжку воздухом, раздражительность, головную боль, утомляемость. Аппетит обычно нормальный, масса тела не снижается.

При преимущественном поражении прямой и сигмовидной кишки (проктосигмоидит) боли возникают в левой половине живота, ощущение давления, распирания в прямой кишке, кашицеобразный или плотный стул несколько раз в день без чувства полного опорожнения кишечника. Возможны так называемые «ложные позывы», при которых выделяются только газы или небольшое количество слизи.

Лечение назначается врачом после выявления в каждом конкретном случае причины и механизма развития заболевания, для этого больного тщательно обследуют.

Важнейшее основополагающее значение в лечении хронического колита принадлежит диете и лечебному питанию. И хотя врач назначает лечебное питание каждому больному индивидуально, пациенты должны знать основные принципы этой диеты, чтобы более сознательно участвовать в лечебном процессе.

 

Диета при обострении колита с поносами

При обострении колита, протекающем с поносами или неустойчивым стулом, питание должно быть полноценным и сбалансированным по содержанию белков, жиров и углеводов. Поваренная соль ограничивается до 8—10 граммов в сутки. Пища должна быть вареной или приготовленной на пару, хотя могут допускаться овощные, мясные и рыбные блюда в запеченном виде без грубой корки. Больной должен питаться 5—6 раз в день.

РАЗРЕШАЮТСЯ:

  • хлеб пшеничный вчерашний, сухари, сухое печенье.
  • Супы готовятся на слабом обезжиренном мясном или рыбном бульоне с хорошо разваренными крупами (перловой, рисовой, гречневой, овсяной) или мелко нашинкованными овощами (картофель, морковь, кабачки, цветная капуста, тыква).
  • Показаны блюда из нежирных сортов мяса и птицы (говядина без видимого жира, телятина, кролик, курица, индейка) — паровые котлеты, фрикадели, кнели, суфле.
  • Рыба также должна быть нежирных сортов (судак, лещ, щука, треска, окунь, хек, ледяная), отварная или паровая.
  • Картофель, кабачки, тыква, морковь, зеленый горошек подаются в протертом виде — пюре, паровые суфле, пудинги.
  • Различные каши, кроме пшенной, готовятся на воде с добавлением сливок и небольшого количества сливочного масла (5 г на порцию).
  • Показаны также паровые омлеты, яйца всмятку (не более двух штук в день), свежеприготовленный творог в натуральном виде или творожный пудинг, вареники с творогом, кисели и протертые компоты, желе, муссы из сладких сортов ягод и фруктов, желейный мармелад, зефир, печеные яблоки, груши, чай, отвар шиповника.
  • Лавровый лист, укроп, листья петрушки, корица используются при переносимости, сливочное масло добавляется в готовые блюда не более 5—10 г на прием.

ЗАПРЕЩАЮТСЯ:

  • хлеб ржаной из муки грубого помола, свежий хлеб всех сортов, изделия из сдобного и слоеного теста;
  • супы из бобовых, молочные супы, щи, борщи, рассольник;
  • жирные мясо, утка, гусь, копчености, колбасы, консервы;
  • жирная, соленая, копченая рыба, рыбные консервы;
  • молоко в натуральном виде, острые соленые сыры;
  • яйца вкрутую и жареные;
  • белокочанная капуста, свекла, редис, редька, лук, чеснок, бобы, брюква, репа, щавель, шпинат, грибы, хрен, перец, острые соусы,
  • а также виноград, абрикосы, сливы, мороженое, шоколад, пирожные, виноградный, сливовый, абрикосовый соки, квас, спиртные, газированные напитки, кофе.

Такую диету следует соблюдать 4—5 недель, а иногда и несколько месяцев, до достижения полной нормализации функций кишечника (ремиссии).

 

Диета после стихания воспалительного процесса (ремиссия)

В последующем РАЗРЕШАЮТСЯ:

  • блюда разной степени измельчения и неизмельченные, отварные, паровые, тушеные, запеченные, жареные без образования грубой корки;
  • супы на нежирном мясном, рыбном бульоне, овощном отваре,
  • овощи отварные и сырые,
  • сладкие блюда и напитки.

Из рациона ИСКЛЮЧАЮТСЯ лишь:

  • индивидуально непереносимые продукты, а также
  • алкоголь, пиво,
  • копчености, консервы,
  • редька, редис, брюква, чеснок, перец, горчица, хрен,
  • грибы,
  • говяжий, бараний и кулинарный жиры,
  • жирные и острые соусы,
  • виноградный сок,
  • квас,
  • газированные напитки,
  • кофе.

Читайте также:

 

Особенности диеты при запорах

Больным, страдающим хроническим колитом с запорами, в основе которых лежит понижение тонуса и ослабление перистальтики толстой кишки, в диету обязательно надо включать продукты, богатые пищевыми волокнами (растительной клетчаткой). Содержащиеся в них целлюлоза, гемицеллюлоза, пектин и лигнин обладают способностью впитывать воду и увеличиваться в объеме, что ускоряет прохождение каловых масс, нормализует перистальтику и опорожнение кишечника.

Наиболее выраженным ПОСЛАБЛЯЮЩИМ ДЕЙСТВИЕМ обладают черный хлеб из муки грубого помола и хлеб с пшеничными отрубями «Здоровье», «Барвихинский», «Русь», а также «Старажытны», «Зернышко». Стимулируют перистальтику кишечника сырые овощи и фрукты, особенно свекла, капуста белокочанная свежая и квашеная, морковь, репа, тыква, кабачки, топинамбур, лиственный салат, цветная капуста, которые используются в натуральном виде и в салатах, а также орехи, мандарины, апельсины, бананы, инжир, финики, чернослив, курага, урюк, яблоки, черная смородина в любом виде, свежие ягоды ежевики, калины, черники. При переносимости в диету могут включаться сельдь, лимонад, фруктовые напитки, насыщенные углекислотой, квас, укроп, сельдерей, зелень петрушки, любистока, лавровый лист, корица.

Умеренно раздражают кишечник и усиливают перистальтику джемы, мед, овощные и фруктовые соки, разведенные пополам с водой, особенно свекольно-морковный (50 мл сока 2 раза в день, но не более 7—10 дней подряд), однодневный кефир, растительное масло (подсолнечное, оливковое, льняное).

Набор продуктов на день (в граммах): хлеб — 400, мясо — 100—120, рыба — 110, яйца — 1—2 шт., творог — 100, мука и крупы — 60—70, сахар — 50—60, масло сливочное — 30, масло растительное — 40—50, овощи, включая картофель, — 800—1000, фрукты — 150—300.

Можно воспользоваться и следующими советами: утром натощак выпить 1 стакан сырой воды комнатной температуры с добавлением 10 г сахара и ломтика лимона.

Или выпить 1 стакан холодной воды со столовой ложкой следующей смеси: по 50 г чернослива без косточек и инжира пропустить через мясорубку, добавить 1 столовую ложку меда и 1 чайную ложку измельченного александрийского листа (сенны).

Утром и в течение дня в меню могут быть САЛАТЫ:

  • из отварной свеклы с добавлением зелени укропа, петрушки и 1 столовой ложки растительного масла;
  • из сырой моркови со свежей зеленью (на 1 порцию — 100 г) — 80 г моркови, 20 г сметаны, 0,2 г лимонной кислоты, зелень укропа, 0,5—0,8 г петрушки, 0,2 г соли;
  • из капусты и моркови со сметаной;
  • из крапивы с чесноком: молодые листья крапивы залить на 5 мин. кипятком, отбросить на дуршлаг, нашинковать, добавить немного чеснока, зелень укропа, петрушки, заправить сметаной или растительным маслом;
  • салат с овсяными или пшеничными хлопьями: натереть на крупной терке 2 небольших яблока, добавить 0,5 ч. л. корицы, 1 ст. л. меда, 2 ст. л. хлопьев, перемешать, оставить на 30—40 мин. Яблоки можно заменить 1 апельсином, а вместо корицы добавить изюм, чернослив или курагу.

Чрезвычайно полезно обогащать пищу пшеничными отрубями. Начинать прием отрубей следует с 1 чайной ложки в день, за неделю увеличивая дозу до 1 чайной ложки 3 раза в день. При хорошей переносимости переходят на прием 1 столовой ложки отрубей 2—3 раза в день. Срок приема не ограничен.

Как готовить отруби к приему? Отмеренную для приема дозу отрубей следует залить 1/2 стакана кипятка, настоять 5 минут, после чего надосадочную жидкость слить. Отруби добавляют в супы, каши, салаты, в котлетную массу как наполнитель, в тесто для блинов, булочек. Их можно съедать в чистом виде или с размоченным изюмом, черносливом.

Для страдающих упорными запорами может быть полезен следующий рецепт: 1 столовую ложку отрубей, подготовленную к приему, залить 150 мл однодневного кефира, настоять 30 мин., перед приемом добавить 1 чайную ложку растительного масла, перемешать. Принимать лучше на ночь.

Те, кто добавляет в пищу отруби, должны пить до 6—8 стаканов жидкости в день. Пить можно воду, витаминные чаи, настои из сухофруктов (яблоки, изюм, чернослив, курага).

Больным с запорами ПРОТИВОПОКАЗАНЫ:

  • хлеб и хлебобулочные изделия из пшеничной муки высшего сорта,
  • тугоплавкие жиры (говяжий, бараний, утиный, гусиный),
  • жареные с грубой коркой мясо и рыба,
  • копчености, пряности, острые соусы, перец, горчица, крепкие бульоны,
  • редис, редька,
  • крепкий чай, черный кофе, шоколад,
  • грибы,
  • ограничиваются каши из манной и рисовой крупы, бобовые, чеснок.

В то же время важно следующее: прием слабительных средств, очистительные клизмы, как правило, не спасают от запоров, а наоборот, со временем лишь усиливают их. Поэтому применять клизмы и слабительные средства можно только по рекомендации врача.

Михаил Сакович, доцент кафедры гастроэнтерологии и диетологии БелГИУВа.
Журнал «Здоровье и успех», № 9 за 1997 год.

 

Диета при запорах

Когда используется: хронические заболевания кишечника (запоры) при отсутствии других заболеваний органов пищеварения.

Показана физиологически полноценная диета, включающая продукты, богатые грубой растительной клетчаткой, стимулирующей перистальтику кишечника.

Запрещается:

  • хлеб из муки высшего сорта, слоеное и сдобное тесто;
  • рис и манную крупу ограничить;
  • жирное мясо;
  • яйца вкрутую и жареные;
  • копченое, консервы;
  • редька, редис, чеснок, лук, репа, грибы;
  • черника, айва, кизил;
  • шоколад, изделия с кремом;
  • животные и кулинарные жиры;
  • острые и жирные соусы, хрен, горчица, перец;
  • какао, черный кофе, крепкий чай, кисель, алкоголь.

 
Пример меню

Завтрак. Салат из свежей капусты и моркови со сметаной (150 г), каша пшенная молочная (280 г), кофе с молоком (180 г).
Второй завтрак. Свежее яблоко.
Обед. Суп из овощей с маслом (400 г), отварное мясо (55 г), свекла тушеная (180 г), желе фруктовое (130 г).
Полдник. Размоченный чернослив (50 г).
Ужин. Голубцы из овощей с маслом (200 г), суп из гречневой крупы с творогом (200 г), некрепкий чай (180 г).
На ночь. Кефир (180 г).
На весь день. Хлеб ржаной (150 г), хлеб пшеничный с отрубями (200 г), сливочное масло (10 г), сахар (40 г).

 

Диета при поносах

Когда используется: острые и хронические заболевания кишечника, сопровождающиеся поносами.

Необходимо снизить калораж пищи за счет ограничения жиров и углеводов, а количество белков должно соответствовать физиологической норме. Нужно избегать химических, механических и температурных раздражителей, продуктов, способствующих брожению в кишечнике.

Разрешается:

  • сухари и вчерашний белый хлеб;
  • супы на обезжиренном мясном или рыбном бульоне с добавлением слизистых отваров круп, жареного мяса, паровых фрикаделек;
  • паровые или сваренные на воде котлеты, фарш с отварным рисом, вареное мясо;
  • сваренная на пару или воде нежирная рыба;
  • вареные протертые овощи;
  • рисовая, овсяная, гречневая каши на воде;
  • яйца всмятку или омлет;
  • кисели и желе из черники, кизила, айвы, груш, протертых сырых яблок;
  • сахар ограничить;
  • зеленый чай, отвары из шиповника, сушеных ягод, черемухи, черной смородины, летом — ягоды черники (1 стакан в три приема).

 
Пример меню

Завтрак. Рыбные паровые котлеты, каша на воде рисовая, протертые, чай.
Второй завтрак. Несоленый творог.
Обед. Суп-пюре из мяса, фрикадельки мясные без гарнира, отвар из плодов черники.
Полдник. Сухарики из пшеничного хлеба сладкие, отвар черемухи.
Ужин. Омлет на пару, каша манная на мясном бульоне.
На ночь. Кисель из отвара сушеных плодов черной смородины.
На весь день. Сухарики из пшеничного хлеба (100 г), сахар (40 г), масло сливочное (10 г).

Светлана Борисенко, 4 июля 2015 года.
Источник: газета «Звязда», в переводе: http://zviazda.by/2015/07/90403.html

Читайте также:

Диета при колите: польза, меню, рецепты блюд

Диета при остром колите

Диета при колите в острой форме на день выглядит примерно так:

  • 1 завтрак: геркулесовая каша на воде, чай.
  • 2 завтрак: стакан киселя.
  • Обед: мясной бульон, мясное суфле, рисовая каша на воде, сухари.
  • Полдник: отвар шиповника.
  • Ужин: паровые котлеты из трески.
  • На ночь: стакан молока.

Предпочтительны нежирные сорта птицы без кожи, приготовленные в пароварке. Каши едят из риса и манки. Рекомендуется пресный творог, черничное желе и какао на воде.

Запрещаются цельное молоко и молочные блюда, соления, маринады и кислые блюда.

[5], [6], [7], [8]

Диета при хроническом колите

Симптомы такого неприятного заболевания, как хронический колит: боль в животе и запоры, которые чередуются с поносами. Спровоцировать приступ может жирная, острая и холодная пища, пища с грубой клетчаткой.

Диета при колите уменьшает воспаление, брожение и гниение в кишечнике. Блюда в основном жидкие, протертые, сваренные в пароварке. Есть при хроническом колите нужно 5 раз в день. Диета при колите разрешает из мучных изделий только сухари из белого хлеба, супы на слабом мясном бульоне с рисовым отваром, фрикадельками и яичными хлопьями. Макароны и крепкие бульоны нужно исключить. Нежирная говядина, курятина, телятина, кролик без кожи разрешены. Исключают жирное мясо и колбасные изделия. Употребляйте в пищу нежирную рыбу, а от жирной, соленой, копченой и консервированной вам придется отказаться. Из молочных продуктов можно только пресный нежирный свежий творог. В день можно съедать до 2 яиц всмятку или белковый омлет. Разрешается рис и гречка. Нежелательно пшено и ячневая крупа. Больному хроническим колитом нельзя употреблять бобовые. Исключаются все виды закусок. Никаких соусов, уксуса и приправ, особенно очень острых. Из приправ допускается корица и ванилин. Разрешен черничный, айвовый и грушевый кисели. Виноград, абрикосы, кофе с молоком, очень крепкий черный кофе и какао – также не для вашего стола.

Вне обострения в день можно съедать 200 г сырых яблок. При признаках бродильных процессов увеличивают количество белка за счет рыбы, мяса, творога.

[9], [10]

Диета 4 при хроническом колите

Диета при колите в хронической форме рекомендует такие блюда: 

  1. Тонкие сухари. 
  2. Слизистые супы из рисовой и овсяной круп с фрикадельками. 
  3. Мясные фрикадельки, тефтели, котлеты из курицы и говядины. 
  4. Овсяная и гречневая каши на воде. 
  5. Паровой омлет из 2 яиц. 
  6. Кисель из черники, отвар шиповника, паровое суфле.

Вам нельзя есть: 

  1. Ржаной хлеб. 
  2. Сдобные изделия из муки. 
  3. Супы с макаронными изделиями. 
  4. Крепкие бульоны. 
  5. Мясо куском. 
  6. Жирные виды рыбы. 
  7. Икру. 
  8. Цельное молоко. 
  9. Яйца вкрутую. 
  10. Жаренные яйца. 
  11. Перловую крупу. 
  12. Фасоль. 
  13. Горох. 
  14. Натуральные фрукты. 
  15. Мед. 
  16. Конфеты. 
  17. Виноградный, абрикосовый соки.

Больным хроническим колитом рекомендуется частое питание небольшими порциями. Последний прием пищи – не позднее 20-00. Основную массу еды нужно съедать в обед, ужин должен быть очень легким. Обязателен второй завтрак и полдник.

[11], [12]

Диета 4а при хроническом колите

Диета при колите в хронической форме в стадии обострения (стол 4а) ограничивает в рационе содержание углеводов (каш, сахара).

Приветствуются такие продукты на столе больного, как черствые сухари, протертый творог, одно яйцо всмятку, слизистые супы, отварная рыба, мясо рубленные (вместо хлеба в котлеты кладите рис), отвар смородины, черники и кефир, сухой бисквит, протертые овощи, сваренные на пару, некислая сметана, простокваша, кисели и чай, какао.

[13], [14], [15], [16], [17]

Диеты при различных видах колита

[18]

Диета при язвенном колите

Язвенный колит – воспалительное, преимущественно аутоиммунной природы, заболевание кишечника. В рационе больного должны преобладать белки. Основные источники белка – рыба и творог, нежирное мясо, яйца всмятку и в виде белковых омлетов. В блюда можно добавлять 10 г сливочного масла. Жиры ограничивают . Блюда не жарят. Очень полезна жидкая рисовая каша на воде, кисели и отвар шиповника в теплом виде, спелые фрукты и овощи в виде пюре. Диета при колите предполагает дробное питание 5-6 раз в день. Последний прием пищи – в 20 часов. Ужин должен быть очень легким. Не ешьте жирное мясо и грибы, острые блюда, соленые блюда, сливы, кофе, шоколад, соусы, попкорн, не пейте алкоголь и газировку.

[19], [20], [21]

Диета при колите с запорами

Соблюдение принципов питания – важная составляющая лечения колита с запорами. Пищу принимают 5 раз в день. Продукты нужно измельчать, они не должны быть твердыми. Основа рациона – несдобное печенье, мягкий сыр, кефир. Допускаются слабо обжаренные котлеты, фрикадельки, протертые каши пополам с молоком, крупяные супы на мясном бульоне, протертые овощи и компоты, отварные фрукты и овощи. Они богаты клетчаткой и помогают в борьбе с запорами. Консистенция блюд – жидкая. В день допустимо употреблять 15 г соли.

Что вам нельзя: 

  1. Сладости (шоколад, кремы).
  2. Копчености, маринады.
  3. Колбасы.
  4. Бобовые.
  5. Цельное молоко.
  6. Жаренные блюда.
  7. Газировку.
  8. Алкоголь.

[22], [23], [24], [25]

Диета при колите с поносом

Бессистемное питание, жаренная пища и глистные инвазии нередко приводят к развитию колита с поносом. Стул у больных колитами, как правило, плотный или неустойчивый, то есть запоры чередуются с поносами. Больных беспокоит урчание в животе, отрыжка и мигрень. Разрешен пшеничный хлеб, сухари и мелко нашинкованные вареные овощи (картофель, кабачки, тыква). Лучшее мясо – телятина и курятина. Полезен отварной лещ и треска, кабачки, тыква и вареный или запеченный зеленый горошек. В день можно съедать 3 яйца всмятку. Яйца вкрутую и жаренные запрещены. Можно готовить омлет на пару и в духовке. Из десертов – творожные пудинги, кисели, компоты и муссы, зефир, груши и отвар шиповника, корица, как добавка в сладкие блюда.

Диета при колите запрещает такие продукты: ржаной хлеб, свежий белый и черный хлеб, изделия из слоеного и дрожжевого теста, молочные супы, борщи, щи, жирные сорта мяса, мясо гуся, утки, дичь, колбасы, соленая рыба, молоко, соленый сыр, плавленый сыр, колбасный сыр, сыр «косичка», свекла, редька, чеснок, брюква, щавель, хрен, соусы, абрикосы, мороженое, пирожные, сок из сливы, спиртные напитки, квас и кофе.

Диету нужно соблюдать около месяца. В период ремиссии разрешаются супы на мясном бульоне, отварные и сырые овощи. Из рациона исключаются алкоголь, копчености, редька, брюква, перец, хрен, говяжий жир, острые соусы, майонез, квас и кофе.

[26], [27], [28]

Диета при спастическом колите

При спастическом колите рекомендованы такие блюда:

  • Каша-размазня, суп-пюре, овощные пюре, фруктовые пюре, желе, муссы, кисели, печеная и вареная нежирная рыба, печеное и вареное на пару и в воде нежирное мясо. Это можно есть, если колит сопровождается диареей.
  • Если же у вас запор, ешьте сырые овощи и фрукты, фруктовые соки, овощные соки, печеную тыкву.
  • Заваривайте семена аниса и пейте вместо чая. На стакан воды нужна 1 чайная ложечка семян. Уйдут боли и прекратится выход газов.

Для борьбы со спастическим колитом очень важно избегать раздражения, нервного перенапряжения. Живите и радуйтесь тому, что приносит каждый новый день!

[29], [30], [31], [32]

Диета при катаральном колите

Диета при колите в начальной, катаральной стадии, должна содержать все необходимые вещества, но быть щадящей для слизистой кишечника. Первые два дня вообще желательно поголодать, пить только чай, минералку и отвар шиповника. В дальнейшем питание должно быть частым (до 6 раз в день), но маленькими порциями. Питание направлено на предотвращение процессов гниения в кишечнике. Пища должна быть варенной и измельченной, из рациона исключается молоко, копчености, бобовые. Кисели, варенные овощи и сухари, напротив, принесут пользу для вашего здоровья.

[33], [34], [35], [36]

Диета при атрофическом колите

Диета при колите с явлениями атрофии слизистой оболочки кишечника направлена на снижение кислотности желудочного сока, она механически щадит слизистую за счет употребления пищи небольшими порциями 6 раз в день в протертом виде, без грубой клетчатки. Распределение диеты такое: дневной рацион составляет 100 г белка, 100 г жира и 400 г углеводов.

Жирное мясо, сдоба, утка, гусь, баранина, виноград, жирный хлеб, жирная рыба, сырые овощи и фрукты запрещены больным атрофическим колитом. На завтрак хорошо съедать яблочное пюре с лимонным соком, на второй завтрак – кашу-размазню из гречи или овсяных хлопьев. На обед – пшеничный хлеб, щи из свежей капусты или овощной суп, отварное мясо или язык с кашей на воде.

Нельзя есть свежий хлеб, молочный, гороховый суп, соленые, жирные, пряные блюда, лук, редис, перец, ягоды в свежем виде и кремовые изделия.

[37], [38], [39], [40], [41], [42]

Диета при эрозивном колите

Диета при колите с язвами должна содержать повышенное количество белков. Они содержатся в мясе, яйцах, твороге. Молоко противопоказано, а мясо можно только нежирное. Возможны манные и рисовые каши, отвар шиповника, некрепкий чай с измельченными сухариками. Фрукты употребляют протертыми, в виде пюре. Рекомендовано вареное мясо и белый вчерашний хлеб. Молочные продукты переносятся плохо. Все жирное, шоколад, кремы, грибы, сливы исключаются.

[43], [44], [45], [46], [47]

Диета при псевдомембранозном колите

Диета при колите предполагает повышенное содержание белка и снижение количества жиров. При псевдомембранозном колите отказываются от таких блюд, как колбасы, свежий хлеб, жирное мясо, копчености и соленые продукты, бобовые, пшенная крупа, кофе с молоком, мороженое, яичница, квас, абрикосовый сок и абрикосы, виноградный сок и виноград. Есть можно только вареные овощи. Груши и сливы нужно запекать. Супы едят в виде кремов и пюре, хлеб едят подсушенным или вчерашним, в виде сухарей. Его нужно размачивать. Не следует есть очень горячие блюда и холодные десерты. Фруктовые соки разбавляются водой, а груши и яблоки чистятся от шкурки и семян. Придется отказаться от жирной, жаренной и копченой пищи.

[48], [49], [50], [51], [52], [53]

Диета при обострении колита

Диета при колите в стадии обострения хронического процесса включает в себя продукты, щадящие слизистую оболочку кишечника: черствый хлеб, протертые ягоды и соки пополам с кипяченой водой, свежий сыр, отвар шиповника, мясо куском, непротертые отварные овощи, пироги с мясом, ватрушки с сыром, джемы, чай с молоком, кофе с молоком. Исключают черный хлеб, колбасы, редьку, щавель, лук, чеснок, абрикосы и дыни. Съедайте перед едой 50 г свежих яблок.

[54], [55], [56], [57]

Диета при колите и энтероколите

Диета при колите и энтероколите подбирается лечащим врачом, который учитывает выраженность воспалительного процесса в кишечнике. При колите и энтероколите без усиления брожения и гниения назначают диету 4. Больному дают крепкий чай без молока, протертый через сито творог, простоквашу, овсяный и манный супы. Можно включать в меню рубленное мясо в виде фрикаделек, кнелей. Разрешена рисовая и манная каша на воде и черствая булка. Из напитков полезны вишневые кисели, а также из плодов черной смородины. Сырые овощи, неочищенные фрукты и изюм надо ограничить, если в кишечнике идет интенсивное брожение. Можно давать больному мясные котлеты без хлеба. Во время ремиссии в кашу можно добавлять немножко молока, допустим неострый томат.

[58], [59], [60], [61]

Диета при гастрите и колите

Диета при колите и гастрите – это диетический стол по Певзнеру 2. Вы можете употреблять в пищу чай, какао, простоквашу, нежирную рубленную селедку, молоко в блюдах, сливки, сливочное масло, омлет, рыбные, вегетарианские, крупяные супы, рыба, жаренная без панировки, рубленные куры, протертые крупы, овощи, протертые фрукты, сладкие блюда без крема, компоты, кисели, муссы, желе, рыбные соусы. На завтрак обязательно следует съедать яйцо всмятку, а на обед овощной протертый суп или суп из круп. Роль первый блюд в лечебном питании при гастрите и колите очень велика. Не ешьте на бегу, всухомятку, не отвлекайтесь во время еды.

[62], [63], [64], [65], [66]

Диета при колите у детей

Диета при колите у детей должна быть физиологической, содержать достаточно белка, исключать раздражители кишечника и продукты, вызывающие гниение и брожение в нем. Это копченые блюда, все жареное, цельное молоко, жирное мясо, капуста, фасоль и лук. Все блюда нужно варить и протирать. При поносах полезны разгрузочные дни. Если ребенок склонен к задержке стула, полезно добавить на его стол побольше измельченной вареной свеклы. Полезны некрепкие бульоны, яйца всмятку, кисели. Приготовьте вашему ребенку свежевыжатый сок из абрикос, если он страдает запором. Цитрусовые исключаются. Полезны сливки. Следите, чтобы маленький сладкоежка не дотянулся до сладостей. Используйте картофельный сок – давайте малышу ½ стакана за полчаса до приема пищи.

Диета при колите зависит от его формы, максимально щадит слизистую кишечника и помогает быстрее выздороветь, если ее тщательно придерживаться.

[67], [68], [69], [70], [71]

Диетическое питание – клинический санаторий БарвихаМед

  1. Главная
  2. Услуги и цены
  3. Питание
  4. Диетическое питание

В клиническом санатории «Барвиха» организовано диетическое сбалансированное питание. Разработано специальное диетическое сезонное меню с широким выбором блюд из исключительно свежих высококачественных продуктов.

Питание пациентов находится под контролем врача-диетолога и медицинских сестер кабинета лечебного питания.

В санатории проводится диетотерапия при следующих заболеваниях:

  • ожирение
  • сахарный диабет
  • язвенная болезнь желудка и двенадцатиперстной кишки
  • хронический гастрит
  • синдром раздраженного кишечника
  • хронический колит
  • хронический холецистит
  • хронический панкреатит
  • ишемическая болезнь сердца
  • гипертоническая болезнь
  • хроническая сердечная недостаточность
  • дислипидемия
  • подагра
  • метаболический синдром
  • аллергические состояния.

Питание пациентов в санатории  осуществляется по семидневному сезонному (летнему и зимнему) меню по следующим  вариантам  диет:

  • основной вариант диеты
  • основной вариант диеты низкоуглеводный
  • основной вариант диеты щадящий
  • специальная диета гипокалорийная
  • специальная диета профилактическая
  • диета Детокс.

На консультации диетолога пациенту даются рекомендации по лечебному питанию, которые включают не только ограничение в пищевом рационе при болезнях, но также содержат рекомендации по целенаправленному воздействию на биохимические процессы в организме с целью коррекции нарушенного обмена веществ.

Ваша заявка на бронирование № принята. В ближайшее время специалист отдела маркетинга, бронирования и сервиса свяжется с Вами

Роль диеты в этиопатогенезе воспалительных заболеваний кишечника

  • Молодецкий Н.А. и соавт. Увеличение заболеваемости и распространенности воспалительных заболеваний кишечника со временем, на основе систематического обзора. Гастроэнтерология 142 , 46–54.e2 (2012).

    ПабМед Статья Google ученый

  • Бериш Дж., Джесс Т., Мартинато М., Лакатос П. Л. и ЭпиКом Э. Бремя воспалительных заболеваний кишечника в Европе. J. Crohns Colitis 7 , 322–337 (2013).

    ПабМед Статья Google ученый

  • Kappelman, M.D. et al. Распространенность и географическое распространение болезни Крона и язвенного колита в США. клин. Гастроэнтерол. Гепатол. 5 , 1424–1429 (2007).

    ПабМед Статья Google ученый

  • Фергюсон, А., Седжвик, Д. М. и Драммонд, Дж. Заболеваемость юношеским воспалительным заболеванием кишечника: влияние на образование и занятость в раннем взрослом возрасте. Gut 35 , 665–668 (1994).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Каппельман, М. Д. и др. Прямые затраты на здравоохранение при болезни Крона и язвенном колите у детей и взрослых в США. Гастроэнтерология 135 , 1907–1913 (2008).

    ПабМед ПабМед Центральный Статья Google ученый

  • Лонгобарди, Т., Джейкобс, П. и Бернштейн, К. Н. Потери работы, связанные с воспалительным заболеванием кишечника в Соединенных Штатах: результаты национального опроса о состоянии здоровья. утра. Дж. Гастроэнтерол. 98 , 1064–1072 (2003).

    ПабМед Google ученый

  • Франке А.и другие. Полногеномный метаанализ увеличивает до 71 количество подтвержденных локусов предрасположенности к болезни Крона. Нац. Жене. 42 , 1118–1125 (2010).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Кенни, Э. Э. и др. Полногеномное сканирование ашкеназской еврейской болезни Крона предполагает новые локусы восприимчивости. Генетика PLoS. 8 , e1002559 (2012 г.).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Кугатасан, С.& Amre, D. Воспалительные заболевания кишечника — модификация окружающей среды и генетические детерминанты. Педиатр. клин. Северный амер. 53 , 727–749 (2006).

    Артикул Google ученый

  • Tysk, C., Lindberg, E., Jarnerot, G. & Floderus-Myrhed, B. Язвенный колит и болезнь Крона в невыбранной популяции монозиготных и дизиготных близнецов. Изучение наследственности и влияния курения. Гут 29 , 990–996 (1988).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Ng, S.C. et al. Заболеваемость и распространенность воспалительных заболеваний кишечника в мире в 21 веке: систематический обзор популяционных исследований. Ланцет 390 , 2769–2778 (2018).

    ПабМед Статья Google ученый

  • Williams, C. N. Увеличивается ли заболеваемость ВЗК, когда люди перемещаются из зоны низкого риска в зону высокого риска? Воспаление.Кишечник Дис. 14 (Прил. 2), С41–С42 (2008).

    ПабМед Статья Google ученый

  • Проберт, К.С., Джаянти, В., Пиндер, Д., Уикс, А.С. и Мэйберри, Дж.Ф. Эпидемиологическое исследование язвенного проктоколита у индийских мигрантов и коренного населения Лестершира. Gut 33 , 687–693 (1992).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Бенчимол, Э.И. и др. Воспалительные заболевания кишечника у иммигрантов в Канаду и их детей: популяционное когортное исследование. утра. Дж. Гастроэнтерол. 110 , 553–563 (2015).

    ПабМед Статья Google ученый

  • Li, X., Sundquist, J., Hemminki, K. & Sundquist, K. Риск воспалительных заболеваний кишечника у иммигрантов первого и второго поколения в Швеции: общенациональное последующее исследование. Воспаление. Кишечник Дис. 17 , 1784–1791 (2011).

    ПабМед Статья Google ученый

  • Альбенберг, Л. Г. и Ву, Г. Д. Диета и кишечный микробиом: ассоциации, функции и последствия для здоровья и болезней. Гастроэнтерология 146 , 1564–1572 (2014).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Пулис, А., Фостер Р., Шетти А., Фагерхол М.К. и Мендалл М.А. Воспаление кишечника, измеряемое фекальным кальпротектином: связь между факторами образа жизни и риском колоректального рака. Рак Эпидемиол. Биомаркеры Пред. 13 , 279–284 (2004).

    ПабМед Статья КАС Google ученый

  • Мартинес-Медина, М. и др. Западная диета вызывает дисбактериоз с увеличением количества кишечной палочки у мышей CEABAC10, изменяет барьерную функцию хозяина, способствуя колонизации AIEC. Гут 63 , 116–124 (2014).

    ПабМед Статья КАС Google ученый

  • Стенман Л.К., Холма Р., Эггерт А. и Корпела Р. Новый механизм дисфункции кишечного барьера из-за пищевого жира: разрушение эпителия гидрофобными желчными кислотами. утра. Дж. Физиол. Гастроинтест. Физиол печени. 304 , Г227–234 (2013).

    ПабМед Статья КАС Google ученый

  • Халмош, Э.П. и Гибсон, П. Р. Диетическое лечение ВЗК — идеи и советы. Нац. Преподобный Гастроэнтерол. Гепатол. 12 , 133–146 (2015).

    ПабМед Статья КАС Google ученый

  • Боррелли, О. и др. Только полимерная диета по сравнению с кортикостероидами при лечении активной детской болезни Крона: рандомизированное контролируемое открытое исследование. клин. Гастроэнтерол. Гепатол. 4 , 744–753 (2006).

    ПабМед Статья Google ученый

  • Zachos, M., Tondeur, M. & Griffiths, A.M. Терапия энтеральным питанием для индукции ремиссии при болезни Крона. Кокрановская система базы данных. Ред. 1 , CD000542 (2007 г.).

    Google ученый

  • Шарлебуа А., Розенфельд Г. и Бресслер Б. Влияние диетических вмешательств на симптомы воспалительного заболевания кишечника: систематический обзор. Крит. Преподобный Food Sci. Нутр. 56 , 1370–1378 (2016).

    ПабМед Статья КАС Google ученый

  • Перссон, П. Г., Альбом, А. и Хеллерс, Г. Диета и воспалительное заболевание кишечника: исследование случай-контроль. Эпидемиология 3 , 47–52 (1992).

    ПабМед Статья КАС Google ученый

  • Чепмен-Кидделл, К.А., Дэвис П.С., Гиллен Л. и Рэдфорд-Смит Г.Л. Роль диеты в развитии воспалительного заболевания кишечника. Воспаление. Кишечник Дис. 16 , 137–151 (2010).

    ПабМед Статья Google ученый

  • Tragnone, A. et al. Пищевые привычки как факторы риска воспалительных заболеваний кишечника. евро. Дж. Гастроэнтерол. Гепатол. 7 , 47–51 (1995).

    ПабМед КАС Google ученый

  • Уиллетт, В.К., Рейнольдс, Р. Д., Коттрелл-Хёнер, С., Сэмпсон, Л. и Браун, М. Л. Валидация полуколичественного вопросника частоты приема пищи: сравнение с 1-летней записью диеты. Дж. Ам. Доц. диеты 87 , 43–47 (1987).

    ПабМед КАС Google ученый

  • Кольдиц, Г. А., Мэнсон, Дж. Э. и Хэнкинсон, С. Э. Исследование здоровья медсестер: 20-летний вклад в понимание здоровья женщин. J. Womens Health 6 , 49–62 (1997).

    ПабМед Статья КАС ПабМед Центральный Google ученый

  • Анантакришнан, А. Н. и др. Проспективное исследование долгосрочного потребления пищевых волокон и риска развития болезни Крона и язвенного колита. Гастроэнтерология 145 , 970–977 (2013).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Анантакришнан, А.Н. и др. Длительное потребление пищевых жиров и риск язвенного колита и болезни Крона. Гут 63 , 776–784 (2014).

    ПабМед Статья КАС Google ученый

  • Халили Х. и др. Потребление железа с пищей и гемового железа, генетическая предрасположенность и риск болезни Крона и язвенного колита. Воспаление. Кишечник Дис. 23 , 1088–1095 (2017).

    ПабМед ПабМед Центральный Статья Google ученый

  • Беттелли, Э.и другие. Реципрокные пути развития образования патогенных эффекторных Th27 и регуляторных Т-клеток. Природа 441 , 235–238 (2006).

    ПабМед Статья КАС Google ученый

  • Эйл, Р. и др. Ионная иммунная супрессия в микроокружении опухоли ограничивает эффекторную функцию Т-клеток. Природа 537 , 539–543 (2016).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Кляйневитфельд, М.и другие. Хлорид натрия вызывает аутоиммунное заболевание, индуцируя патогенные клетки Th27. Природа 496 , 518–522 (2013).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Ву, К. и др. Индукция патогенных клеток Th27 индуцируемой солечувствительной киназой SGK1. Природа 496 , 513–517 (2013).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Йосеф Н.и другие. Динамическая регуляторная сеть, контролирующая дифференцировку клеток Th27. Природа 496 , 461–468 (2013).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Бао, С. и др. Цинк модулирует врожденный иммунный ответ in vivo на полимикробный сепсис посредством регуляции NF-kappaB. утра. Дж. Физиол. Легочная клетка. Мол. Физиол. 298 , L744–L754 (2010 г.).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Финамор, А., Massimi, M., Conti Devirgiliis, L. & Mengheri, E. Дефицит цинка вызывает повреждение мембранного барьера и увеличивает трансмиграцию нейтрофилов в клетки Caco-2. Дж. Нутр. 138 , 1664–1670 (2008 г.).

    ПабМед Статья КАС Google ученый

  • Прасад, А. С. Цинк: роль в иммунитете, окислительном стрессе и хроническом воспалении. Курс. мнение клин. Нутр. Метаб. Care 12 , 646–652 (2009 г.).

    ПабМед Статья КАС Google ученый

  • Халили Х. и др. Выявление и характеристика новой связи между диетическим калием и риском болезни Крона и язвенного колита. Фронт. Иммунол. 7 , 554 (2016).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Анантакришнан, А.Н. и др. Потребление цинка и риск болезни Крона и язвенного колита: проспективное когортное исследование. Междунар. Дж. Эпидемиол. 44 , 1995–2005 (2015).

    ПабМед ПабМед Центральный Статья Google ученый

  • Риболи, Э. и др. Европейское проспективное исследование рака и питания (EPIC): изучаемые популяции и сбор данных. Опубл. Нутр Здоровья. 5 , 1113–1124 (2002).

    Артикул КАС Google ученый

  • Феррари, П. и др. Внутригрупповые и межгрупповые различия в измеренном потреблении макронутриентов с учетом ошибок измерения в Европейском проспективном исследовании рака и питания. утра. Дж. Эпидемиол. 160 , 814–822 (2004).

    ПабМед Статья Google ученый

  • Харт, А.Р. и др. Диета в этиологии язвенного колита: европейское проспективное когортное исследование. Digestion 77 , 57–64 (2008).

    ПабМед Статья Google ученый

  • ВЗК в исследовании EPIC Investigators et al. Линолевая кислота, диетическая полиненасыщенная жирная кислота n-6 и этиология язвенного колита: вложенное исследование случай-контроль в рамках европейского проспективного когортного исследования. Гут 58 , 1606–1611 (2009).

    Артикул КАС Google ученый

  • Колдер, П. К. Жирные кислоты и воспаление: передний край между едой и фармацевтикой. евро. Дж. Фармакол. 668 (Прил. 1), S50–S58 (2011).

    ПабМед Статья КАС Google ученый

  • Симопулос, А. П. Эволюционные аспекты диеты, соотношение омега-6/омега-3 и генетическая изменчивость: значение питания при хронических заболеваниях. Биомед. Фармацевт. 60 , 502–507 (2006).

    ПабМед Статья КАС Google ученый

  • Чан, С. С. и др. Связь между высоким потреблением с пищей n-3 полиненасыщенных жирных кислот докозагексаеновой кислоты и снижением риска болезни Крона. Алимент. Фармакол. тер. 39 , 834–842 (2014).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Чан, С.С. и др. Потребление углеводов в этиологии болезни Крона и язвенного колита. Воспаление. Кишечник Дис. 20 , 2013–2021 (2014).

    ПабМед ПабМед Центральный Статья Google ученый

  • Расин А. и др. Рацион питания и риск воспалительных заболеваний кишечника в Европе: результаты исследования EPIC. Воспаление. Кишечник Дис. 22 , 345–354 (2016).

    ПабМед Статья Google ученый

  • Опстелтен, Дж.Л. и др. Молочные продукты, диетический кальций и риск воспалительных заболеваний кишечника: результаты европейского проспективного когортного исследования. Воспаление. Кишечник Дис. 22 , 1403–1411 (2016).

    ПабМед Статья Google ученый

  • Bergmann, M.M. et al. Отсутствие связи между употреблением алкоголя и риском язвенного колита или болезни Крона: данные европейского проспективного когортного исследования (EPIC). евро.Дж. Клин. Нутр. 71 , 512–518 (2017).

    ПабМед Статья КАС Google ученый

  • Гавалер, Дж. С., Розенблюм, Э. Р., Дил, С. Р. и Боуи, Б. Т. Конгенеры фитоэстрогенов алкогольных напитков: текущий статус. Проц. соц. Эксп. биол. Мед. 208 , 98–102 (1995).

    ПабМед Статья КАС Google ученый

  • Зайфрид, Х.Э., Андерсон Д.Э., Фишер Э.И. и Милнер Дж.А. Обзор взаимодействия пищевых антиоксидантов и активных форм кислорода. Дж. Нутр. Биохим. 18 , 567–579 (2007).

    ПабМед Статья КАС Google ученый

  • Ямамото Т., Накахигаси М. и Саниабади А. Р. Обзорная статья: диета и воспалительные заболевания кишечника — эпидемиология и лечение. Алимент. Фармакол. тер. 30 , 99–112 (2009).

    ПабМед Статья КАС Google ученый

  • Бартон, Л.Л., Ритц, Н.Л., Фок, Г.Д. и Лин, Х.К. Круговорот серы и кишечный микробиом. Коп. Дис. науч. 62 , 2241–2257 (2017).

    ПабМед Статья КАС Google ученый

  • Kim, I.W. et al. Диеты западного типа индуцируют инфильтрацию макрофагов и способствуют колит-ассоциированному канцерогенезу. Дж. Гастроэнтерол. Гепатол. 25 , 1785–1794 (2010).

    ПабМед Статья КАС Google ученый

  • Бретон, Дж. и др. Внутренние иммуномодулирующие эффекты низкоперевариваемых углеводов избирательно усиливают их противовоспалительный пребиотический потенциал. Биомед. Рез. Междунар. 2015 , 162398 (2015).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Ле Леу, Р.К., Янг, Г.П., Ху, Ю., Винтер, Дж. и Конлон, М.А. Диетическое красное мясо усугубляет колит, вызванный декстрансульфатом натрия, у мышей, тогда как резистентный крахмал ослабляет воспаление. Коп. Дис. науч. 58 , 3475–3482 (2013).

    ПабМед Статья КАС Google ученый

  • Дегань, Э. и др. Подавление сфингозин-1-фосфатлиазы способствует канцерогенезу толстой кишки посредством STAT3-активируемых микроРНК. Дж. Клин. Вкладывать деньги. 124 , 5368–5384 (2014).

    ПабМед ПабМед Центральный Статья Google ученый

  • Янчу, П., Моруа, С., Клавель-Шапелон, Ф., Бутрон-Рюо, М. К. и Карбоннел, Ф. Потребление животного белка и риск воспалительного заболевания кишечника: проспективное исследование E3N. утра. Дж. Гастроэнтерол. 105 , 2195–2201 (2010).

    ПабМед Статья КАС Google ученый

  • Лян, Дж.и другие. Сфингозин-1-фосфат связывает постоянную активацию STAT3, хроническое воспаление кишечника и развитие рака, связанного с колитом. Раковая клетка 23 , 107–120 (2013).

    ПабМед Статья КАС Google ученый

  • Hernandez, A.L. et al. Хлорид натрия ингибирует супрессивную функцию регуляторных Т-клеток FOXP3+. Дж. Клин. Вкладывать деньги. 125 , 4212–4222 (2015).

    ПабМед ПабМед Центральный Статья Google ученый

  • Zhang, W.C. et al. Высокое содержание соли вызывает специфическое состояние активации макрофагов, M(Na). Сотовые Res. 25 , 893–910 (2015).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Хантер, Д. Дж. Взаимодействие генов и окружающей среды при заболеваниях человека. Нац.Преподобный Жене. 6 , 287–298 (2005).

    ПабМед Статья КАС Google ученый

  • Хор Б., Гарде А. и Ксавье Р. Дж. Генетика и патогенез воспалительного заболевания кишечника. Природа 474 , 307–317 (2011).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Леоне В. А., Чам К.М. и Чанг, Э. Б. Диета, кишечные микробы и генетика в иммунной функции: можем ли мы использовать наши текущие знания для достижения лучших результатов при воспалительных заболеваниях кишечника? Курс. мнение Иммунол. 31 , 16–23 (2014).

    ПабМед Статья КАС Google ученый

  • Van Der Sloot, K.W. et al. Висцеральное ожирение, генетическая предрасположенность и риск осложнений у лиц с болезнью Крона. Воспаление. Кишечник Дис. 23 , 82–88 (2017).

    Артикул Google ученый

  • Анантакришнан, А. Н. и др. Генетические полиморфизмы в метаболизме жирных кислот изменяют связь между потреблением пищевых продуктов n3: n6 и риском язвенного колита: проспективное когортное исследование. Воспаление. Кишечник Дис. 23 , 1898–1904 (2017).

    ПабМед Статья Google ученый

  • Костя, И.и другие. Взаимодействия между соотношением полиненасыщенных жирных кислот в рационе и генетическими факторами определяют предрасположенность к болезни Крона у детей. Гастроэнтерология 146 , 929–931 (2014).

    ПабМед Статья КАС Google ученый

  • Hargreaves, C. E. et al. Рецепторы Fcgamma: генетическая изменчивость, функция и заболевание. Иммунол. 268 , 6–24 (2015).

    ПабМед Статья КАС Google ученый

  • Штейн, М.П. и др. Связывание С-реактивного белка с FcγRIIa на моноцитах и ​​нейтрофилах человека является аллель-специфическим. Дж. Клин. Вкладывать деньги. 105 , 369–376 (2000).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Stein, M. P., Mold, C. & Du Clos, T. W. Связывание С-реактивного белка с мышиными лейкоцитами требует Fc-гамма-рецепторов. Дж. Иммунол. 164 , 1514–1520 (2000).

    ПабМед Статья КАС Google ученый

  • Бхарадвадж, Д. и др. Основным рецептором С-реактивного белка на лейкоцитах является рецептор Fcγ II. Дж. Экспл. Мед. 190 , 585–590 (1999).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Чжоу Л. и др. IL-6 программирует дифференцировку клеток T(H)-17, способствуя последовательному включению путей IL-21 и IL-23. Нац. Иммунол. 8 , 967–974 (2007).

    ПабМед Статья КАС Google ученый

  • Fantini, M.C. et al. IL-21 регулирует экспериментальный колит, модулируя баланс между клетками Treg и Th27. евро. Дж. Иммунол. 37 , 3155–3163 (2007).

    ПабМед Статья КАС Google ученый

  • Каспи, А.и другие. Влияние жизненного стресса на депрессию: модерация полиморфизмом в гене 5-НТТ. Наука 301 , 386–389 (2003).

    ПабМед Статья КАС ПабМед Центральный Google ученый

  • Риш, Н. и др. Взаимодействие между геном переносчика серотонина (5-HTTLPR), стрессовыми жизненными событиями и риском депрессии: метаанализ. JAMA 301 , 2462–2471 (2009 г.).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Кау, А.Л., Ахерн П.П., Гриффин Н.В., Гудман А.Л. и Гордон Дж.И. Питание человека, кишечный микробиом и иммунная система. Природа 474 , 327–336 (2011).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Браун, К., ДеКофе, Д., Молкан, Э. и Гибсон, Д.Л. Дисбактериоз кишечной микробиоты, вызванный диетой, и влияние на иммунитет и болезни. Питательные вещества 4 , 1095–1119 (2012).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • D’Haens, G. R. et al. Ранние очаги рецидивирующей болезни Крона, вызванные вливанием кишечного содержимого в исключенную подвздошную кишку. Гастроэнтерология 114 , 262–267 (1998).

    ПабМед Статья Google ученый

  • Sellon, R.K. et al. Резидентные кишечные бактерии необходимы для развития спонтанного колита и активации иммунной системы у мышей с дефицитом интерлейкина-10. Заразить. Иммун. 66 , 5224–5231 (1998).

    ПабМед ПабМед Центральный КАС Google ученый

  • Худкович Т., Степанкова Р., Себра Дж. и Тласкалова-Хогенова Х. Роль микрофлоры в развитии воспаления кишечника: острый и хронический колит, индуцированный декстрансульфатом в стерильных и общепринятых выращивали иммунокомпетентных и иммунодефицитных мышей. Фолиа микробиол. 46 , 565–572 (2001).

    Артикул КАС Google ученый

  • Morgan, X.C. et al. Дисфункция кишечного микробиома при воспалительных заболеваниях кишечника и лечении. Геном Биол. 13 , R79 (2012).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Нагалингам, Н. А. и Линч, С. В. Роль микробиоты при воспалительных заболеваниях кишечника. Воспаление. Кишечник Дис. 18 , 968–984 (2012).

    ПабМед Статья Google ученый

  • Спор, А., Корен, О. и Лей, Р. Раскрытие влияния окружающей среды и генотипа хозяина на микробиом кишечника. Нац. Преподобный Микробиолог. 9 , 279–290 (2011).

    ПабМед Статья КАС Google ученый

  • Ву, Г.Д. и др. Связь долгосрочных моделей питания с кишечными микробными энтеротипами. Наука 334 , 105–108 (2011).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Де Филиппо, К. и др. Влияние диеты на формирование микробиоты кишечника, выявленное сравнительным исследованием детей из Европы и сельских районов Африки. Проц. Натл акад. науч. США 107 , 14691–14696 (2010 г.).

    ПабМед Статья Google ученый

  • Эйссеннаггер, Н.и другие. Микробиота кишечника способствует гиперпролиферации эпителия, индуцированной гем, путем открытия слизистого барьера в толстой кишке. Проц. Натл акад. науч. США 112 , 10038–10043 (2015 г.).

    ПабМед Статья КАС Google ученый

  • Ijssennagger, N., de Wit, N., Muller, M. & van der Meer, R. Пищевая гем-опосредованная активация PPAR-альфа не влияет на гем-индуцированную эпителиальную гиперпролиферацию и гиперплазию в толстой кишке мыши. PLoS ONE 7 , e43260 (2012).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Н., И. Дж. и др. Пищевой гем изменяет микробиоту и слизистую оболочку толстой кишки мыши без функциональных изменений в перекрестных помехах хозяин-микроб. PLoS ONE 7 , e49868 (2012 г.).

    Артикул КАС Google ученый

  • Серегин С.С. и др. NLRP6 защищает мышей Il10 ( -/- ) от колита, ограничивая колонизацию Akkermansia muciniphila. Cell Rep. 19 , 733–745 (2017).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Вернер, Т. и др. Истощение просветного железа изменяет микробиоту кишечника и предотвращает илеит, подобный болезни Крона. Гут 60 , 325–333 (2011).

    ПабМед Статья КАС Google ученый

  • Тернбо, П.Дж., Бакхед Ф., Фултон Л. и Гордон Дж. И. Ожирение, вызванное диетой, связано с заметными, но обратимыми изменениями в микробиоме дистального отдела кишечника мыши. Микроб-хозяин клетки 3 , 213–223 (2008).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • David, L.A. et al. Диета быстро и воспроизводимо изменяет микробиом кишечника человека. Природа 505 , 559–563 (2014).

    ПабМед Статья КАС ПабМед Центральный Google ученый

  • Девкота С. и др. Таурохолевая кислота, индуцированная диетическим жиром, способствует размножению патобионтов и колиту у мышей Il10 -/- . Природа 487 , 104–108 (2012).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Кеванс, Д. и др. Профиль генетического риска ВЗК у здоровых ближайших родственников пациентов с болезнью Крона. J. Crohns Colitis 10 , 209–215 (2016).

    ПабМед Статья Google ученый

  • Кеванс, Д. и др. Детерминанты кишечной проницаемости у здоровых ближайших родственников лиц с болезнью Крона. Воспаление. Кишечник Дис. 21 , 879–887 (2015).

    ПабМед Статья Google ученый

  • Жернакова А.и другие. Популяционный метагеномный анализ выявляет маркеры состава и разнообразия кишечного микробиома. Наука 352 , 565–569 (2016).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Сокол Х. и др. Faecalibacterium prausnitzii представляет собой противовоспалительную комменсальную бактерию, идентифицированную при анализе микробиоты кишечника пациентов с болезнью Крона. Проц. Натл акад. науч. США 105 , 16731–16736 (2008 г.).

    ПабМед Статья КАС Google ученый

  • Имханн, Ф. и др. Взаимодействие генетики хозяина и микробиоты кишечника, лежащее в основе возникновения и клинических проявлений воспалительного заболевания кишечника. Гут https://doi.org/10.1136/gutjnl-2016-312135 (2016).

  • Найтс, Д. и др. Сложная генетика хозяина влияет на микробиом при воспалительном заболевании кишечника. Геном Мед. 6 , 107 (2014).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Терпин В. и др. Ассоциация генома хозяина с микробным составом кишечника в большой здоровой когорте. Нац. Жене. 48 , 1413–1417 (2016).

    ПабМед Статья КАС Google ученый

  • Bonder, M.J. et al. Влияние генетики хозяина на микробиом кишечника. Нац. Жене. 48 , 1407–1412 (2016).

    ПабМед Статья КАС Google ученый

  • Фесканич Д. и др. Воспроизводимость и достоверность измерений потребления пищи с помощью полуколичественного вопросника частоты приема пищи. Дж. Ам. Доц. диеты 93 , 790–796 (1993).

    ПабМед Статья КАС Google ученый

  • Римм Э.и другие. Воспроизводимость и валидность расширенного полуколичественного опросника по пищевым продуктам, заполняемого специалистами здравоохранения. утра. Дж. Эпидемиол. 135 , 1114–1126 (1992).

    ПабМед Статья КАС Google ученый

  • Rockett, H. R. et al. Валидация опросника по частоте приема пищи среди молодежи/подростков. Пред. Мед. 26 , 808–816 (1997).

    ПабМед Статья КАС Google ученый

  • Рокетт, Х.Р., Вольф, А. М. и Кольдиц, Г. А. Разработка и воспроизводимость опросника частоты приема пищи для оценки рациона детей старшего возраста и подростков. Дж. Ам. Доц. диеты 95 , 336–340 (1995).

    ПабМед Статья КАС Google ученый

  • Ascherio, A. et al. Корреляция потребления витаминов А и Е с концентрацией каротиноидов и токоферолов в плазме среди американских мужчин и женщин. Дж. Нутр. 122 , 1792–1801 (1992).

    ПабМед Статья КАС Google ученый

  • Romieu, I. et al. Пищевые предикторы бета-каротина и альфа-токоферола плазмы: проверка опросника частоты пищевых продуктов. утра. Дж. Эпидемиол. 131 , 864–876 (1990).

    ПабМед Статья КАС Google ученый

  • Уиллетт, В.С. и др. Валидация диетического вопросника с уровнем каротиноидов и альфа-токоферола в плазме. утра. Дж. Клин. Нутр. 38 , 631–639 (1983).

    ПабМед Статья КАС Google ученый

  • Джовануччи, Э. и др. Потребление фолиевой кислоты, метионина и алкоголя и риск колоректальной аденомы. J. Natl Cancer Inst. 85 , 875–884 (1993).

    ПабМед Статья КАС Google ученый

  • Хантер Д.Дж. и др. Сравнение показателей потребления жирных кислот с помощью аспирата подкожного жира, опросника по частоте приема пищи и записей о диете у свободноживущих мужчин в США. утра. Дж. Эпидемиол. 135 , 418–427 (1992).

    ПабМед Статья КАС Google ученый

  • London, S.J. et al. Жирнокислотный состав подкожной жировой ткани и диета у женщин в постменопаузе в США. утра. Дж. Клин. Нутр. 54 , 340–345 (1991).

    ПабМед Статья КАС Google ученый

  • Юань, К. и др. Достоверность диетического вопросника оценивается путем сравнения с несколькими взвешенными диетическими записями или 24-часовыми отзывами. утра. Дж. Эпидемиол. 185 , 570–584 (2017).

    ПабМед ПабМед Центральный Статья Google ученый

  • Ордас, И., Экманн Л., Таламини М., Баумгарт Д. К. и Сандборн В. Дж. Язвенный колит. Ланцет 380 , 1606–1619 (2012).

    ПабМед Статья Google ученый

  • Анантакришнан, А. Н. и др. Диета в старшей школе и риск болезни Крона и язвенного колита. Воспаление. Кишечник Дис. 21 , 2311–2319 (2015).

    ПабМед ПабМед Центральный Статья Google ученый

  • Бергманн, М.М. и др. Отсутствие связи между употреблением алкоголя и риском язвенного колита или болезни Крона: данные европейского проспективного когортного исследования (EPIC). евро. Дж. Клин. Нутр. 71 , 566 (2017).

    ПабМед Статья КАС Google ученый

  • Диетический воспалительный потенциал и риск болезни Крона и язвенного колита

    Предыстория и цели

    Воспаление является потенциальным механизмом, с помощью которого диета модулирует начало воспалительного заболевания кишечника.Мы проанализировали данные 3 больших проспективных когорт, чтобы определить влияние воспалительного потенциала пищи на риск развития болезни Крона (БК) и язвенного колита (ЯК).

    Методы

    Мы собрали данные о 166 903 женщинах и 41 931 мужчине в рамках исследования здоровья медсестер (1984–2014 гг.), исследования здоровья медсестер II (1991–2015 гг.) и последующего исследования медицинских работников (1986–2012 гг.). Оценки эмпирического пищевого воспалительного паттерна (EDIP) рассчитывались на основе взвешенных сумм 18 групп пищевых продуктов, полученных с помощью опросников по частоте пищевых продуктов.Самооценка CD и UC была подтверждена просмотром медицинской документации. Модели пропорциональных рисков Кокса использовались для расчета отношения рисков (ОР) и 95% доверительных интервалов (ДИ).

    Результаты

    Мы задокументировали 328 случаев БК и 428 случаев ЯК за 4 949 938 человеко-лет наблюдения. Средний возраст при постановке диагноза ВЗК составлял 55 лет (диапазон 29–85 лет). По сравнению с участниками из самого низкого квартиля кумулятивного среднего балла EDIP, у участников из самого высокого квартиля (самый высокий пищевой воспалительный потенциал) риск развития целиакии был на 51% выше (HR 1.51; 95% ДИ 1,10–2,07; P тренд  = 0,01). По сравнению с участниками с постоянно низкими показателями EDIP (в 2 временных точках, разделенных 8 годами), у участников со сдвигом от низкого к высокому воспалительному потенциалу диеты или постоянно придерживавшихся провоспалительной диеты был более высокий риск CD (ОР 2,05; 95% ДИ 1,10–3,79 и ОР 1,77; 95% ДИ 1,10–2,84). Напротив, воспалительный потенциал пищи не был связан с риском развития язвенного колита ( P тренд = 0,62).

    Выводы

    При анализе 3 больших проспективных когорт мы обнаружили, что режим питания с высоким воспалительным потенциалом связан с повышенным риском БК, но не с ЯК.

    Глютен, болезнь Крона и язвенный колит

    Журнал «Жизнь без глютена» недавно взял интервью у Келли Иссоксон, MS, RD, CNSC, зарегистрированного диетолога в программе «Питание и интегративное воспалительное заболевание кишечника» (IBD) в Cedars-Sinai, о связи между глютеном, болезнью Крона и язвенным колитом.

    В статье цитируется недавнее исследование, которое показало, что почти каждый пятый пациент с ВЗК пробует безглютеновую диету. Из тех, кто решил придерживаться безглютеновой диеты, две трети сообщают об улучшении симптомов, а 38 процентов сообщают о меньшем количестве или менее тяжелых обострениях между периодами ремиссии. Это было крупнейшее исследование безглютеновой диеты у пациентов с ВЗК, включающее в общей сложности 1647 участников.

    Однако Иссоксон говорит, что преимущества безглютеновой диеты могут не иметь непосредственного отношения к глютену.

    «Пищевые продукты, содержащие глютен, также являются важным источником фруктана, типа FODMAP (ферментируемые олигосахариды, дисахариды, моносахариды и полиолы), который связан с функциональными желудочно-кишечными симптомами при синдроме раздраженного кишечника и ВЗК», — сказал Иссоксон Gluten. -Свободная жизнь .

    Согласно статье, недавний анализ, проведенный китайскими исследователями, показал, что у пациентов с ВЗК, находящихся на диете с низким содержанием FODMAP, наблюдалось значительное улучшение многих симптомов.

    «Таким образом, краткосрочная диета с низким содержанием FODMAP или даже диета с уменьшением количества фруктанов может быть лучшим выбором и привести к улучшению симптомов без необходимости соблюдения долгосрочной безглютеновой диеты», — сказал Иссоксон. Жизнь без глютена .

    Иссоксон добавила, что всякий раз, когда пациент заинтересован в переходе на безглютеновую диету, она рекомендует сначала пройти обследование на целиакию. «Тестирование на целиакию имеет много преимуществ, в том числе помогает пациенту понять, насколько строгим он должен быть на безглютеновой диете», — сказал Иссоксон «Жизнь без глютена» .

    Что касается лечения симптомов, Иссоксон также подчеркивает важность сбалансированной диеты для заживления кишечника и общего состояния здоровья, как определенные продукты могут способствовать желудочно-кишечным симптомам, а также о том, как снижение стресса и повышение физической активности могут помочь справиться с симптомами.

    «Ограниченные диеты могут снизить качество жизни, увеличить риск недоедания и замедлить процесс выздоровления. Моя цель — помочь достичь питательного баланса с помощью наименее ограничивающей диеты», — сказал Иссоксон. Статья -Free Living .

    Узнайте больше в блоге Cedars-Sinai: Является ли питание без глютена хорошей идеей?

    Какая диета лучше всего подходит для лечения ВЗК?

    Почти каждый пациент с воспалительным заболеванием кишечника (ВЗК) задается одним и тем же вопросом, на который не так-то просто ответить.

    «Доктор, что мне следует есть, если я живу с ВЗК?» — это, вероятно, наиболее часто задаваемый вопрос после постановки диагноза, — говорит доктор Майтрейи Раман, доцент медицины Университета Калгари.

    Раман, гастроэнтеролог, врач-диетолог и исследователь, внимательно изучил эту тему и рассмотрел имеющиеся данные о диетических схемах, которые могут быть полезными (или нет) для пациентов.

    ВЗК включает болезнь Крона, которая может вызывать воспаление в любой части пищеварительного тракта и обычно поражает тонкий кишечник; язвенный колит, ограниченный толстой или толстой кишкой и прямой кишкой; и неопределенный колит, который имеет черты как болезни Крона, так и колита.Симптомы всех форм ВЗК включают диарею, спазмы и боль в животе, утомляемость и непреднамеренную потерю веса.

    Учитывая разрушающий жизнь характер хронического состояния, пациенты часто очень мотивированы попробовать различные методы лечения, которые могут принести облегчение, в том числе изменить свой рацион.

    «Роль диеты как фактора риска и терапии ВЗК вызывает большой интерес у пациентов», — говорит Раман, соавтор обзора диет при ВЗК, опубликованного в журнале Clinical Gastroenterology and Hepatology в марте 2021 года.Эти результаты показывают, что эксклюзивное энтеральное питание является наиболее хорошо поддерживаемым подходом, но не для всех. Другие планы, такие как специальная углеводная диета, также могут быть полезны.

    К сожалению, существует относительная нехватка исследований по наилучшей диете при ВЗК. Тем не менее доказательств становится все больше. Раман отмечает, что за последнее десятилетие наука и понимание микробиома кишечника, состоящего из триллионов бактерий (полезных и вредных), развились.Дисбаланс бактерий в кишечнике может вызвать множество проблем со здоровьем и может способствовать ВЗК. И диета может иметь большое значение.

    Недавние высококачественные рандомизированные контролируемые исследования показали, что изменения в диете улучшают симптомы ВЗК, уменьшают воспаление кишечника и улучшают результаты лечения пациентов, объясняет Раман.

    Прежде чем углубляться в варианты того, что вы можете положить на свою тарелку и в свое тело, если у вас ВЗК, знайте, что эксперты подчеркивают, что диетические изменения не являются полной заменой медицинского лечения.

    «Диета — это один из многих методов лечения», — говорит доктор Джеймс Льюис, заместитель директора Программы воспалительных заболеваний кишечника в Медицинской школе Перельмана Пенсильванского университета. «В то время как стратегия, основанная на диете, может быть предпочтительной и практичной для некоторых пациентов, ее может быть намного сложнее реализовать для других пациентов». Некоторые диеты при ВЗК довольно ограничительны, и любые существенные изменения в привычках питания могут быть трудными для поддержания. Тем не менее, многие пациенты, особенно с заболеванием легкой и средней степени тяжести, рассматривают диету как один из вариантов лечения ВЗК.

    Эксперты рекомендуют пациентам обращаться за профессиональной помощью для разработки индивидуального плана питания. Терезия Алчуфете, ведущий диетолог UPMC Total Care в Университете Питтсбурга, подчеркивает, что выбор диеты должен быть адаптирован к каждому человеку.

    Рассмотрите свои цели, связанные не только с ВЗК, но и с общим состоянием здоровья. И убедитесь, что основное внимание уделяется тому, что вы можете есть, а не только тому, что вы устраняете.Альшуфете рассказывает пациентам о том, как делать осознанный выбор, стремясь увеличить разнообразие и питательные вещества. «Моей целью для каждого пациента было бы начать строить эти позитивные отношения с едой — действительно понять, какие продукты могут помочь им чувствовать себя хорошо».

    Эксклюзивное энтеральное питание

    Наиболее широко изученная и подтвержденная данными диета при ВЗК — и, в частности, при болезни Крона — представляет собой полностью жидкую диету на основе формулы, заменяющую прием пищи. Это называется эксклюзивным энтеральным питанием, и обычно его назначают и контролируют врачи.Чаще всего рекомендуется для детей, его можно употреблять, выпивая специальную смесь, приготовленную врачом, или вводить через зонд для кормления, вставленный через нос пациента в желудок.

    Имеются убедительные доказательства того, что это приводит к уменьшению воспаления и улучшению заживления, и это сравнимо с лечением стероидами, помогая пациентам достичь ремиссии болезни Крона, что означает, что болезнь больше не активна. Он также работает относительно быстро.Краткосрочные программы эксклюзивного энтерального питания рассчитаны на достижение ремиссии в течение 6–12 недель.

    Однако в основном его изучали у детей, а не у взрослых. И есть еще более очевидный недостаток: сложно придерживаться диеты «с точки зрения качества жизни, поскольку она требует полного отказа от нормальной пищи», — говорит доктор Ашвин Анантакришнан, гастроэнтеролог из Центра лечения заболеваний пищеварительного тракта в Массачусетсе. Больница.

    CD-TREAT

    Были попытки повторить успех исключительно энтерального питания с помощью твердой пищи.Небольшое исследование 2019 года, опубликованное в Gastroenterology , показало, что потребление индивидуальной диеты на основе «обычных продуктов» с составом, аналогичным исключительно энтеральному питанию, получившего название CD-TREAT, привело к изменениям в микробиоме, которые отражали изменения, обнаруженные при исключительно энтеральном питании. Диета также была связана с уменьшением воспаления кишечника и хорошо переносилась детьми и взрослыми в исследовании.

    CD-TREAT назначается и персонализируется врачом или диетологом и исключает определенные пищевые компоненты, такие как глютен (то есть без пшеницы), лактозу и алкоголь.Он включает в себя все макроэлементы (с большим количеством белков и жиров и меньшим количеством углеводов) и уменьшает количество клетчатки. Таким образом, человек может съесть, например, рисовую кашу с немолочным жирным молоком на завтрак, жареный сыр на безглютеновом хлебе с яблоком на обед и жареный лосось с картофелем и нарезанным огурцом на ужин.

    Хотя необходимы дополнительные исследования, полученные результаты обеспечивают основу для лечения активной болезни Крона, не полагаясь на жидкую диету.

    Диета, исключающая болезнь Крона

    Успешные диеты при ВЗК исключают традиционную западную диету, богатую красным мясом, сладкую, переработанную, которая наносит ущерб здоровью кишечника. Исследования показывают, что переход к такому способу питания во многом виноват в росте заболеваемости ВЗК — даже на Востоке, например в Японии, где также была принята западная диета.

    Чтобы противостоять этому, диета исключения болезни Крона направлена ​​​​на то, чтобы исключить основные продукты западной диеты, такие как переработанное мясо, искусственные подсластители и алкоголь, которые могут повлиять на здоровье кишечника.Данные высококачественных сравнительных испытаний демонстрируют эффективность диеты в облегчении симптомов и уменьшении воспаления, и она может начать работать в течение трех-шести недель.

    Исследование, опубликованное в 2019 году в журнале Gastroenterology , продемонстрировало, что у детей с болезнью Крона легкой и средней степени тяжести исключающая диета при болезни Крона может вызывать и поддерживать ремиссию. Последующее исследование, опубликованное в ноябре 2021 года в журнале Lancet Gastroenterology & Hepatology , показало, что он эффективен для индукции и поддержания ремиссии у взрослых с болезнью Крона легкой и средней степени тяжести.

    Но, как следует из названия, исключающая диета при болезни Крона очень ограничительна. В исследовании 2021 года, посвященном изучению этого подхода, участникам разрешалось есть только куриную грудку, яйца и частичное энтеральное питание — или жидкие смеси для получения части калорий — в качестве источников животного белка, и ограничивалось определенными фруктами и овощами в качестве источников животного белка. первые шесть недель. Вторая шестинедельная фаза включала постепенное введение почти всех фруктов и овощей при ограничении говядины и бобовых и разрешении одного ломтика цельнозернового хлеба в день.

    Этот 12-недельный период, называемый фазой индукции, наиболее важен для достижения ремиссии. Третий шестинедельный период, поддерживающая фаза, добавляет больше продуктов, чтобы сделать диету более устойчивой при сохранении результатов.

    Даже с этими корректировками диета может стать проблемой для соблюдения в долгосрочной перспективе и требует тщательного планирования и домашней кухни, говорит доктор Хенит Янаи, глава Центра ВЗК в Медицинском центре Рабина в Петах-Тикве. , Израиль.

    Специфическая углеводная диета

    Специфическая углеводная диета, которая представляет собой беззерновую элиминационную диету, основана на идее о том, что потребление определенных сложных углеводов питает нездоровые бактерии, вызывая избыточный рост этих «плохих» бактерий в тонком кишечнике. Это, в свою очередь, может способствовать воспалению.

    Основываясь на этой концепции, диета избегает всего, от столового сахара до зерновых, включая пшеницу и кукурузу, крахмалистых продуктов, таких как картофель, и других исключений.Приверженцы, однако, могут есть мясо, рыбу и птицу без добавок, овощи (свежие или замороженные, но не консервированные с какими-либо добавками), а также большинство орехов и масел. Они также могут использовать мед в качестве подсластителя.

    Тем не менее, эксперты выражают озабоченность по поводу способности пациентов соблюдать диету и советуют, чтобы план питания контролировался врачом-диетологом.

    Средиземноморская диета

    Средиземноморская диета — еще один подход, рекомендуемый некоторым пациентам с ВЗК.Он хорошо изучен и широко рекламируется за его общие преимущества, в том числе для здоровья сердца и мозга. Лучше всего то, что этот стиль питания рекомендуется почти всем, и ему легче следовать, чем более строгим диетам. Если вы будете следовать этому плану, вы будете есть фрукты и овощи, цельнозерновые продукты, орехи и нежирный белок, такой как рыба.

    Средиземноморская диета была представлена ​​в редком и известном прямом сравнении диет при ВЗК, проведенном Льюисом и названном исследованием DINE-CD.Исследование, опубликованное в мае 2021 года в журнале Gastroenterology, , противопоставило его диете с определенными углеводами. В исследовании приняли участие более 190 пациентов с болезнью Крона легкой и средней степени тяжести.

    Исследование показало, что обе диеты одинаково помогли пациентам достичь симптоматической ремиссии и улучшить качество их жизни. Ни один из вариантов не оказал существенного влияния на биомаркер, используемый для измерения воспаления, что, как было задокументировано, помогает улучшить диета исключения болезни Крона.

    Но поскольку средиземноморский подход позволяет употреблять самые разнообразные продукты и лучше изучен с точки зрения его общей пользы для здоровья, Льюис и другие врачи, как правило, рекомендуют именно его, а не конкретную углеводную диету.

    Диета с низким содержанием FODMAP

    Пациенты, у которых болезнь Крона хорошо контролируется в отношении воспаления, но которые все еще страдают от симптомов раздраженного кишечника, могут получить пользу от диеты с низким содержанием FODMAP. (Это обозначает ферментируемые олиго-, ди-, моносахариды и -полиолы.Эта диета, предназначенная в первую очередь для лечения СРК, направлена ​​на исключение углеводов с короткой цепью или сахаров, которые плохо всасываются в тонком кишечнике. Продукты, которые ограничиваются или избегаются при этой диете, изначально включают пшеницу, молочные продукты, некоторые фрукты, такие как яблоки, и овощи, такие как артишоки и спаржа.

    «Если у людей есть сильная боль и вздутие живота, а больше ничего не работает, то, возможно, я могу попробовать элиминационную диету FODMAP», — говорит доктор.Джин Фокс, гастроэнтеролог из клиники Майо в Рочестере, штат Миннесота. Но обычно пациенты следуют этому подходу под наблюдением диетолога, поэтому они не продолжают ограничительную фазу более шести недель.

    После этого, на этапе повторного введения, в течение шести-восьми недель постепенно вводят продукты, чтобы определить, какие из них могут вызывать проблемы. После определения того, что может вызывать симптомы, этих продуктов можно избегать или ограничивать. Обратной стороной, по словам Фокса, является то, что пациенты, которые не видят облегчения симптомов после этой диеты, могут без необходимости ограничивать широкий спектр продуктов.

    Больше обязательных к прочтению историй от TIME


    Свяжитесь с нами по телефону по адресу [email protected]

    Рекомендации по питанию при воспалительных заболеваниях кишечника | Факты о здоровье и питании для вас | Пациенты и семьи

    Воспалительное заболевание кишечника (ВЗК) — это термин, используемый для описания двух заболеваний, вызывающих воспаление желудочно-кишечного тракта (ЖКТ): болезнь Крона и язвенный колит .Оба могут вызвать язвы или язвы в желудочно-кишечном тракте. Это может повлиять на то, как организм усваивает пищу, или сделать его трудным или болезненным при приеме пищи.

    Симптомы IBD

    • в брюшной полости

    • диарея с крови

    • лихорадка

    • Бедный рост у детей

    • потеря веса

    • rail тьли

    • тошнота и рвота

    Почему еда, которую я ем, важна?

    Пища, которую вы едите, обеспечивает ваш организм витаминами, минералами, белками и калориями, необходимыми для роста и поддержания здоровья.Людям с ВЗК нелегко усваивать питательные вещества из продуктов, которые они едят; и, следовательно, им нужно больше витаминов, минералов, белков и калорий, чем другим людям. У них больше шансов плохого роста и недоедания. Они могут есть меньше, потому что плохо себя чувствуют, или боятся есть, потому что от еды им становится хуже.

    Что мне есть и пить?

    Соблюдайте высококалорийную диету с высоким содержанием белка. Стремитесь к сбалансированному питанию, включающему продукты из всех пищевых групп (зерновые, молоко и заменители молока, мясо и заменители мяса, фрукты и овощи).

    Пища, которую вы едите, должна основываться на том, что вам нравится и что может выдержать ваше тело.

    Непереносимость лактозы часто встречается у людей с болезнью Крона, но у некоторых людей нет проблем при употреблении молочных продуктов.

    Старайтесь есть чаще, но меньшими порциями и перекусывать (каждые 3–4 часа)

    Если вам больно есть или вы теряете вес, попробуйте такие добавки, как Boost, Sure и Breakfast Essentials .

    Ваши потребности в жидкости увеличиваются при хронической диарее и острых обострениях.Пейте больше жидкости во время приступов (>/= 8 чашек в день).

    Когда ваше заболевание активно, диета с низким содержанием клетчатки и жиров может уменьшить симптомы.

    При активном ВЗК может помочь:

    • Ограничить употребление молочных продуктов с высоким содержанием лактозы.

      • Вы можете приготовить йогурт с живыми активными культурами или йогурты в греческом стиле.

      • Возможно, вы справитесь с твердыми сырами, такими как чеддер и швейцарский.

      • Попробуйте миндальное или кокосовое молоко, безлактозное молоко (например, Lactaid®) или используйте таблетки с лактазой.

    • Ограничьте употребление фруктозы.

      • Большое количество содержится во фруктовых соках, газированных напитках, меде и сухофруктах.

    • Ограничьте сорбит (используется в качестве подсластителя, часто используется в леденцах/шоколадах без сахара).

    • Ограничьте употребление продуктов с высоким содержанием жира, таких как масло, сливки, красное мясо, шоколад, жареное или фаст-фуд.

    • Ограничьте употребление продуктов с высоким содержанием клетчатки, таких как цельнозерновые продукты, бобы, фрукты и овощи с кожурой .

      • Вы можете обращаться с фруктами и овощами со снятой кожурой.

      • Фрукты с низким содержанием клетчатки включают дыню, медвяную росу, мандарины, фруктовый коктейль и яблочное пюре. Из овощей попробуйте цуккини, желтый кабачок и болгарский перец.

      • Попробуйте хорошо приготовленные овощи и овощной сок.

      • Попробуйте зерновые продукты с низким содержанием клетчатки, такие как белый хлеб, белый рис и макароны, а также хлопья и крекеры с низким содержанием клетчатки.

    • Кофеин, кислые продукты и алкоголь могут усилить обострение.

    Это может помочь вести дневник питания. Ваш врач-диетолог может вместе с вами просмотреть ваш журнал питания и помочь определить пищевые триггеры, а также продукты, которые могут улучшить ваши симптомы.

    Должен ли я принимать дополнительные витамины и минералы?

    Да, вам следует принимать комплексные поливитамины с минералами.

    Если вы принимаете стероиды или ограничиваете потребление молочных продуктов, вам также следует дополнительно принимать кальций (500 мг 3 раза в день) и витамин D (800–1000 МЕ в день).

    Если вы принимаете сульфасалазин, вам может потребоваться прием фолиевой кислоты.

    Дефицит железа и витамина B12 часто встречается при ВЗК, поэтому вам может потребоваться сдать анализы крови для измерения этих питательных веществ.

    При продолжительной диарее вам также могут понадобиться добавки с магнием, цинком и калием. Напиток с электролитом, такой как Drip Drop, может помочь вернуть эти питательные вещества в ваш организм.

    Проконсультируйтесь с врачом, если вы беспокоитесь о своем питании.

    Как насчет других добавок для лечения ВЗК?

    Могут быть полезны пребиотики, пробиотики, рыбий жир и льняное масло.Необходимо провести дополнительные испытания. Некоторые пациенты обнаружили, что они помогают поддерживать здоровье кишечника или уменьшают симптомы. Другие не видят никаких изменений в своих симптомах.

    Пребиотики  – это тип клетчатки, которая помогает поддерживать здоровье кишечника. Они способствуют развитию «дружественных» бактерий в кишечнике. Лук, чеснок, бананы, спаржа, авокадо и некоторые цельнозерновые злаки являются хорошими источниками этой клетчатки.

    Пробиотики  – это живые бактерии, поддерживающие здоровье кишечника.Их называют «хорошими микробами». Вы можете найти их в таких продуктах, как йогурт, и на этикетке будет написано «Живые, активные культуры». Торговая марка VSL # 3 может помочь людям с язвенным колитом и резервуарным илеитом.

    Витамин D : Низкий уровень витамина D может вызвать более тяжелое ВЗК, которое подвергает пациентов повышенному риску хирургического вмешательства, пребывания в больнице, рака толстой кишки и инфекции C-diff. Прием добавки витамина D улучшает активность болезни и качество жизни.

    Жир морской рыбы и льняное масло содержат омега-3 жирные кислоты, которые могут облегчить симптомы ВЗК.Если ваше тело может справиться с рыбой, попробуйте есть рыбу, такую ​​как лосось, треска и тунец, несколько раз в неделю. Вы также можете найти рыбий жир и льняное масло в форме капсул.

    Куркума   или куркумин  может действовать как противовоспалительное средство. Употребление специи в пищу или в виде капсул может быть полезным.

    Поговорите со своим врачом, прежде чем начинать принимать какие-либо добавки.

    Чтобы узнать больше о ВЗК, посетите:

    Teach Back

    • Что самое важное вы узнали из этого материала?

    • Какие изменения вы внесете в свой рацион/образ жизни на основе того, что узнали сегодня?

    Если вы являетесь пациентом UW Health и у вас есть дополнительные вопросы, свяжитесь с UW Health по одному из телефонных номеров, указанных ниже.Вы также можете посетить наш веб-сайт по адресу www.uwhealth.org/nutrition.

    В поликлиники диетологии UW Hospital and Clinics (UWHC) и American Family Children’s Hospital (AFCH) можно позвонить по телефону: (608) 890-5500 .

    В клиники диетологии Медицинского фонда UW (UWMF) можно позвонить по телефону: (608) 287-2770 .

    Диета с высоким содержанием жиров способствует возникновению язвенного колита, индуцированного DSS, за счет подавления экспрессии FXR через путь TGFB

    Язвенный колит является одним из ВЗК, вызывающим хроническое воспаление кишечника и дисфункцию слизистого барьера.На данный момент заболеваемость ЯК неуклонно растет во всем мире. Он стал новым независимым фактором риска ряда тяжелых заболеваний, особенно рака толстой и прямой кишки. Однако этиология НЯК оставалась неясной. Предыдущие исследования показывают, что диета с высоким содержанием жиров способствовала патогенезу нарушения регуляции иммунной системы, а фарнезоидный X-рецептор (FXR) также был вовлечен в патогенез различных воспалительных симптомов. Тем не менее, их внутренняя роль в патогенезе ЯК не упоминалась.В этом исследовании мы стремимся исследовать роль FXR в UC. Диета с высоким содержанием жиров (HFD) способствует прогрессированию язвенного колита, вызванного DSS, показывает увеличение секреции желчных кислот в сыворотке и приводит к подавлению генов-мишеней FXR (FXR α , Shp и lbabp). Добавление агониста FXR FexD восстанавливает фенотип, вызванный диетой с высоким содержанием жиров, тогда как ингибитор TGFBRI SB431542 отменяет восстановление FexD у мышей с ЯК, индуцированным DSS. Чтобы дополнительно проверить взаимосвязь между сигнальным путем FXR и TGFB, мы создали модель UC-HFD в клеточной линии Caco2.Результаты показывают тот же вывод, что FXR смягчает воспаление ЯК посредством TGFB-зависимого пути. Эти результаты расширяют роль FXR при язвенном колите и позволяют предположить, что активацию FXR можно рассматривать как терапевтическую стратегию при язвенном колите.

    1. Введение

    Язвенный колит (ЯК) – одно из воспалительных заболеваний кишечника, возникающее в результате нарушения иммунной системы слизистой оболочки и приводящее к активизации хронического воспаления кишечника и структурной дисфункции желудочно-кишечного тракта [1].В отличие от болезни Крона (БК), которая может возникнуть в любом отделе желудочно-кишечного тракта, ЯК преимущественно поражает толстую и прямую кишку [2]. Симптомы язвенного колита обычно разнообразны, например диарея, спазмы в животе, боль в прямой кишке и кровь в стуле. Более того, в нескольких исследованиях показано, что язвенный колит является независимым фактором риска рака толстой и прямой кишки [3–5]. Заболеваемость и распространенность ЯК в последнее время неуклонно растут во всем мире [6]. На данный момент его этиология остается неясной.

    Предыдущие исследования показали, что этиология и патология ЯК были многофакторными, в первую очередь связаны с чувствительностью кишечника к иммунологическим стимулам и приводили к дисфункциональной активации ответа иммунной системы слизистой оболочки [7].Дисфункция слизистого барьера приводит к увеличению проницаемости кишечника и, в конечном итоге, к воспалению кишечника с участием иммунных клеток. Существующие терапевтические варианты, такие как анти-TNF- α антитело инфликсимаб, 5-аминосалициловые кислоты и кортикостероид преднизолон, в основном использовались для подавления иммунной системы и преднамеренных симптомов у пациентов [8].

    Хотя на желудочно-кишечные проблемы, вызванные язвенным колитом, влияют несколько состояний, роль диеты с высоким содержанием жиров в их течении часто недооценивается.Согласно исследованиям Magro et al., повышенное потребление холестерина и животных жиров может увеличить заболеваемость ЯК [9]. Исследование Degirolamo et al. показывает, что HFD приводят к эквивалентному усилению желчных кислот [10], которые являются мощными индукторами ЯК, из-за гидрофобной природы вторичных желчных кислот литохолевой кислоты и дезоксихолевой кислоты, способствующих эффектам кишечной проницаемости [11, 12].

    Трансформирующий фактор роста Белки β относятся к семейству полифункциональных полипептидов, продуцируемых множественными лимфоидными и нелимфоидными клетками [13].ЯК — это разновидность воспалительного заболевания кишечника. Сообщалось, что TGFB1-3 является ключом к регуляции иммунных клеток. Продукция TGFB также связана с патогенезом колита, что означает, что патология ЯК может быть вызвана нарушением пути TGFB.

    Фарнезоидный Х-рецептор (FXR) является одним из ядерных рецепторов, отвечающих за поглощение питательных веществ и устранение токсичных пищевых компонентов; в основном регулирует гомеостаз желчных кислот через ось кишечник-печень и, в конечном итоге, поддерживает основные аспекты кишечного барьера [14, 15].Хотя взаимосвязь HFD, FXR и UC была исследована, внутренние механизмы остаются неясными. Здесь мы предполагаем, что FXR смягчает воспаление слизистой оболочки, вызванное HFD, посредством активации пути TGFB.

    2. Результаты
    2.1. HFD способствуют прогрессированию ЯК, вызванного DSS, у мышей

    Чтобы понять вклад диеты в прогрессирование ЯК, мышей лечили 3,5% DSS в течение недели для развития симптомов ЯК, например, диареи, ректального кровотечения, и потеря веса, а затем мы поддерживаем DSS-индуцированных мышей с обычной диетой или HFD в течение 2 недель.Ежедневное изменение массы тела и DAI показано на рисунках 1(a) и 1(b); по сравнению с группой, получавшей DSS, масса тела в группе, получавшей комбинацию DSS и HFD, значительно снижалась с 5-го по 14-й день (DSS по сравнению с DSS+HFD, по сравнению с , ), а для сравнения DAI двойное лечение также приводит к значительному увеличению количества мышей среди групп (DSS по сравнению с DSS + HFD, по сравнению с , ).

    Затем мы оценили общее содержание БА в сыворотке у мышей, индуцированных DSS, на ND и HFD; мы обнаружили, что между группой DSS и группой DSS-HFD было примерно 3-кратное увеличение (рис. 1 (c)).Таким образом, HFD способствуют прогрессированию ЯК, вызванного DSS, у мышей.

    2.2. FXR уменьшает повреждение тканей у мышей, индуцированных DSS

    FXR является одним из ядерных рецепторов, которые главным образом регулируют гомеостаз желчных кислот. Значительное увеличение желчных кислот в группе DSS-HFD дало нам ключ к пониманию того, что FXR может быть вовлечен в симптомы язвенного колита, усугубляемые диетой с высоким содержанием жиров. Так, мы исследовали уровень экспрессии мРНК генов FXR α , Shp и lbabp, являющихся генами-мишенями FXR [16].Как показано на рисунке 1(d), все они резко уменьшились в группе, получавшей DSS плюс диету с высоким содержанием жиров, по сравнению с другими группами. А в группе, получавшей только DSS, они также значительно уменьшились в группе, получавшей носитель.

    Затем мы проверяем функцию FXR в смягчении UC, вызванного DSS-HFD. Мы добавляем агонист FXR FexD в ежедневный рацион группы DSS-HFD. Мы обнаружили, что FexD компенсирует фенотип ЯК, вызванный двойным лечением HFD и DSS. Показатель DAI и потеря массы тела были значительно снижены по сравнению с группой HFD-DSS (рис. 2(a) и 2(b)).Концентрация желчных кислот в сыворотке также заметно снижается при лечении FexD; однако он был в некоторой степени заблокирован ингибитором TGFBRI SB431542 (рис. 2(c)). Окрашивание HE толстой кишки оценивало гистологические изменения. Лечение DSS вызвало утолщение мышц, повреждение крипт и инфильтрацию лимфоцитов, а HFD усугубляет симптомы; однако добавление агониста FXR FexD значительно уменьшало эти симптомы (рис. 2(d)).

    2.3. Агонист FXR активировал передачу сигналов TGFB у мышей, получавших DSS-HFD

    Поскольку было высказано предположение, что путь TGFB связан с восстановлением DSS-индуцированного язвенного колита, мы исследовали ключевой медиатор для инициации нижестоящего сигнального каскада TGF-бета, фосфорилированные формы TGFBRI и SMAD2 в группе DSS-HFD после лечения FexD с помощью вестерн-блоттинга.Наши данные показали, что TGFBRI и SMAD2 были значительно активизированы.

    Чтобы дополнительно подтвердить, является ли путь TGFB важным для связанного с FXR восстановления ЯК, мы ингибируем передачу сигналов TGFB с помощью ингибитора TGFBRI SB431542 у мышей DSS-HFD, получавших FexD. Мы обнаружили, что обработка SB431542 значительно компенсировала увеличение сигнала TGFB в толстой кишке мышей DSS-HFD, получавших FexD, что приводило к нарушению снижения DAI и уменьшению местного воспаления (рис. 2 (a)–2 (d)). Вестерн-блот обработанного белка ткани толстой кишки показывает, что FexD может повышать экспрессию TGFBRI и уровень фосфорилирования smad2.

    Затем мы подвергли эпителиальные клетки толстой кишки (Caco2) воздействию пальмитиновой кислоты (PA) и TNF- α , чтобы имитировать HFD в ситуации с язвенным колитом. PA- и TNF- α -индуцированное увеличение цитокинов воспаления резко ингибировалось агонистом FXR FexD, а ингибитор TGFBRI SB431542 (Selleck) может устранять влияние FexD. Следовательно, эти результаты показывают, что активация FXR может облегчить колит, вызванный DSS, за счет усиления передачи сигналов TGFB (рис. 3).


    3.Материал и метод
    3.1. Животные и лечение

    6-недельных самцов мышей C57BL/6 (18–20 г) приобретали в центре лабораторных животных SLAC; все мыши имеют степень SPF (Шанхай, Китай). Для индукции язвенного колита мышам ежедневно давали 3,5% DSS (MP Biomedicals) в воде с обычным рационом в течение недели, а затем их рацион был изменен на корм с высоким содержанием жиров, который был приобретен у XIETONG SHENGWU (XT101

    -1). ), содержащие 60% энергии из жира еще на 2 недели.Для экспериментов с агонистом FXR фексарамин D растворяли в кукурузном масле в концентрации 50 мг/кг с ингибитором TGFBRI SB431542 (Selleck) или без него, а затем через желудочный зонд в течение 7 недель мышей, получавших DSS, на HFD в течение 2 недели. Показатель DAI и гистопатологические показатели мышей оценивали, как описано в предыдущей работе [17].

    3.2. Клеточная культура и обработка

    Клеточная линия Caco2 была приобретена в Американской коллекции типовых культур. Его культивировали в среде DMEM с высоким содержанием глюкозы (HyClone) с добавлением 10% FBS (Gibco), 100  мкг/мл мкг/мл пенициллина и стрептомицина при 37°C с 5% CO 2 в клеточном инкубаторе.Клетки обрабатывали 100 нг/мл TNF- α , 100 мк М пальмитиновой кислоты, 10 мк М FexD и 10 мк М SB431542 в течение 12 часов.

    3.2.1. Вестерн-блоттинг и количественная ПЦР в реальном времени (qRT-PCR)

    Обработанную ткань толстой кишки мышей и культивированные клетки свежеприменяли для экстракции тотальной РНК с использованием протокола реагента TRIzol (Invitrogen). Затем проводили количественную ПЦР в реальном времени, как описано выше. Вкратце, 1  мкг г общей РНК подвергали обратной транскрипции в кДНК, а затем кДНК проводили с использованием системы SYBR (Takara) в соответствии с инструкциями производителя на машине для ПЦР в реальном времени ABI 7500.Уровень экспрессии мРНК рассчитывали по методике; окончательные значения были нормализованы к экспрессии мРНК GAPDH. Праймеры для gapdh, FXR α , Shp и lbabp, использованные для количественной ОТ-ПЦР, показаны в таблице 1. При проведении вестерн-блоттинга белки разделяли на геле SDS-PAGE с различной концентрацией (7,5%-10%) и затем отделенный белок переносили из геля на нитроцеллюлозные (НЦ) мембраны и блотировали соответствующими первичными антителами, затем соответствующими вторичными антителами, а затем обнаруживали с помощью хемилюминесцентной системы ECL. Первичными антителами, использованными в этом исследовании, были анти- β -актин 13E5, CST), p-Smad2 (D43B4, CST) и анти-TGFBRI (ab31013 Abcam).

    + + + + 9162 9

    QRT-ПЦР-праймер вперед (5-3) Обратный (5-3)

    GAPDH (мышь) AGGTCGGTGTGAACGGATTTG GGGGTCGTTGATGGCAACA
    FXR α (мышь) GCACGCTGATCAGACAGCTA CAGGAGGGTCTGTTGGTCTG
    Shp (мышь) GTACCTGAAGGGCACGATCC GTGAAGTCTTGGAGCCCTGGT
    lbabp (мышь) CACCATTGGCAAAGAATGTG AACTTGTCACCCACGACCTC
    GAPDH (человек) GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATG
    91 622 ФНО- α (человек) CACATCTCCCAACACCTTAACTT CCTCTCTCTAATCAGCCCTCTG
    91 622 ИЛ-6 (человек) ACTCACCTCTTCAGAACGAATTG CCATCTTTGGAAGGTTCAGGTTG ИЛ девяносто одна тысяча шестьсот двадцать две-1 β (человек) ATGATGGCTTATTACAGTGGCAA GTCGGAGATTCGTAGCTGGA
    ИЛ девяносто одна тысяча шестьсот двадцать две-8 (человек) ACTCCAAACCTTTCCACC CTTCTCCACAACCCTCTG

    3.3. Статистический анализ

    Данные представлены в виде . Для сравнения двух групп независимых выборок использовали непарный двусторонний критерий Стьюдента. Множественный сравнительный анализ был проведен односторонним ANOVA. Для статистического анализа использовали программное обеспечение SPSS Statistics версии 20.0 и программное обеспечение GraphPad Prism 6. Все статистические тесты со значением <0,05 считались значительно измененными.

    4. Обсуждение

    В последние годы в связи с изменением образа жизни и пищевых привычек заболеваемость ЯК во всем мире постепенно увеличивается и тесно связана с заболеваемостью колоректальным раком.Исследования [18] показали, что колоректальный рак, связанный с ЯК, составляет лишь 1-2% всех случаев колоректального рака, но на него приходится 15% факторов, вызывающих смерть у пациентов с ЯК. Можно считать, что онкологические заболевания ЯК являются одной из основных причин смерти больных ЯК. Однако этиология и патогенез до сих пор не ясны. В настоящее время считается, что изменения в среде обитания, пищевых привычках, иммунной системе, генетике и других факторах могут играть важную роль в процессе канцерогенеза ЯК.

    Диета с высоким содержанием жиров тесно связана с возникновением колита и колоректального рака. Недавнее исследование [19] доказало, что диета с высоким содержанием жиров может увеличивать распространенность ЯК у мышей. У мышей с колитом, которым давали пищу с высоким содержанием жиров, наблюдалось усиление локального воспаления в толстой кишке, что указывает на то, что диета с высоким содержанием жиров может быть патогенным фактором ЯК. Механизм может заключаться в метаболическом разложении липидов в пищеварительном тракте, таких как вторичная желчная кислота и сероводород, которые повреждают микроокружение кишечника и вызывают воспаление слизистой оболочки толстой кишки.Постоянное накопление воспалений может привести к возникновению дисплазии и даже рака. Диета с высоким содержанием жиров является основной причиной ожирения, а ожирение рассматривается большинством исследователей как «вялотекучее воспалительное состояние». Воспаление, связанное с ожирением, играет важную роль в возникновении и развитии рака [20]. В настоящее время отсутствуют соответствующие экспериментальные и клинические исследования влияния диеты с высоким содержанием жиров на рак ЯК.

    ИЛ-6 представляет собой тип полипотентного цитокина, который соединяется с рецепторами с образованием комплекса ИЛ-6/ИЛ-6R/gpl30 для передачи сигнала, вызывая активацию активатора транскрипции 3 и затем проявляя свою биологическую функцию.Его основные биологические функции включают регуляцию иммунного ответа и системы кроветворения, индукцию белков острой фазы и регуляцию роста опухоли. При воспалительном заболевании кишечника, будь то болезнь Крона или язвенный колит, CD4+ Т-клетки, которые поддерживают хроническое воспаление толстого кишечника, в основном полагаются на антиапоптотический эффект ИЛ-6, который является основным цитокином в развитии воспалительного заболевания кишечника. При постепенном прогрессировании воспалительного заболевания кишечника и возможной эволюции опухолей ИЛ-6 не только помогает опухолевым факторам и способствует возникновению аномальных клеток, но также оказывает антиапоптотическое действие на Т-клетки и опухолевые клетки [21].Исследования [22] подтвердили, что блокирование опосредованной антителами передачи сигналов IL-6 может задержать образование связанного с ЯК колоректального рака, вызванного химическими канцерогенами.

    ЯК является рецидивирующим заболеванием. Продолжительность начала и периода ремиссии различается. Рецидивирующее воспаление приводит к атипичной гиперплазии слизистой оболочки кишечника и даже раку. Трудно собрать несколько циклов клинических случаев. Основным методом исследования является создание соответствующей животной модели. Этот эксперимент доказывает, что колит, вызванный DSS, похож на поражения толстой кишки человека.Патология толстой кишки может проявляться образованием эрозий и язв, а также инфильтрацией большого количества воспалительных клеток, а поражения ограничиваются слизистой оболочкой и подслизистой оболочкой.

    Являясь важным иммуномодулирующим фактором, TNF- α оказывает сильное провоспалительное действие и вырабатывается и высвобождается иммунными клетками и макрофагами. TNF- α может дополнительно активировать NF- κ B; стимулируют экспрессию провоспалительных факторов IL-1, IL-6, IL-8 и IFN- γ ; ингибировать экспрессию IL-10; способствовать воспалению; повышают проницаемость эпителиальных клеток; и инициируют цитотоксичность, апоптоз и реакцию острой фазы, что, в свою очередь, вызывает повреждение слизистой оболочки кишечника [23].

    Таким образом, наше исследование продемонстрировало, что FXR смягчает воспаление ЯК посредством TGFB-зависимого пути. Эти результаты расширяют роль FXR при язвенном колите и позволяют предположить, что активацию FXR можно рассматривать как терапевтическую стратегию при язвенном колите.

    Доступность данных

    Данные, связанные с нашими результатами, могут быть предоставлены, когда они потребуются.

    Конфликт интересов

    Авторы заявляют об отсутствии конфликта интересов.

    Благодарности

    Эта работа была поддержана грантами Национального фонда естественных наук Китая (No.81700480).

    Диета при болезни Крона

    Если у вас болезнь Крона, вы точно знаете, насколько трудным может быть выбор следующего приема пищи. Но вполне возможно разработать план здорового питания, который обеспечит вас необходимыми питательными веществами и калориями, а также исключит триггерные продукты, провоцирующие симптомы.

    Болезнь Крона, тип раздраженного кишечника, который вызывает хроническое воспаление желудочно-кишечного тракта (ЖКТ), может затруднить переваривание и усвоение необходимых питательных веществ из пищи.В результате пища, которую вы едите, может иметь большое влияние на то, как вы будете себя чувствовать после этого. Неприятные симптомы, которые могут возникнуть в результате болезни Крона, включают диарею, газы, вздутие живота, боль в животе, судороги и даже недоедание. В некоторых случаях это также может привести к анемии и снижению уровня витамина B12, фолиевой кислоты и железа.

    К счастью, есть способы избежать обострения симптомов и даже способствовать заживлению желудочно-кишечного тракта.

    Один из советов: есть три раза в день небольшими порциями и перекусывать между каждым приемом пищи, чтобы избежать переедания, которое, как было установлено, еще больше затрудняет пищеварение.

    Хотя некоторые продукты, несомненно, усугубляют болезнь Крона, есть и другие продукты, которые могут быть полезны для страдающих болезнью Крона. На самом деле, некоторые из них действительно содержат важные питательные вещества, которые способствуют здоровому пищеварению, и их обязательно следует включить в свой рацион. Вот что вы должны добавить в свой список покупок:

    • Миндальное молоко
    • Яйца
    • Овсянка
    • Супы на овощной основе
    • Лосось
    • Птица
    • Тропические фрукты, включая бананы, папайю, манго и дыню
    • Пюре из бобов
    • Авокадо
    • Салат с маслом
    • Жареный красный перец (с кожурой)
    • Белый рис
    • Мягкое арахисовое масло/миндальное масло

    Важно отметить, что не все могут переносить одни и те же продукты; то, что может быть безопасным для одного, может вызвать симптомы у другого.

    Добавить комментарий

    Ваш адрес email не будет опубликован.