Морская капуста при гастрите: 🚩 Страница не найдена – Все о морепродуктах

Содержание

Вкусные рецепты на диете при гастрите | ЛАМИНАЛЬ

            Многие не понаслышке знают о том, что такое диета при гастрите, которая включает ограниченный набор рецептов при приготовлении блюд. Гастрит – воспаление слизистой оболочки желудка, и практически половине жителей страны знакомы симптомы этой болезни. Для снижения болевых синдромов, а также для профилактики гастрита рекомендуется придерживаться диеты на основе нежирных, хорошо проваренных продуктов, исключая резкие на вкус, острые и другие раздражающие компоненты.

            Здоровье человека вообще в значительной степени связано с питанием, соблюдение определённых правил при составлении рациона обеспечивает профилактику многих заболеваний. Основная рекомендация здоровой диеты – умеренность в количестве и разнообразие по составу. Для успешной работы различных систем организма необходимо регулярное поступление с пищей множества незаменимых веществ: минералов, витаминов, жиров и аминокислот определённой структуры. Ограничения касаются животных жиров, легкоусвояемых углеводов (сахаров), а также продуктов, прошедших отдельные виды обработки (копчение, жарение, посол и хранение с консервантами). Для здорового питания приветствуются блюда на основе широкого перечня овощей и фруктов (от моркови и помидоров до авокадо и рукколы), нежирного мяса животных и птиц, любые виды морепродуктов и рыбы (в том числе жирной), прошедшие умеренную тепловую обработку.

             Большой перечень допустимых продуктов даёт широкие возможности для рецептов на разные вкусы. Не стоит забывать об умеренном использовании пряностей, соусов, экзотических масел (например, кунжутного). Стоит находить и пробовать новые продукты, например: кокосовое молоко, морские водоросли, тропические фрукты, мясо северного оленя. Вы узнаете новые вкусы, а главное – обогатите свой рацион новыми полезными веществами, которые, возможно, очень нужны вашему организму. Любой экзотический продукт содержит уникальный комплекс микроэлементов, липидов, ферментов, который формируется его средой произрастания или проживания. И если он придётся по вкусу, то скорее всего будет полезным для вас.

            Особое внимание в ряду диетических продуктов широкого назначения стоит обратить на морские водоросли. В странах азиатско-тихоокеанского региона (Япония, Корея) с регулярным потреблением водорослей связывают достижение жителями активного долголетия. Морские водоросли (например, морская капуста) содержат богатый комплекс макро- и микроэлементов (поскольку в морской воде, среде их обитания, представлена практически вся таблица Менделеева), незаменимые липиды (в том числе полиненасыщенные жирные кислоты класса омега-3), пищевые волокна (клетчатку, альгиновую кислоту и другие полисахариды). Состав ламинарии обеспечивает её востребованность при профилактике и лечении хронического гастрита. Большое значение для достижения терапевтического эффекта имеет способ переработки ламинарии в готовый для употребления продукт.

 

Природный гель ламинарии

             Те, кто находил ламинарию в море в виде больших бурых листов с ажурными краями, наверняка запомнил ощущение её скользкой поверхности, как бы покрытой тонким слоем влажного геля. Даже будучи выброшенными волной на берег моря водоросли будут долго и с неохотой расставаться с влагой под палящими лучами солнца, сохраняя вязкую плёнку на своей поверхности. Этот загустевший гель на ощупь напоминает протёртую кашу-размазню, так знакомую человеку на диете. И это сравнение вполне оправданно.

            Гель на поверхности ламинарии образовывается благодаря высокомолекулярным полисахаридам в её составе, которые отличаются сильными влагоудерживающими свойствами. Такой гель соответствует требованиям к продуктам, которые используют в диете при гастрите. Но напрямую принимать ламинарию неэффективно – она выделяет мало природного геля, а сам лист водоросли имеет жёсткую, волокнистую структуру. Эта проблема была успешно решена: ученые ТИНРО создали продукт, в котором морская капуста целиком была превращена в гель из высокомолекулярных полисахаридов. Это сделало биогель удобным для ежедневного применения. С начала 90-х годов прошлого века его стали производить под товарным знаком «Ламиналь»®.

            В настоящее время биогель «Ламиналь»® является официально зарегистрированным специализированным пищевым продуктом для диетического профилактического и диетического лечебного питания для людей с заболеваниями желудочно-кишечного тракта.

 

Ламиналь – полезно и вкусно

             Для приёма внутрь «Ламиналь»®  предварительно разбавляют кипячёной водой до состояния жидкого киселя. Полученный напиток в чистом виде имеет лёгкий привкус водорослей, однако это не ограничивает возможностей изменения вкуса продукта. Вместо кипяченой воды можно использовать фруктовые или ягодные соки, раствор сахара или мёда. Популярный вариант диетического напитка получается при растворении «Ламиналь»® в смеси яблочного и апельсинового сока. В него можно дополнительно добавить немного молока, и получится замечательный молочный коктейль, который с удовольствием пьют дети, не догадываясь о том, что основу напитка составляет гель из водорослей.

        Приём таких напитков натощак – хорошая профилактика болевых синдромов хронического гастрита. Они незаменимы и в качестве быстрого перекуса на бегу, ведь при гастрите нежелательны длительные перерывы между приемами пищи, когда сам желудочный сок становится раздражителем органов желудочно-кишечного тракта. «Ламиналь»®  успешно нейтрализует избыточную кислую среду в желудке, при этом он создает на некоторое время защитную плёнку на внутренней слизистой оболочке.

            Сказанное выше не ограничивает все возможности использования геля из ламинарии. Наверняка ваша фантазия найдёт новые возможности для вкусных рецептов на диете при гастрите.

15 самых полезных свойств морской капусты

Морская капуста, полезная, съедобная водоросль. Она относится к классу бурых морских водорослей, которые отличаются богатым набором полезных микроэлементов и питательных веществ. Водоросли выцеживают из морской воды, а затем перерабатывают в приемлемую для человеческого организма форму.

Что входит в состав морской капусты?

  • полный набор макро- и микроэлементов таких как фосфор, натрий, железо, магний, йод.
  • все витамины из группы B, а также в большом количестве E, A, C и D. Причем витаминов и микроэлементов в морской капусте в несколько раз больше, чем в обычной.
  • природные энтеросорбенты под названием «Альгинаты». Они предназначены для избавления организма от токсинов, ионов, радионуклидов и болезнетворных бактерий.
  • стерины, которые препятствуют скапливанию излишком холестерина и разжижают кровь, тем самым уменьшая тромбообразование сосудов.
  • органически связанная форма йода, которая поддерживает баланс данного элемента в организме.
  • пищевые волокна, они же пектины, помогающие налаживать работу пищеварительной системы и желудочно-кишечного тракта.
  • жирные кислоты, предотвращающие появление атеросклероза в старости.
  • белки и самые полезные для организма аминокислоты.
  • полисахариды высокомолекулярного типа, которые приводят в норму обмен веществ, следят за уровнем холестерина, баланса воды и соли, не дают образоваться тромбам в крови.

Полезные свойства морской капусты

Морская капуста применяется при лечении следующих заболеваний:

  • заболевания щитовидной железы
  • профилактика онкологии
  • способствует очищению организма
  • авитаминоз
  • анемия
  • ожирение
  • запоры
  • улучшает обмен веществ
  • иммуностимулирующее действие
  • антисклеротическое действие
  • снижает плохой холестерин
  • снижает тромбообразование
  • улучшает память
  • помогает бороться со стрессом, упадком сил, депрессией
  • повышает либидо

Ламинария – один из самых насыщенных йодом продуктов, который помогает выводить из организма вредные вещества, в том числе свинец и тяжёлые металлы. Йод также хорошо влияет на состояние щитовидной железы, в частности лечит эндемичный зоб, гипертиреоз, Базедову болезнь. Таким больным, живущим на Дальнем Востоке, рекомендуется в пищу употреблять хлеб, который выпекается с добавлением ламинарии. Если у вас есть хлебопечка, то вы тоже можете сами производить такой хлеб с лечебным действием, если будете добавлять 0,4 мг порошка сухой морской капусты на 1 кг хлеба.

Ламинарией можно лечить хронические анатомические запоры, делая настой на сухом порошке или измельченной морской капусты. Морская капуста благодаря безопасному и мягкому воздействию на кишечник, способна безболезненно выводить из него застоявшиеся образования и в целом благотворно влияет на весь процесс пищеварения.

Настой из сухой ламинарии можно использовать от затяжного стресса. За счёт богатого бромом и витаминами группы В состава морская капуста успокаивает и приводит нервную систему в норму. Ламинария благоприятно воздействует на ЦНС, делает работоспособность организма выше, делает человека сильнее умственно и физически. 

Полезные свойства морской капусты используют для профилактики и дополнительного лечебного средства при артериосклерозе. Если вы включите морскую капусту в свое ежедневное меню, то избыток холестерина перестанет откладываться на стенках сосудов и станет выводиться из организма. Кроме того, ламинария содержит в своем составе такое полезное вещество как ламинин, которое имеет способность нормализовать кровяное давление. Не зря морскую капусту признали одним из самых полезных продуктов для продления молодости и долголетия.

Доказано, что ламинария – мощный афродизиак, она способна лечить хвори, которые связаны с гормонами. Также она помогает поддерживать в тонусе и выступать как профилактическое средство против женских болезней – воспаления придатков, заболеваний матки и трихомонадном кольпите.

Морскую капусту применяют как эффективное средства избавления от ангины, и как хорошее средство для укрепления иммунитета, который, как известно, стоит на защите нашего организма от простуды и инфекций.

Широкое применение среди жителей Дальнего Востока получила морская водоросль при лечении подагры, воспаленных суставах и других ревматических заболеваний: для этого 2 столовые ложки сухой ламинарии залейте в термосе 1 л горячей воды и дайте настояться в течение 10 часов. Вылейте настой в тазик и подержите больное место в течение 15-20 минут (температура настоя 37-38 градусов). Затем вытрете насухо и укутайте чем-нибудь теплым. Такие ванночки рекомендуется делать через день до полного исчезновения болей в суставах.

Низкая заболеваемость раком молочной железы у японок, учеными объясняется, постоянным присутствием ламинарии в их рационе.

Кому нельзя употреблять морскую капусту?

Ламинария не показана тем, у кого аллергия на йод. Её не рекомендуется есть и принимать в порошковом виде беременным, страдающим крапивницей, ринитом, угревыми сыпями, фурункулёзом. К числу людей, которым нельзя есть морскую капусту, относятся страдающие нефритом, туберкулёзом, болезнями желудка и кишечника в острой стадии, геморроем, нефрозом и любыми другими заболеваниями почек.

Как употреблять морскую капусту

Сколь же в день рекомендовано съедать морской капусты, и может ли ее чрезмерное употребление нанести вред организму?

В профилактических и лечебных целях достаточно съедать в день 2 чайной ложки сухой морской капусты. Вы можете пить из нее настои, добавлять ее как полезную приправу (вместо соли) в супы, соусы, салаты, овощные пюре, предварительно перемолов ее в муку.

Если в рационе слишком часто будет появляться морская капуста, то в итоге это может привести к развитию фурункулеза. Поэтому всего, как говорится, должно быть в меру.
Какую капусту лучше не употреблять в пищу?
Если водоросль была извлечена из вод Баренцева моря, то её лучше не покупать, так как известно о сильных загрязнениях воды в этом регионе. Поэтому интересуйтесь производителем готового продукта.

Не рекомендуется брать маринованную и консервированную морскую капусту – в ней содержатся вредные для здоровья добавки, это вызывает сомнение  в ее полезных свойствах. Поэтому покупайте сушёную ламинарию, которая всегда продается в аптеках. Она бывает в виде пластин, брикетов, измельченная, а также в виде порошка. При ее изготовлении было только извлечена влага, а все ценные витамины и микроэлементы сохранились полностью.

Как морская капуста помогает похудеть?

Ценная водоросль – весьма низкокалорийный, диетический продукт, в 100 г ее содержится всего 5,4 ккал. Она способствует похудению, заполняя желудок и вызывая чувство насыщенности. Кроме того, она поглощает жидкости и заполняет кишечник, расщепляет жировые клетки. Все это дает возможность успешно ее использовать для снижения лишнего веса и в борьбе с целлюлитом.

Можно ли морскую капусту при гастрите

Морская капуста была известна человечеству еще с древних времен. Это питательный, полезный, а главное – полностью натуральный продукт с уникальным составом. Даже несмотря на масштабное развитие фармакологии, появление сотен препаратов для лечения болезней, морская капуста при гастрите желудка остается на хорошем счету у гастроэнтерологов. Целебные свойства водоросли достаточно изучены, чтобы рекомендовать ее всем больным. Вместе с икрой морские водоросли способны творить настоящие чудеса.

Полезный состав ламинарии

Чтобы убедиться, можно ли морскую капусту при гастрите, предлагаем рассмотреть ее состав более детально. Ламинария (научное название водоросли) содержит множество питательных веществ. Из витаминов изобилуют А и К, практически вся группа В. Легкоусвояемых белков тоже достаточно.

Настоящей проблемой для жителей России является нехватка йода. Употребление йодированной соли – не выход из ситуации, ведь сам по себе этот продукт вреден для организма. А вот морская капуста – совсем другое дело. Вы удивитесь, но состав ламинарии отдаленно напоминает человеческую кровь.

Благодаря такому сбалансированному составу, морепродукт прекрасно зарекомендовал себя в лечении, профилактике:

  • Онкологии.
  • Болезней верхних дыхательных путей.
  • Сердечно-сосудистых нарушений.

Антимикробная активность морской капусты обусловлена наличием особых активных веществ. Также в ней обнаружили хлорофилл. Он заживляет раны и язвочки, восстанавливает клетки.

Польза при гастрите

Можно или нет морскую капусту при гастрите, ведь водоросли содержат полисахариды? Безусловно, ведь именно они играют решающую роль. Достаточно вспомнить, какими симптомами сопровождается это заболевание:

  • Ухудшение моторики.
  • Ноющие боли.
  • Метеоризм, утренняя тошнота.
  • Различные диспепсические расстройства.

Когда гастрит сопровождается запорами, ламинария выполняет функцию легкого слабительного. Она способна ликвидировать проблемы с кишечником, восстановить нормальную работу пищеварительной системы, купировать боль в желудке при гастрите.

Когда воспаление слизистой желудка вызвано тяжелым отравлением солями металлов, внезапным заражением радиацией, морепродукт помогает вывести токсины, радионуклиды. Противопоказаний практически нет – разве что острая форма заболевания, чувствительность к йоду. Великолепной репутацией пользуется морская капуста при гастрите с повышенной кислотностью в натуральном виде.

Похожие записи

капустный салат

Капуста — как много в этом слове! Всего 100 гр. этого полезного овоща обеспечит суточную потребность организма в витамине С (аскорбинке), а по содержанию лишь немного уступает лимону, который считается чуть ли не панацеей от различных простуд и инфекций. Однако стоит лимону полежать в холодильнике хотя бы неделю, то количество аскорбинки в полезном цитрусе уменьшится на треть, тогда как капуста сохраняет витамин С чуть ли не всю зиму.

Содержащаяся в капусте тартрановая кислота нормализует жировой обмен, задерживает превращение углеводов в жир, тем самым замедляя старение организма. Однако эта кислота разрушается при тепловой обработке, поэтому людям с избыточной массой тела капусту надо есть в свежем виде, но она вредна для слабого желудка.

Отмечено положительное действие сока капусты при болезнях печени, а её свежий сок рекомендуется при гастрите с пониженной кислотностью, спастическом и язвенном колитах, атонии кишечника, заболевании почек и мочевыводящих путей, гиповитаминозах. Он также обладает противокашлевым и смягчающим действиями, в связи с чем его назначают при бронхитах. Под действием  капустного сока усиливается перистальтика кишечника, улучшается всасывание, ускоряется эвакуация его содержимого, уменьшаются боли в области печени, исчезают диспепсические явления и уменьшаются размеры печени.

Салаты — частые гости на наших столах. Например в нашей семье принято подавать салат перед подачей основной пищи (к примеру на ужин). Вот сегодня я и спешу рассказать Вам о простом рецепте приготовления лёгкого салата, но очень вкусного, здорового и питательного. Для этого нам не потребуется много ингредиентов, ведь этот салат готовится исключительно из овощей, поэтому всё делаем быстро и салат готов за 5-10 минут.

Потребуется: количество приготовленного салата рассчитано на 4-5 порций.
  • Капуста — у меня молодой кочан — количество капусты Вы берёте необходимое для себя — примерно 1/2 часть от среднего вилка.
  • Морковь — свежая 1-2 шт.
  • Приправа — у меня для корейской моркови — примерно 1-2 ст.л.
  • Соль — по вкусу.
  • Сахар — 1-2 ст.л. (по вкусу)
  • Уксус (9%) или яблочный — 1 дес.л.
  • Горошек консервированный — 1 б.
  • Масло растительное (не рафинированное) — для заправки салата.
  • Зелень — для подачи салата.

 

Как приготовить вкусный капустный салат к ужину:

Первым делом я готовлю морковь. Делается она по принципу корейской моркови, но без кипящего растительного масла (хотя можно в этот салат добавить и приготовленной корейской моркови). Нарезаю морковь длинной соломкой (или натираем её на тёрке для приготовления корейской моркови). Присыпаем морковь солью и сахаром, добавляем приправу для корейской моркови или любую другую универсальную приправу. И тщательно руками мнём морковь. чтобы она дала сок и стала мягкой. Это займёт примерно 2-3 минуты. Даём моркови постоять и ещё больше обмякнуть.

Теперь нам нужно тонко нашинковать молодую капусту и также её помять руками до характерного выделения сока и мягкости капусты. Это я делаю прямо на разделочной доске или в глубокой миске. Когда капуста обмякла, добавляем её к моркови, сдабриваем уксусом и тщательно перемешиваем. Ни в коем случае не должно быть сильного запаха и вкуса уксуса — его мы просто добавляем для небольшой кислинки.

Если требуется Вы можете на свой вкус добавить ещё приправы — варьируйте на свой вкус. Может кому-то не хватит соли или наоборот сахара.

В почти готовый салат добавляем растительное масло и консервированный зелёный горошек. Я непременно пользуюсь в приготовлении такого салат именно растительным маслом с запахом — не рафинированным. На мой вкус оно придаёт более яркий, насыщенный аромат нашему салату. Перемешиваем салат с горошком, украшаем сверху зеленью и подаём к столу. Думаю, Ваши домашние съедят этот салат  просто мгновенно. Я например очень его люблю и могу его кушать в любое время. Вот такой он простой и вкусный. Пожалуйста, кому тарелочку с салатом? Угощайтесь мои дорогие — на здоровье!

Приятного аппетита желает Всем Светлана и моя домашняя kulinarochka2013.ru!

 

Как приготовить не менее вкусный и полезный, витаминный салат из капусты по-корейски Вы найдёте в пошаговом рецепте с фото

Хотите получать новые рецепты на почту?

Корабли и капуста – Аналитика

Но, если уж речь зашла о капусте, то это – весьма полезный продукт! В апельсинах и лимонах витамина “C” столько же, сколько в свежей белокочанной, но в брюссельской и цветной капусте – витамина “C” больше, чем в цитрусовых! К сожалению, об этом мало кто знает. Однако морская капуста – не менее ценный кладезь витаминов. Впрочем, в своей крови и лимфе мы с момента рождения носим частичку моря! Ведь кровь и морская вода по химическому составу очень похожи, а потому – нам полезна любая капуста. Вообще-то свое название капуста получила благодаря округлой форме кочана, напоминающей голову человека. Слово “капуста” происходит от латинского – “капут” – “голова”. Разновидностей капусты много – краснокочанная (листья ее окрашены антоцианами в красный, красно-лиловый цвет), брюссельская (очень маленькие кочанчики), цветная (кочан собран из белых, плотно прилегающих соцветий), брокколи (соцветия темно-зеленые и неплотно прилегают друг к другу), кольраби (напоминает по форме репку, редьку), но самая лучшая и ценная из них во всех отношениях – белокочанная капуста. Этот овощ у хороших хозяек в течение всего года: в борще, в щах, в пирожках, в свежем виде – в салате, в квашеном виде – в винегрете, и просто квашеная с картошкой! Капуста прекрасно хранится, меньше других овощей теряя витамин “C”. Та капуста, которой пришлось долежать до весны, сохраняет около 30 % аскорбиновой кислоты, тогда как в яблоках остается менее 1 %, а в картофеле – около 5 %. Квашеная капуста витамином “C”, пожалуй, даже богаче, чем свежая, – в квашеной почти 40 % витамина “C”, так как при квашении образуются дополнительные количества этого витамина из родственных ему веществ. Однако, надо заметить, что много витамина “C” только в той капусте, которая хранится в собственном рассоле. В капусте есть витамин “U”, который хорошо сохраняется при сушении и при замораживании, однако он разрушается при нагревании, поэтому тем, кто лечит язву, нужно есть разнообразные салаты из свежей капусты, и капустный сок, считающийся противоязвенным средством, разумеется, целесообразнее употреблять свежим. Родина капусты – Средиземноморье. Известно, что выращивают ее еще с 3-го тысячелетия до новой эры. Однако из более чем 100 видов капусты (листовой, белокочанной и краснокочанной, кольраби, савойской, брюссельской, цветной, кормовой, китайской, пекинской и многих других сортов) наибольшее распространение получила белокочанная капуста, – она занимает, как правило, более 30 % площадей, занятых овощами. Сто одежек, и все – без застежек В качестве лекарства белокочанную капусту применяли еще в Древнем Риме, а на Руси капустой лечили болезни печени, селезенки, кожи (экзему, язвы). В капусте содержатся в малом количестве углеводы и жиры, в то же время она богата солями калия, железа, кальция и фосфора, а также витаминами – каротином, “P”, “K”, “C”, “B1”, “B2”, “B6”, фолиевой кислотой, холином. Аскорбиновая кислота в капусте находится в связанной форме – это вещество называется аскорбиноген. Еще в начале 50-х годов (теперь уже прошлого столетия) было обнаружено, что свежий сок капусты излечивает язву желудка, что объясняется наличием в капусте, точнее, в капустном соке, противоязвенного витамина “U”. Сок капусты полезен также и при гастрите с пониженной кислотностью, холецистите, язвенном колите и даже при воспалительных гинекологических заболеваниях! История медицины хранит описание следующего эксперимента: группа больных (82) человека лечилась капустным соком. У 24 человек была язва желудка и двенадцатиперстной кишки, у 52 – был хронический гастрит, у 6 (шести) пациентов – холангиогепатит (воспалительное заболевание желчных путей и печени). В результате лечения капустным соком у всех больных исчезли (или почти исчезли, значительно уменьшились) боли в животе, прекратились тошнота и рвота, изжога, нормализовалась кислотность желудочного сока; при нормальной кислотности желудочного сока изменений не произошло. У пациентов, больных холангиогепатитом, уменьшились размеры печени (!), прекратились боли, тошнота, рвота, нормализовался состав желчи. Известно также, что фитонциды капусты активны в отношении золотистого стафилококка, возбудителя туберкулеза, а также других патогенных микробов. Ценный список витаминов В свежей белокочанной капусте содержится столько же витамина “C” (45-60 мг %), сколько в апельсинах или лимонах, а в брюссельской и цветной капусте – в 1,5 – 2 раза даже больше (70 – 120 мг %), богаты этим витамином капуста кольраби (в ней 50 мг %) и краснокочанная (60 мг %). В разных видах капусты содержится каротин (0,06 – 0,3 мг %), витамины: “E” (0,1 – 1 мг %), “B6” (0,1 – 0,28 мг %), “PP” (0,3 – 0,8 мг%), “B1” (0,02 – 0,1 мг %), “B2” (0,04 – 0,2 мг %), фолацин (10 – 30 мкг %). По содержанию витамина “P” – капуста чемпион среди овощей. Капуста содержит и витамин “I”, который рассматривается как противоязвенный фактор. Кроме того, это источник комплекса минеральных веществ (калий – 185 мг %, магний – 16, сера – 37, фосфор – 31, железо – 0,6, марганец – 0,17, медь – 0,8, цинк – 0,4 мг %), сахаров (46 %, в основном глюкоза, фруктоза), клетчатки (1 %), пектина (0,6 %), органических кислот (0,2 %). Капуста малокалорийна, что позволяет включать ее в меню больных, страдающих избыточным весом. В пищу капусту употребляют в сыром, жареном, тушеном, вареном виде; однако капусту можно и заготавливать впрок, – ее квасят в бочках, маринуют, консервируют (в банках), даже сушат. Весной, когда в нашем организме иссякает “запас” витаминов, очень ценным блюдом может быть салат из свежей капусты, – мелко, тонко нарезанной, слегка подсоленной, а затем и “подавленной” деревянным пестиком, после чего ее еще надо приправить майонезом, добавив мелко нарезанную петрушку и укроп. Рецепты от ученого Биолог О.А. Колесова предлагает хороший рецепт для разнообразия вашего меню: Рулет №1 (из капусты) Необходимо для блюда: 1 кочан (средний) капусты, 300 граммов мяса, 20-30 граммов масла, неполный стакан молока, 2 столовые ложки манной крупы, 1 луковица, 30 граммов зелени, 0,5 стакана муки, 0,5 стакана сметаны, одно яйцо. Нарезают мелко капусту, кладут в кастрюлю, добавляют молоко, масло и тушат на медленном огне. Через некоторое время всыпают тонкой струйкой манную крупу и очень тщательно размешивают. Закрывают кастрюлю крышкой и варят минут 10, после чего добавляют сырое яйцо. Поджаривают в кипящем масле (в отдельной посуде) мясо и мелко нарезанный лук, пропускают через мясорубку. Получилось два фарша, – капустный и мясной. Мокрое полотенце отжимают и кладут на него тонким слоем капустный фарш (или капустное “тесто”), затем мясной, края “теста” соединяют, защипывая. Получившийся рулет аккуратно перекладывают на противень, предварительно смазанный маслом. Обмазывают рулет сметаной, добавив в нее немного муки, и ставят в духовку. На стол лучше подавать со сметаной. Рулет №2 1 кг картофеля, 1 стакан муки, 2 яйца, 1 столовая ложка сыра тертого (можно больше), 100 граммов помидоров, 2 стакана лукового соуса, 0,5 кочана капусты, 150 граммов лука репчатого, перец, соль – по вкусу. Картофель, отваренный в кожуре, перетирают с мукой, капусту, обжаренную с луком и помидорами, заливают яйцом и тушат, начинку заворачивают в полученное картофельное тесто, смазывают рулет яйцом, посыпают тертым сыром и запекают в духовке в течение 15 минут. Морская капуста В нашей крови есть частица моря, – кровь и морская вода по химическому составу очень похожи. Море издревле давало людям пищу – рыбу, моллюсков, еще много чего вкусного, а у иных берегов – и морские водоросли. Теперь-то уже доподлинно известно, что водоросли – древнейший представитель жизни. Морская капуста – наиболее популярная употребляемая в пищу морская водоросль. Научное название морской капусты – “ламинария” произошло от латинского “lamina”, означающего в переводе “пластинка”. Строки из энциклопедического словаря: “ламинария – род бурых водорослей, слоевище состоит из пластины шириной до 0,5 м, длиной до 5 м (иногда до 25 м) и ствола с ризоидами при основании. Около 30 видов, на территории СНГ – 17 видов. Преимущественно растет в холодных морях, некоторые виды съедобны, применяют в медицине”. Итак, слоевище этих водорослей, как известно, представляет собой лентообразные пластины, иногда гладкие, порой – морщинистые. Эти морские “пластины” порой достигают длины до 25 метров. Морская капуста – витаминное сокровище моря. Первое упоминание в литературе СНГ о морских водорослях принадлежит перу выдающегося ученого С.П. Крашенинникова, в середине 18 века посетившего Камчатку: “Есть еще морская трава Яранга, которая около Лопатки выметывается из моря и видом походит на усы китовые. Оную траву курилы мочат в студеной воде и пьют от великого резу”. Уже в то время (в 18 веке), а возможно, и значительно раньше, морская капуста применялась местным населением жителей Камчатки (наверное, и японцами, и корейцами, и другими островитянами) в лечебных целях. Известно, что за те два столетия, прошедших после экспедиции С.П. Крашенинникова, были выявлены многие ценные свойства чудесного дара моря, что позволило морской капусте найти широкое применение и в медицине, и в пищевой промышленности, и в сельском хозяйстве, и в косметике. Однако есть основания полагать, что применение морской капусты будет иметь в дальнейшем еще более широкое распространение. Доктор фармацевтических наук З. Задерякина: – Морская капуста – это группа бурых водорослей, принадлежащих к семейству ламинариевых (сахаристая, японская, узкая, курчавая ламинарии и другие). Для нее характерно листовидное слоевище, прикрепленное к грунту с помощью похожих на многочисленные коготки приспособлений. Пластинка слоевища у ламинарии японской, например, достигает в длину 15 метров, а у сахаристой – до 3 метров, в то время как ширина ее – 20 – 30 сантиметров. Особенно много морской капусты произрастает на прибрежном шельфе морей дальневосточного бассейна. Здесь, на глубине 20 и более метров вдоль побережья простираются обширные подводные поля морской капусты, выражаясь современным языком, – капустные плантации. Сокровища длинных листов Развиваясь в морской воде, состоящей из самых разнообразных солей, ламинария всасывает их и избирательно накапливает такие жизненно необходимые организму человека элементы, как йод, калий, натрий, кальций, магний, фосфор, бром, хлор. Особенно удивительна способность ламинарии накапливать йод. Установлено, что килограмм водорослей содержит столько йода, сколько 100 тонн морской воды! Иначе говоря, йода в клетках ламинарии в 100 тысяч раз больше, чем в морской воде! В состав клеток ламинарий входят также и витамины “A”, “C”, “D”, “E”, “F”, углеводы, альгинаты (соли особой альгиновой кислоты) и белковые вещества. Таким образом, морская капуста содержит не одно, а целый комплекс физиологически активных веществ, способных в определенных случаях оказывать лечебное действие. Наряду с этим морская капуста – прекрасный диетический продукт, не только питательный, но и регулирующий обменные процессы в организме. Капуста – для стекла, мыла, зонтиков и йода История добычи и переработки морской капусты насчитывает более 300 лет. Из продуктов переработки получались добавки, применяемые для изготовления мыла, стекла, непромокаемой ткани для зонтиков, и конечно же, для получения йода. Еще в 1670 году (а может, и гораздо раньше) в Японии стали добывать из ламинарий агар-агар, а в начале 18 века в Шотландии, Ирландии, во Франции и в Японии выброшенные морем (после бури) водоросли сжигали в особых ямах. Золу, полученную из ламинарии, промывали, а использованную воду затем выпаривали, в процессе чего и получался углекислый натр (сода), которая в больших количествах требовалась для производства мыла и стекла. Еще в начале 19 века в маленькой Шотландии в год сжигали около 100 тысяч тонн (!) сухих водорослей. Однако вскоре (тогда же, в начале 19 века) после открытия французским ученым Лебланом более экономичного способа получения углекислого натра из поваренной соли и серной кислоты, коммерческий интерес к морским водорослям значительно снизился. Возродился он вновь после того, как в 1811 году мсье Куртуа, – французский промышленник и исследователь обнаружил в морских водорослях новый (по тем временам) элемент – йод! Йод оказался прекрасным средством для дезинфекции и вскоре нашел в медицине широчайшее применение. Итак, с момента открытия йода около 60 лет водоросли были единственным источником этого ценного лекарственного средства. Только в 1873 году йод был также обнаружен в маточных растворах, остававшихся после извлечения селитры из чилийского “гуано” – птичьего помета. Тем не менее, конкуренция чилийского йода не могла еще долго помешать добыванию йода из морских водорослей. Известно, что в 1916 году в одной только Японии из морской капусты было добыто 300 тонн (!) кристаллического йода. Несомненно, во время первой мировой войны потребность в йоде значительно возросла, и его недостаток стал особенно остро ощущаться в России, импортировавшей его до этого из Германии. И только тогда-то и вспомнили о тех собственных ресурсах йодосодержащих водорослей, незаслуженно забытых прежде. Только так и был построен в 1915 году завод по выработке йода на Дальнем Востоке. Более значительный размах поиски сырьевых ресурсов для получения йода на территории бывшего СССР получили только с 1930 года, после выхода Постановления Совета Труда и Обороны о создании в стране (специальной) йодной промышленности. В тот момент первостепенное внимание ученых уделялось именно морским водорослям. Специальные научные экспедиции изучали запасы морской капусты в морях Дальнего Востока, в Белом море, параллельно шли поиски и разработки оптимальных технологий получения йода. На Дальнем Востоке вновь был построен завод по получению йода из морской капусты. Примерно в то же время завод в Архангельске, открытый еще в 1921 году, был значительно расширен. Но вскоре морская капуста, как промышленный источник йода, уступила место новому, более перспективному. Советские ученые обнаружили йод в буровых водах бакинских нефтяных скважин и разработали экономичную технологию получения ценного лекарства. Огромная страна смогла, наконец, полностью удовлетворять потребность в йоде за счет собственного производства. В тот период интерес к морской капусте снизился. Однако, благодаря тому, что еще в 1883 году был разработан способ получения из морской капусты альгиновой кислоты, эффективно применяемой в текстильной промышленности в качестве аппретуры для изготовления непромокаемых тканей и в медицине. Таким образом, зонтики той эпохи, как вы понимаете, шили из той ткани, для непромокаемости к которой добавлялась альгиновая кислота, получаемая из той же морской капусты. Капуста – против зоба, туберкулеза, ожирения, поноса В процессе исследований морской капусты в области медицины выяснилось, что альгинаты (натриевая и калиевая соли альгиновой кислоты) дают прекрасный терапевтический эффект при лечении желудочно-кишечных заболеваний. Альгинаты обладают большой вязкостью и высокими адсорбционными свойствами. Принятые внутрь в виде каши, киселя или так называемого альгинового молока, они обволакивают слизистую оболочку кишечника полупроницаемой пленкой, тем самым предохраняя воспаленные места или язвенную поверхность от механических и других раздражений. Кроме того, альгинат кальция обладает ярко выраженным кровоостанавливающим действием и антибактериальными свойствами и потому может быть использован в виде полосканий, пластырей, повязок. Его можно сочетать с антибиотиками и другими препаратами, он быстро всасывается, кроме того, нетоксичен. В среде желудочного сока альгинат натрия набухает, переходит в желе и вызывает уменьшение всасывающей способности желудка. В связи с этим он входит в состав таблеток и пилюль для лечения ожирения. А в практике лечения детей альгиновую кислоту используют как слабительное средство. Издавна у многих народов морскую капусту использовали для лечения самых разнообразных заболеваний. Так, аборигены Гебридских островов применяли некоторые виды ламинарии как потогонное средство, ирландцы – для лечения золотухи, индусы – при туберкулезе! Но особенно популярна морская капуста на всех побережьях как лучшее средство для лечения заболевания щитовидной железы, то есть зоба. В морской капусте много соединений йода – микроэлемента, входящего в состав гормона щитовидной железы. Терапевтический эффект йода усиливается различными органическими компонентами клеток морской капусты и проявляется в несколько иной форме по сравнению с действием элементарного йода. Порошок сушеной морской капусты часто применяют как вспомогательный препарат при гипертериозе, легких формах базедовой болезни, и для профилактики эндемического зоба. Ламинария эффективна при таких заболеваниях желудочно-кишечного такта: атоническом запоре, хронических и острых энтероколитах, проктитах. Однако специалисты не рекомендуют морскую капусту тем, кто болен нефритом, геморрагической болезнью, диатезом, крапивницей, фурункулезом. В период беременности также не стоит ею увлекаться. Морская капуста может быть использована и как природный поливитаминный препарат, и как средство, регулирующее обменные процессы в организме человека. Ведь наряду с комплексом витаминов она аккумулирует и множество элементов, растворенных в морской воде. Они-то и входят в большинстве своем в состав ферментов клеток нашего организма. А мы знаем, что именно ферменты делают возможными те удивительные превращения, которые претерпевают в клетках компоненты нашей пищи, что именно они обеспечивают “технологию” всех обменных процессов. Трудно в современной медицинской практике найти лекарственное растение с таким широким диапазоном целебного действия, как у морской капусты. И можно сожалеть, что она не используется еще в той мере, какой заслуживает! Морская капуста – в меню Морская капуста – ценный пищевой продукт. На всем земном шаре жители прибрежных районов употребляют ее в пищу. В основном добывают капусту в Японском и северном морях. Особенно широко она используется в Японии. Здесь морская капуста – излюбленная основа самых разнообразных блюд и лакомств. Она добавляется к супам, мясным блюдам, подается в виде салатов, из морской капусты с соей готовят соус. Морская капуста – один из основных продуктов японской, корейской, китайской кухни, жителям островов не нужно ехать далеко за столь ценным продуктом, достаточно спуститься на морской рынок. Ежегодно в пищу японцы употребляют несколько десятков тысяч тонн (!) морской капусты. Отсутствие на Японских островах зоба и золотушных заболеваний у детей, а также низкий уровень нервных заболеваний, и как следствие этого – отсутствие вызываемых стрессами раковых опухолей ученые связывают с употреблением в пищу этой водоросли. На территории СНГ морская капуста более популярна у населения прибрежных районов, однако постепенно она все более распространяется вглубь материка, в районы, отдаленные от морей. Известны консервные баночки с салатом из морской капусты (производство о. Сахалин), с которыми можно приготовлять самые разнообразные блюда, – в них можно добавлять вареные рубленые яйца с зеленым луком, приправленные майонезом, или в салаты из вареного картофеля добавлять морскую капусту, приправленную майонезом, посыпанную зеленью укропа, петрушки, приправленную красным острым перцем и т.д. Можно даже делать восточные “манты” с добавлением в мясную начинку морской капусты. Для приготовления блюд водоросль вымачивают в холодной воде – затем, чтобы освободить от избытка йода и солей. Разбухшую капусту шинкуют мелко, варят и готовят из нее целый ряд блюд. Если вы приобрели “сушеную” морскую капусту китайской расфасовки, то ее надо не только вымачивать, но и промыть от песка! Итак, проверенные рецепты: – Холодная закуска. Разваренную морскую капусту одну или с соленой селедкой пропускают через мясорубку и добавляют по вкусу уксус, масло и лук. – Суп. Разваренную и нарезанную полоской морскую капусту добавляют вместо овощей к мясному или рыбному бульону. – Сладкое блюдо. Разваренную морскую капусту, нарезанную небольшими квадратиками, доваривают в разведенном сахарном сиропе (1:10), а затем перекладывают в более густой сироп (2 части сахара на 1 часть воды). Однако варьировать блюда из морской капусты может любая хозяйка до бесконечности, это дело вкуса и фантазии.

Морская капуста LEOR “диетическая” – «Наконец-то нашла без уксуса и растительного масла! Для тех, у кого привередливый желудок.»

На фоне приёма ОК и антибиотиков снизился иммунитет, ЖКТ как-то не очень стал, посоветовали есть капусту морскую. Вещь действительно не просто полезная, а очень полезная:

В морской капусте содержатся белки, углеводы, клетчатка, минеральные соли и жиры; йод, марганец, бром, цинк, железо, калий, магний, фосфор, азот, сера и другие. Присутствуют витамины – А, С, Е, D, а также некоторые витамины группы В – В1, В2 и В12; кислоты – пантотеновая и фолиевая, полисахариды, белковые вещества, а также L-фруктоза.

Вопрос стал в другом: где взять капусту без уксуса и растительного масла. Замороженной в городе не нашла, сушёная была только с добавками острыми. Кстати, ламинария не теряет своих свойств ни при термообработке, ни при высушивании. Остальная морская капуста была маринованной с уксусом – вариант на тот момент для меня совершенно не подходящий. Пить БАД Эвалар “Ламинария” тоже не очень хотелось, потому как надеялась больше на натуральный продукт. Обратилась к продавцу и она показала эту морскую капусту. Действительно, без уксуса и растительного масла. В составе:

вода, морская капуста отварная, соль и лимонная кислота.

Последняя мне тоже не кстати, но решаю эту проблему так: помещаю ложку капусты в кружку с водой на пару минут – от кислоты и соли мало что остаётся. Употреблять морскую капусту много нельзя. Желательно 3-5 раз в неделю не более 100 г. или 2 чайных ложек, иначе может быть переизбыток йода. Кроме того, есть противопоказания для применения:

геморрагические проявлениях, нефрит, хронический фурункулез, гиперфункция щитовидной железы. Если организм чувствителен к компонентам ламинарии, то её потребление может вызвать аллергию. Морская капуста может также вызвать возникновение крапивницы и раздражения кожи.

В некоторых источниках есть упоминания о том, что нельзя употреблять морскую капусту при заболеваниях ЖКТ. Если честно, в тех же БАД такого противопоказания нет. Думаю, связано подобное утверждение с тем, что капуста обладает слабительным эффектом, а при обострении гастрита или пр. заболеваний ЖКТ (если они с диареей), это нежелательно. В морской капусте содержится клетчатка.

Пожалуй, главным действующим веществом, все – таки, в морской капусте выступает альгиновая кислота: способна останавливать кровотечение. Это особенно полезным оказалось в лечении поражений язвенных желудка и кишечника. Обладают альгинаты и выраженным сорбирующим действием,выводят радионуклиды, а также соли тяжелых металлов. При всем этом, удерживают собственную микрофлору, что очень эффективно используется в лечении дисбактериоза и других заболеваний кишечника. Альгинаты, входящие в состав морской капусты, способны благотворно действовать на иммунную систему, восстанавливая и укрепляя ее.

На вид капуста “Диетическая” приятного тёмно-зелёного цвета, запах ламинарии. Порезана хорошо – не длинные ленты, которые трудно проглотить) Хранить можно в холодильнике. Я покупаю обычно пару пачек ( в связи с дефицитом у нас))), поэтому часть храню в морозилке.

Продукты, полезные для печени | Foodman

Пожалуй, печень — самый терпеливый орган в организме. Каждую минуту она обеспечивает жизнедеятельность организма и защищает его от токсинов. Печень имеет способность восстанавливаться, однако даже такому неутомимому защитнику время от времени требуется помощь. Есть доступные и вкусные способы поддержать ее. Мы выбрали для вас продукты, которые помогут вашей печени прийти в себя после бурных праздников.

Печень — уникальный орган. Эта крупнейшая человеческая железа способна восстанавливать сама себя до тех пор, пока изменения, происходящие с ней, не станут необратимыми. Не имея болевых рецепторов, она долго не подает тревожных сигналов, образно выражаясь, «страдает молча». Когда железа дает о себе знать, ситуация уже близка к критической.

Не стоит ждать, пока печень «заговорит» о своем неблагополучии. Поддерживать ее в здоровом состоянии вполне реально, пересмотрев ежедневный рацион питания и включив продукты, которые «любит» этот неутомимый орган.

Тыква


Один из лучших помощников и защитников печени. В ее составе представлены практически все витамины группы B, очень важные для поддержания самой крупной железы организма. Так, витамин B3, именуемый также ниацином, предотвращает гибель клеток печени и усиливает ее защитную функцию.

Микроэлементы, входящие в состав этого яркого плода, способны помочь в обновлении поврежденных клеток железы. В овоще присутствует значительная часть таблицы Менделеева: железо, магний, калий, цинк, кальций и много других элементов. Благодаря столь богатому минеральному составу тыква способствует улучшению проходимости желчевыводящих путей, выведению излишков холестерина и нормализации липидного обмена.

Высокое содержание пектина в этом овоще помогает печени осуществлять ее защитную функцию – выводить вредные компоненты из организма.

Тыква универсальна с кулинарной точки зрения, ее можно употреблять в сыром и термически обработанном виде для приготовления первых, вторых блюд, салатов и десертов.

Не рекомендуется включать в рацион тыкву тем, у кого имеется сахарный диабет и гастрит с пониженной кислотностью, а также в момент обострения язвенной болезни желудка и двенадцатиперстной кишки.

Капуста


Все известные разновидности этого овоща, а в особенности брокколи и цветная капуста, при регулярном включении в рацион способствуют увеличению числа глюкозинолатов в кровеносной системе. Эти вещества помогают трудолюбивому органу в синтезе ферментов, обезвреживающих канцерогены и токсины.

В капусте содержится жирорастворимый витамин К, запасаемый в организме печенью. При участии этого витамина самая крупная железа вырабатывает протромбин – белок, отвечающий за свертываемость крови.

Витамин К хорошо усваивается, если употреблять содержащие его продукты вместе с какой-либо жировой составляющей. Капустный салат с оливковым маслом станет отличным способом насытить организм этим веществом.

Морская капуста


Ее листья содержат производные альгиновой кислоты – полисахариды, не растворимые в воде. Альгинаты деактивируют тяжелые металлы, а также радиоактивные и токсические вещества. Таким образом они берут на себя часть работы печени, помогая ей избавлять организм от вредоносных веществ.

Морская капуста представлена в продаже в сушеном, замороженном и маринованном виде. Ее можно употреблять, добавляя в салаты и в другие холодные закуски. Консервированный продукт имеет меньше полезных свойств. Интересная идея – использовать измельченную сухую ламинарию как приправу для блюд, заменяя ею соль.

Диетологи рекомендуют суточную норму потребления ламинарии (сухой продукт) для взрослых – 1 чайную ложку. Морскую капусту нельзя употреблять людям с повышенной чувствительностью к йоду.

Авокадо


В составе этого фрукта в значительном количестве содержатся мононенасыщенные жиры, которые способствуют восстановлению клеток печени и помогают связывать токсины в группы (в таком виде они гораздо легче выводятся из организма).

Исследования ученых подтверждают, что спустя неделю после начала регулярного употребления в пищу авокадо показатель «плохого» холестерина в организме уменьшается приблизительно на 23%.

Полезность авокадо для печени обусловлена присутствием в его составе глютатиона – мощного антиоксиданта. Данное вещество формирует связи с токсичными соединениями, можно сказать, прилепляется к ним, таким образом блокируя негативное воздействие и помогая их выведению из организма. Глютатион выступает своеобразным партнером печени в организме, избавляет клетки железы от скопления токсинов, отфильтрованных при очищении крови.

Употреблять в пищу авокадо следует сырым. Он хорош как в естественном виде, так и в салатах и холодных закусках. Некоторые поклонники здорового питания используют этот фрукт в качестве заменителя сливочного масла в бутербродах.

Листья, кожуру и косточку авокадо употреблять в пищу нельзя: они содержат в составе фунгицидный токсин персин, опасный для человека.

Свекла


Этот корнеплод помимо прочих полезных компонентов содержит бетаин — витаминоподобное вещество, являющееся производным аминокислоты глицина. Именно ему свекла обязана своим ярким красным цветом. Бетаин стимулирует липидный обмен в железе, тем самым помогая профилактике жирового гепатоза печени – заболевания, сопровождающегося постепенным разрушением клеток органа.

Яркий корнеплод можно употреблять и в сыром, и в вареном виде. Для печени полезен сок из сырой свеклы. Его рекомендуется пить в сочетании с другими соками (морковным, яблочным). Разовая доза не должна превышать 50 мл, а начинать стоит с 1 столовой ложки в день.

Следует помнить, что свекла имеет послабляющее действие. Кроме того, она противопоказана при сахарном диабете.

Масла растительного происхождения


Для здоровья печени важен витамин Е, или токоферол, которым богаты растительные масла (льняное, оливковое, горчичное, кукурузное и другие). Он предотвращает разрушение клеток железы, поддерживая их целостность, нормализует обменные процессы.
Токоферол является сильным антиоксидантом, он предохраняет клеточные мембраны от разрушительного воздействия свободных радикалов, снижает показатель холестерина.

В растительных маслах содержатся эйкозаноиды – производные полиненасыщенных жиров, близкие по составу к фосфолипидам клеток организма.

Употреблять масла нужно в сыром виде: при температурном воздействии витамин Е разрушается. Диетологи не рекомендуют превышать суточную норму этого продукта — 25 граммов.

Сухофрукты


Печень – орган, который «любит» полезные сладости, и речь идет не о кондитерских изделиях. Чернослив, курага, изюм богаты калием, каротином (в организме он преобразуется в витамин А), пектином, выводящим из организма вредные вещества.

Диетологи советуют запивать эти полезные сладости водой. Сухофрукты действуют как адсорбенты: впитывают токсины, затем разбухают в воде, и, оказывая мягкий слабительный эффект, выводят их из организма.

Оптимальный вариант – съедать ежедневно (к примеру, на полдник) горсть разных сухофруктов, взяв по 20-30 г каждого вида. Следует помнить: эти сладости при всей своей полезности имеют высокий гликемический индекс.

Кисломолочные продукты


Нежирный творог, кефир, ряженка, йогурт и другие подобные продукты оказывают оздоравливающее действие на пищеварительную систему в целом. Они способствуют выведению токсинов, нормализуют микрофлору, препятствуют формированию жирового гепатоза печени.

Творог содержит фосфолипиды – лецитин и кефалин, входящие в структуру мембран клеток.

Диетологи не советуют увлекаться обезжиренным творогом. Оптимальный вариант – продукт малой и средней жирности (2-5%).

Построить рацион на продуктах, полезных для самой крупной железы организма, несложно. Все они отлично сочетаются между собой.

Капустный салат, приправленный маслом оливы, свекла с черносливом, запеченная тыква с курагой… Немного знаний и кулинарной фантазии – и благодарная печень будет бесперебойно работать, обеспечивая отличное самочувствие и полноценную жизнедеятельность надолго.

Королева Татьяна

Ключевые слова:

Противовоспалительное, гастропротекторное и антиульцерогенное действие экстракта красных водорослей Gracilaria changii (Gracilariales, Rhodophyta)

BMC Complement Altern Med. 2013; 13: 61.

, 1 , 2 , 1 и , 1 и 1 1

Meng-hooi Shu

1 Тропические инфекционные заболевания Исследовательства и образования (Tidrec), Департамент медицинской микробиологии, Факультет Медицинский университет Малайи, Куала-Лумпур 50603, Малайзия

Дэвид Эпплтон

2 Технологический центр Симе Дарби, 1-й этаж, Блок B Технологический центр UPM-MTDC III, Лебух Силикон, Университет Путра Малайзия, Серданг, Селангор 43400, Malaysia

Keivan Zandi

1 Исследовательский и образовательный центр тропических инфекционных заболеваний (TIDREC), кафедра медицинской микробиологии, медицинский факультет, Малайский университет, Куала-Лумпур 50603, Малайзия

Sazaly AbuBakar

2

4 Центр исследований и образования по болезням (TIDREC), кафедра медицинской микробиологии, медицинский факультет, Университет Малайи, Куала-Лумпур 50603, Малайзия a

1 Научно-образовательный центр тропических инфекционных заболеваний (TIDREC), кафедра медицинской микробиологии, медицинский факультет, Университет Малайи, Куала-Лумпур 50603, Малайзия

2 Технологический центр Sime Darby, 1-й этаж, блок B UPM-MTDC Technology Center III, Lebuh Silikon, Universiti Putra Malaysia, Serdang, Selangor 43400, Malaysia

Автор, ответственный за переписку.

Поступила в редакцию 1 ноября 2012 г.; Принято 7 марта 2013 г.

Copyright © 2013 Shu et al.; лицензиат BioMed Central Ltd. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution (http://creativecommons.org/licenses/by/2.0), которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе, при условии, что оригинальная работа правильно процитирована. Эта статья цитировалась другими статьями в PMC.

Abstract

Справочная информация

Gracilaria changii (Xia et Abbott) Abbott, Zhang et Xia, красные водоросли, обычно встречающиеся в прибрежных районах Малайзии, которые традиционно используются в пищу и для лечения различных заболеваний, включая воспаление и желудочные заболевания. .Целью исследования было изучение противовоспалительной, гастропротекторной и антиульцерогенной активности метанольного экстракта стандартизированного масс-спектрометрией Gracilaria changii .

Методы

Метанольный экстракт Gracilaria changii (экстракт MeOHGCM6) готовили и стандартизировали с помощью масс-спектрометрии (МС). Противовоспалительную активность экстракта MeOHGCM6 исследовали путем обработки клеток U937 во время их дифференцировки 10 мкг/мл экстракта MeOHGCM6.Уровень ответа фактора некроза опухоли-α (TNF-α) и экспрессию генов TNF-α и интерлейкина-6 (IL-6) контролировали и сравнивали с таковой при лечении 10 нМ бетаметазоном, противовоспалительным препаратом. Гастропротекторную и антиульцерогенную активность экстракта MeOHGCM6 исследовали путем кормления крыс экстрактом MeOHGCM6 в диапазоне от 2,5 до 500 мг/кг массы тела (м.т.) после индукции поражений желудка. Выработка слизи и желудочного сока, pH желудочного сока и уровни небелковых сульфгидрилов (NP-SH) определялись и сравнивались с теми, которые получали при кормлении 20 мг/кг b.ж. омепразол (OMP), известный противоязвенный препарат.

Результаты

MS/MS анализ экстрактов MeOHGCM6 выявил присутствие метил 10-гидроксифеофорбида a и 10-гидроксифеофитина a , известных белков хлорофилла и нескольких неидентифицированных молекул. Обработка 10 мкг/мл экстракта MeOHGCM6 во время дифференцировки клеток U937 значительно ингибировала уровень ответа TNF-α и экспрессию генов TNF-α и IL-6. Ингибирующий эффект был сравним с эффектом бетаметазона.Для клеток, обработанных 10 мкг/мл экстракта MeOHGCM6, цитотоксических эффектов не зарегистрировано. Крысы получали экстракт MeOHGCM6 в дозе 500 мг/кг массы тела. показали уменьшение абсолютных размеров поражений желудка, вызванных этанолом, на  > 99% ( p  < 0,05). Этот защитный эффект был сравним с действием OMP. рН желудочной слизи дозозависимо снижался с 5,51 до 3,82 и наблюдалось значительное повышение концентрации NP-SH.

Выводы

Результаты исследования показывают, что стандартизированный по масс-спектрометрии метанольный экстракт Gracillaria changii обладает противовоспалительными, гастропротекторными и антиульцерогенными свойствами.В будущем необходимо дальнейшее изучение активного компонента экстракта и механизма его действия.

Ключевые слова: Противовоспалительное, Противоязвенное, Гастропротекторное, Gracilaria changii , Цитокины, Бетаметазон, Омепразол, Морские водоросли, Язва

Фон

Воспаление является основным признаком многих заболеваний. Он характеризуется комплексом организованных взаимодействий между медиаторами воспаления и воспалительными клетками, направленными на устранение раздражителей и заживление повреждений тканей [1,2].Воспаление является важным защитным механизмом хозяина. Однако воспаление, возникающее в слизистой оболочке желудочно-кишечного тракта, вызывает язву желудочно-кишечного тракта [3]. Язва желудочно-кишечного тракта является распространенным серьезным заболеванием пищеварительной системы, поражающим миллионы американцев и многие другие во всем мире [4]. Наиболее частой причиной язвенной болезни желудочно-кишечного тракта является инфицирование Helicobacter pylori ( H. pylori ) [5] и длительное применение нестероидных противовоспалительных препаратов (НПВП), таких как аспирин и ибупрофен [6].Появление контрольных антибиотиков против H. pylori значительно снизило количество случаев желудочно-кишечных язв в развитых странах [7]. Однако заболеваемость по-прежнему высока в других странах, и заболевание, вызванное использованием НПВП, по-прежнему является серьезной проблемой здравоохранения в развитых странах [6,7].

Лечение воспаления в целом направлено либо на подавление активности воспалительных клеток, либо на ингибирование продукции медиаторов воспаления [8].Последнее может быть достигнуто с помощью таких препаратов, как НПВП и кортикостероиды [9]. Лечение язвы желудочно-кишечного тракта в целом направлено либо на устранение инфекции H. pylori , либо на снижение и ингибирование уровней выработки желудочной кислоты, ответственных за эрозию защитного слоя желудочно-кишечного тракта [10,11]. Последнее может быть достигнуто с помощью таких препаратов, как блокаторы гистамина (H 2 ), ингибиторы кислотной помпы и препараты для защиты слизистой оболочки [9]. Однако описаны различные побочные эффекты длительного применения этих препаратов [9].Кроме того, противовоспалительные и антиульцерогенные препараты применяются в основном для облегчения симптомов заболевания, фактически не леча и не предупреждая воспалительных и ульцерогенных процессов.

Разработка противовоспалительных и противоязвенных препаратов в последнее время была сосредоточена на обнаружении благоприятного применения травяных растительных экстрактов, которые являются сильнодействующими и более безопасными в использовании. Водоросли, обнаруженные в изобилии у прибрежных районов во многих частях мира, представляют собой огромный, но неиспользованный потенциал нового источника терапевтических средств [12,13].Например, сообщалось, что красные водоросли содержат активные соединения, которые могут помочь уменьшить воспаление пищеварительного тракта [14], предотвратить или лечить язву желудка и рак, вызванные окислительным стрессом [15,16], ингибировать воспалительную активность путем подавления производства медиаторы воспаления [17-19] и индуцируют апоптоз раковых клеток в желудке [20] и толстой кишке [21]. Природные соединения, полученные из съедобных водорослей, могут быть более безопасными для использования в качестве противовоспалительных и желудочных противоязвенных терапевтических средств, поскольку они употреблялись в пищу и использовались в традиционной медицине с незапамятных времен [13].

Красные водоросли, Gracilaria changii (Xia et Abbott) Abbott, Zhang et Xia, обнаруженные в прибрежных районах Малайзии, представляют собой потенциальный местный источник этого природного терапевтического средства. В настоящее время водоросли коммерчески собирают только из-за содержания в них коллоидного агара и в качестве местных пищевых деликатесов. Эти водоросли широко применяются в народной медицине для лечения различных заболеваний, в том числе воспалений и желудочных заболеваний. Настоящее исследование направлено на оценку потенциальной противовоспалительной, гастропротекторной и антиульцерогенной активности этих малазийских красных водорослей, Gracilaria changii .

Методы

Получение экстракта водорослей

Gracilaria changii (Xia et Abbott) Abbott, Zhang et Xia были собраны в прибрежных водах Мориб, Селангор, Малайзия (N2° 44′ 908″, E101° 26′ 590″ ) в конце февраля 2003 г. [22-24]. Водоросли были идентифицированы профессором доктором Пханг Сью Мои, директором Института наук об океане и Земле Института биологических наук факультета естественных наук Университета Малайи, где хранились ваучерные образцы (гербарий №PSM 6320 и PSM 6321). Водоросли промывали стерильной морской водой с окончательным ополаскиванием стерильной дистиллированной водой, как описано ранее [22]. Затем водоросли обрабатывали ультразвуком в ультразвуковом аппарате с водяной баней и хранили при температуре -70°C. Метанольный экстракт Gracilaria changii (экстракт MeOHGCM6) готовили в Малайзийском университете Теренггану (UMT) по методике, описанной [25]. Экстракт MeOHGCM6 перед использованием хранили при температуре -20°C.

Экстракт MeOHGCM6

Анализ профиля экстракта MeOHGCM6 проводили на системе сверхбыстрой жидкостной хроматографии (UFLC) Shimadzu, оснащенной фотодиодным матричным ультрафиолетовым (PDA UV) детектором и времяпролетным масс-спектрометром с ионной ловушкой (TOF) (Shimadzu, Япония).Разделение осуществляли на колонке Waters Xbridge C18 (50 мм × 2,1 мм, диаметр частиц 2,5 мкм) (Water, США) при 40°C. Подвижная фаза состояла из воды [0,1 % муравьиной кислоты (BDH Laboratory Supplies, England)] : ацетонитрила (BDH Laboratory Supplies, England) (0,1 % муравьиной кислоты) при скорости потока 0,50 мл/мин с объемом впрыска 10 мкл. . Для масс-спектрометрии (МС) использовали режим ионизации электрораспылением (ESI) с положительным/отрицательным переключением и внешним эталоном. Словарь натуральных продуктов (CRC Press) со спектрами МС высокого разрешения и структурной информацией использовался для анализа спектров положительных и отрицательных ионов вместе с информацией МС/МС для идентификации сходных компонентов.

Промоноцитарная клеточная линия человека (клетки U937)

Клетки U937 были приобретены в Американской коллекции типовых культур (ATTC, США) и культивированы в Roswell Park Memorial Institute-1640 (среда RPMI-1640) (Flowlab, Австралия) [дополнено 1 % 10 мМ заменимой аминокислоты (NEAA) (Flowlab, Австралия) и 1 % 10 мМ L-глютамина (L-Glu) (Flowlab, Австралия)], содержащего 10 % инактивированной нагреванием эмбриональной бычьей сыворотки (FBS) ( Флоулаб, Австралия). Клетки инкубировали при 37°C во влажном инкубаторе с 5% CO 2 .

Дифференцировка клеток U937

Клетки U937 высевали в 96-луночные планшеты для культивирования клеток (Falcon, США) при плотности 2 × 10 4 клеток/лунку со средой RPMI-1640, содержащей 2% FBS, и хранили при 37 °C во влажном инкубаторе с 5% CO 2 . На следующий день к моноцитарным клеткам U937 добавляли среду, содержащую форбол-12-миристат-13-ацетат (PMA) (Sigma-Aldrich, США) в концентрациях от 0 до 50 нМ, чтобы вызвать дифференцировку на 24 и 48 часов.Параллельно добавляли среду, содержащую только разбавители РМА [раствор диметилсульфоксида (ДМСО) (Sigma-Aldrich, США)], и использовали в качестве контроля носителя. В конце указанного момента времени клетки оценивали на предмет экспрессии специфичных для дифференцировки маркеров поверхности клеток макрофагов и жизнеспособности клеток.

Экспрессию CD11b, специфичного для дифференцировки маркера поверхности клеток макрофагов, определяли путем окрашивания клеток, как описано ранее [26,27]. Жизнеспособность клеток определяли с помощью теста исключения красителя трипанового синего (Sigma, США), как описано ранее [28].

Анализ цитотоксичности

Клетки U937 высевали в 96-луночные планшеты для культивирования клеток с плотностью 2 × 10 4 клеток/лунку со средой RPMI-1640, содержащей 2% FBS, и хранили при 37°C во влажном инкубаторе с 5% CO 2 . На следующий день добавляли среду, содержащую экстракт MeOHGCM6 (в диапазоне концентраций от 0 до 100 мкг/мл) и бетаметазон (Sigma, США) (в диапазоне концентраций от 0 до 100 нМ). Параллельно добавляли среду, содержащую только экстракт MeOHGCM6 и разбавители бетаметазона [этанол (EtOH) (BDH Laboratory Supplies, England) и ДМСО, соответственно], и использовали в качестве контроля носителя.Через сутки после обработки скорость пролиферации клеток U937 определяли с помощью набора CellTiter 96® Non-Radioactive Cell Proliferation Kit (Promega, США) строго по протоколу, рекомендованному производителем.

Обработка экстрактом MeOHGCM6 клеток U937

Клетки U937 высевали в 24-луночные планшеты для культивирования клеток (Falcon, США) с плотностью 2 × 10 5 клеток/лунку со средой RPMI-1640, содержащей 2% FBS, и инкубировали при 37°C во влажном инкубаторе с 5% CO 2 .На следующий день клетки U937 индуцировали для дифференцировки с помощью 10 нМ ФМА в течение 24 часов. Во время дифференцировки клетки U937 обрабатывали экстрактом MeOHGCM6 или бетаметазоном в физиологической концентрации. Через 0, 8, 16 и 24 часа после обработки супернатант и клетки собирали и анализировали на уровень ответа TNF-α и экспрессию генов TNF-α и IL-6.

Уровень ответа TNF-α

Уровень TNF-α измеряли с помощью набора II BD OptEIA™ Human TNF (TNF-α) ELISA II (BD Biosciences, США) в соответствии с протоколом производителя.

Экспрессия генов TNF-α и IL-6

Суммарную РНК из культур клеток выделяли с помощью TRI Reagent® (Molecular Research Centre, Inc., США) и обрабатывали ДНКазой (Promega, США). РНК подвергали обратной транскрипции (кДНК) с использованием обратной транскриптазы SuperScript™ II (Invitrogen, США). Затем кДНК использовали для проведения количественной ПЦР в реальном времени с использованием мастер-микса SYBR® Green PCR (Qiagen, Германия) на DNA Engine Opticon II® (MJ Research, Bio-Rad, США), как описано ранее [29].Используемые олигонуклеотидные праймеры представляли собой прямой 5’AAGAGTTCCCCAGGGACCTC и обратный 5’GCTTGAGGGTTTGCTACAAC для TNF-α; прямой 5’GAAAGGAGACATGTAACAAG и обратный 5’CCAGGCAAGTCTCTCATTG для IL-6; и прямой 5’GCGAGAAGATGACCCAGATC и обратный 5’GGATAGCACAGCCTGGATAG для бета-актина (β-актина) (внутренняя ссылка).

Животные

В исследовании использовались взрослые самки крыс Sprague-Dawley в возрасте от 7 до 8 недель и весом 160–200 г. Протокол экспериментов на животных был одобрен Институциональным комитетом по этике экспериментов на животных Университета Малайи [Номер утверждения: MP/08/06/2010/SMH(R)].Животные были получены из Университета Путра Малайзии (UPM). Животных содержали индивидуально в клетках с проволочным дном с широкой сеткой для предотвращения копрофагии. Их содержали в хорошо проветриваемом помещении с регулируемой температурой, с пищей и водой, с 12-часовым циклом свет/темнота на протяжении всего исследования. Всех крыс лишали пищи на 48 часов, но имели свободный доступ к питьевой воде за 2 часа до воздействия на них ульцерогенов.

EtOH-индуцированные поражения желудка

Крыс случайным образом разделили на 7 групп, каждая из которых состояла из 6 крыс.Группе 1 вводили 10% Tween 20 (разбавители экстрактов) (BDH Laboratory Supplies, England) и служили группой отрицательного контроля. Группе 2 давали 500 мг/кг м.т. экстракта MeOHGCM6, эквивалентного неродственному растительному экстракту, приготовленному аналогичным образом параллельно с экстрактом MeOHGCM6, для использования в качестве контрольной группы неспецифического растительного экстракта (NSPE). Группу 3 лечили OMP (Chemical Company of Malaysia, Малайзия) в дозе 20 мг/кг м.т. и служили группой положительного контроля лечения. Остальные группы 4, 5, 6 и 7 получали 4 различных концентрации экстракта MeOHGCM6 в диапазоне от 2.5 – 500 мг/кг массы тела соответственно. Через 30 минут после предварительной обработки всем животным перорально вводили абсолютный EtOH. Через час после введения животных умерщвляли, вводя им передозировку диэтиловым эфиром (BDH Chemicals Ltd., Англия). Брюшную полость крысы рассекали и ближайший к кардии пищевод и растянутый желудок на пилорическом сфинктере немедленно завязывали узлом с помощью веревки во избежание вытекания желудочного содержимого. Желудок быстро извлекали и погружали в воду.

Измерение желудочной секреции

Содержимое желудка каждой крысы аспирировали и аккуратно соскабливали шпателем. Желудочный сок, содержащий частицы пищи, отбрасывался. Собранную желудочную слизь взвешивали на электронных весах (Mettler Toledo, Швейцария). Количество желудочного сока измеряли мерным цилиндром. рН желудочного содержимого измеряли с помощью цифрового рН-метра (Crison Instruments, S.A., Испания).

Оценка макроскопических поражений желудка

После сбора желудок немедленно промывают физиологическим раствором и исследуют под микроскопом для препарирования (1.8×) с окуляром с квадратной сеткой. Железистая часть желудка оценивалась на образование язвы. Общая площадь изъязвления (UA) геморрагических поражений для каждого желудка была измерена с помощью планниметрии (мм 2 ) и процент ингибирования был рассчитан по следующей формуле: Определение продукции небелковых сульфгидрилов (NP-SH)

Уровень NP-SH в слизистой оболочке желудка измеряли, как описано ранее [30] с небольшими изменениями.Вкратце, железистый желудок взвешивали и гомогенизировали в пробирках, содержащих ледяную 0,02 М этилендиаминтетрауксусную кислоту (ЭДТА) (GibcoBRL Life Technologies, США) (рН 8,9). Аликвоты гомогенатов смешивали с дистиллированной водой и 50% трихлоруксусной кислотой (Sigma Chemical Co., США). Смесь инкубировали при постоянном перемешивании в течение 10 минут при 4°C, а затем центрифугировали при 3000×g в течение 15 минут. Затем смесь анализировали на уровень NP-SH с использованием набора для анализа глутатиона (Sigma Chemical Co., США) согласно протоколу производителя.

Статистический анализ

Все данные были выражены в виде среднего ± стандартного отклонения (S.D) или медианы (25% и 75% квартиль) из двух или трех независимых экспериментов по противовоспалительным исследованиям и семи независимых экспериментов по гастропротекторным и антиязвенным исследованиям . ANOVA (однофакторный дисперсионный анализ и двусторонний дисперсионный анализ) использовали для сравнения между группами и для сообщения о статистической значимости « p » по отношению к контрольной группе.Значение p  < 0,05 считалось статистически значимым. Все статистические анализы проводились с использованием программного обеспечения GraphPad Prism 4.0 (США) и программного обеспечения SPSS версии 16.0 (SPSS Inc, Чикаго) соответственно.

Результаты

Стандартизированный профиль экстракта MeOHGCM6

Анализы ЖХ-МС различных партий экстракта MeOHGCM6 были выполнены для обеспечения воспроизводимости и согласованности методов экстракции. Партии 1 и 2 экстракта MeOHGCM6, использованные в исследовании, показали очень похожие профили масс-спектров и количество основных масс (рис. A-C).Анализ спектров и сравнение со Словарем натуральных продуктов CRC Press определили характерные массы как 457,405, 645,280 и 887,579. Идентифицированная масса в спектре положительных ионов m/z 457,405, имела фрагменты 398,327 (базовый пик), 380,316 и 158,082. Нейтральная потеря массы 59,077, возможно, свидетельствует о потере триметиламина. Это предполагает, что соединение может содержать фрагмент триметиламмония. Данные МС высокого разрешения и МС/МС не смогли окончательно идентифицировать какие-либо известные соединения из Словаря натуральных продуктов.Однако массы m / z 645 и 887 показали отчетливую связь с двумя известными хлорофиллами, метил-10-гидроксифеофорбидом и и 10-гидроксифеофитином и с соответствующими коэффициентами поглощения УФ-излучения, наблюдаемыми в анализе PDA (таблица).

Профилирование различных партий экстракта MeOHGCM6. Режим ESI с положительным/отрицательным переключением и внешним эталоном использовался для МС с использованием системы Shimadzu UTLC. Суммарные спектры положительных ионов проанализированы для идентификации сходных компонентов из двух разных партий экстракта MeOHGCM6, использованных в исследовании.( A ) Экстракт MeOHGCM6 (партия 1; M6-1). ( B ) Экстракт MeOHGCM6 (партия 2; M6-2). ( C ) Сравнение интенсивности наиболее распространенных масс двух партий экстракта MeOHGCM6, использованных в исследовании.

Таблица 1

Таблица 1

Структура Отображение самой значительной массы, присутствующих в экстракт MeOHGCM6 с использованием LC / MS

3

MASS (ION)

5

возможный ID
417.298
1, 2
Скорее всего загрязнитель
457,405 *
1, 2
Неопознанный
461,326
1, 2
Скорее всего загрязнитель
50224 505.353 505.353 1, 2
9
Все скорее всего Contaminant
573.256
1, 2
1, 2
Неопознанные
645.280
1, 2
Метил 10-hydroxyphaeophorbide
743,636
1, 2
Неизвестные
887,579 1, 2 10-Hydroxypheophytin a

Экспрессия специфичного для дифференцировки маркера поверхности клеток макрофагов на клетках U937

Дифференцированные клетки U937 отличаются экспрессией специфичного для линии моноцитов/макрофагов белка CD11b, поверхностного маркера [26].В нашем исследовании экспрессия CD11b была отмечена интенсивной коричневато-синей меткой на поверхности клетки [27]. Экспрессия CD11b была значительно увеличена, когда клетки U937 индуцировали к дифференцировке с увеличением концентрации PMA (1, 10 и 50 нМ) (рисунок , рисунок A). Полученные данные свидетельствуют о том, что обработка 10 или 50 нМ ФМА в течение 24 часов или 1 нМ ФМА в течение 48 часов дифференцировала клетки U937 значительно выше 50% клеточной культуры.

Экспрессия специфичного для дифференцировки маркера клеточной поверхности макрофагов на дифференцированных моноцитарных клетках U937. моноцитарных клеток U937 индуцировали для дифференцировки с помощью ( A ) 0 нМ ФМА в течение 24 часов; ( B ) 0 нМ ФМА в течение 48 часов; ( C ) 1 нМ ФМА на 24 часа; ( D ) 1 нМ ФМА на 48 часов; ( E ) 10 нМ ФМА на 24 часа; ( F ) 10 нМ ФМА на 48 часов; ( G ) 50 нМ ФМА на 24 часа и ( H ) 50 нМ ФМА на 48 часов. Клетки окрашивали с использованием иммуногистохимического окрашивания для выявления присутствия CD11b, маркера поверхности клеток макрофагов.Дифференцированные моноцитарные клетки U937 идентифицировали по интенсивному коричневато-синему пятну на клеточной поверхности дифференцированных клеток. Клетки просматривали при 20-кратном увеличении в светлом поле с помощью инвертированного микроскопа и фотографировали с помощью камеры Nikon D70 (Nikon, Япония). Показан один архетипический набор фотографий из трех отдельных экспериментов.

Специфичные для дифференцировки моноцитарные клетки U937 экспрессия маркера клеточной поверхности макрофагов и определение жизнеспособности клеток. моноцитарных клеток U937 индуцировали для дифференцировки различными концентрациями ФМА в течение 24 и 48 часов.( A ) Процент дифференцированных клеток оценивали по присутствию CD11b на клеточной поверхности. ( B ) Процент жизнеспособных клеток оценивали с использованием анализа исключения трипанового синего. Процент дифференцированных или жизнеспособных клеток от общего количества клеток был одинаковым до эксперимента с использованием различных концентраций PMA и периода инкубации. Данные представлены как среднее  ± S.D. из трех независимых экспериментов со знаком «*» p  < 0,05 представляют собой значимое различие по сравнению с группой, у которой не индуцировали дифференцировку.

Определение жизнеспособности клеток на дифференцированных клетках U937

Жизнеспособные дифференцированные клетки U937 оценивали с использованием анализа исключения красителя трипанового синего. Жизнеспособность клеток U937 продемонстрировала значительное дозозависимое снижение процента жизнеспособных клеток при индукции дифференцировки с помощью 1, 10 и 50 нМ ФМА (рис. B). Полученные данные свидетельствуют о том, что 90% дифференцированных клеток U937 оставались жизнеспособными после обработки 1 или 10 нМ ФМА в течение 24 часов или 1 нМ ФМА в течение 48 часов.

Цитотоксичность экстракта MeOHGCM6 на клетках U937

Цитотоксическое действие экстракта MeOHGCM6 и бетаметазона на клетки U937 определяли путем расчета скорости пролиферации клеток. Клетки U937, обработанные экстрактом MeOHGCM6 в концентрациях 0,05, 0,5, 1 и 5 мкг/мл, демонстрировали всплески пролиферации 117,39% (108,48%, 122,10%), 152,04% (149,36%, 154,72%) ( p  < 0,05), 145,39% % (137,48%, 149,11%) ( p  < 0,05) и 118,49% (112,01%, 133,28%) соответственно (рис. A).Обработка экстрактом MeOHGCM6 в концентрации 10 мкг/мл снижала скорость пролиферации клеток до 87,00% (82,43%, 89,62%). Клетки U937, обработанные бетаметазоном, продемонстрировали значительное дозозависимое снижение скорости их пролиферации (рис. B). При более низких концентрациях бетаметазона (0,1, 1, 5 и 10 нМ) скорость пролиферации клеток составила 110,35 % (92,20 %, 115,83 %), 113,75 % (89,56 %, 122,98 %), 94,59 % (85,56 %, 101,93 %). и 80,48% (77,78%, 110,48%) соответственно.

Цитотоксическое действие различных концентраций экстракта MeOHGCM6 и бетаметазона на моноцитарные клетки U937. Скорость пролиферации моноцитарных клеток U937, обработанных возрастающими концентрациями экстракта ( A ) MeOHGCM6 и ( B ) бетаметазона, определяли в течение 24 часов путем проведения анализа МТТ. Процент пролиферации клеток зависит от количества клеток, высеянных до введения различных доз экстракта MeOHGCM6 и бетаметазона. Концентрации экстракта MeOHGCM6, вызывающие 30% (G1 30 ), 50% (G1 50 ) и 70% (G1 70 ) ингибирования пролиферации клеток, экстраполировали из графика (указано стрелкой).Результаты выражали в виде медианы (25% и 75% квартиль) из двух независимых экспериментов.

Влияние обработки экстрактом MeOHGCM6 на уровень ответа TNF-α во время дифференцировки клеток U937

Влияние обработки экстрактом MeOHGCM6 на регуляцию уровня ответа TNF-α во время дифференцировки клеток U937 исследовали с помощью ELISA. Уровень ответа TNF-α достиг максимального уровня 43,28 ± 5,15 пг/мл через 8 часов, когда клетки U937 индуцировали к дифференцировке (рис. A).В присутствии 10 мкг/мл экстракта MeOHGCM6 во время дифференцировки клеток U937 уровень ответа TNF-α значительно снижался до 8 часов [0,14 ± 0,28 пг/мл ( p  < 0,001)] и был сравним с наблюдаемым в наличие бетаметазона [0,28 ± 0,56 пг/мл ( p  < 0,001)].

Обработка экстрактом MeOHGCM6 на уровень ответа TNF-α и экспрессию генов TNF-α и IL-6 во время дифференцировки моноцитарных клеток U937. Моноцитарные клетки U937 индуцировали для дифференцировки с помощью 10 нМ ФМА.При дифференцировке моноцитарные клетки U937 обрабатывали экстрактом MeOHGCM6. ( A ) Уровень ответа TNF-α определяли количественно с помощью ELISA. Уровни экспрессии генов ( B ) TNF-α и ( C ) IL-6 количественно определяли с использованием qRT-PCR. Результаты были выражены как среднее значение  ± S.D. из четырехкратного анализа.

Влияние обработки экстрактом MeOHGCM6 на экспрессию генов TNF-α и IL-6 во время дифференцировки клеток U937

Регулирование TNF-α и IL-6 обработкой экстрактом MeOHGCM6 во время дифференцировки клеток уровень экспрессии генов с помощью qRT-PCR.Уровень экспрессии гена TNF-α достиг пика через 6 часов (3,16 ± 0,48 копий/актин) дифференцировки клеток U937 (рис. B). Уровень экспрессии гена TNF-α снижался в течение первых 6 часов [0,52 ± 0,28 копий/актин ( p  < 0,001)] дифференцировки клеток U937 в присутствии 10 мкг/мл экстракта MeOHGCM6. Снижение уровня экспрессии гена TNF-α в клетках U937 во время дифференцировки при обработке 10 мкг/мл MeOHGCM6 было сравнимо или лучше результатов обработки 10 нМ бетаметазона [0.55 ± 0,42 копий/актин ( p  < 0,001)]. Уровень экспрессии гена IL-6 значительно увеличился и достиг пика 0,68 ± 0,09 копий/актин через 12 часов дифференцировки клеток U937 (рис. C). Наблюдалось снижение уровня экспрессии гена IL-6: 0,10 ± 0,01 копий/актин, 0,23 ± 0,02 копий/актин ( p  < 0,01), 0,37 ± 0,04 копий/актин ( p  0,0± 0)0. 0,05 копий/актин ( p  < 0,001) через 3, 6, 9 и 12 часов соответственно, когда клетки U937 во время дифференцировки обрабатывали 10 мкг/мл экстракта MeOHGCM6.Ингибирование уровней экспрессии гена IL-6 в присутствии экстракта MeOHGCM6 было сравнимо с бетаметазоном.

Профилактическое воздействие экстракта MeOHGCM6 на содержимое желудка крыс после острого повреждения слизистой оболочки желудка, вызванного EtOH

подача этанола. 2,45 ± 0,25 г желудочной слизи и 1.75   ± 0,20 мл желудочного сока было извлечено из желудка крыс, которых кормили только разбавителем экстракта (таблица). 1,54 ± 0,31 г желудочной слизи и 0,96 ± 0,25 мл желудочного сока и 1,68 ± 0,19 г желудочной слизи и 0,96 ± 0,16 мл желудочного сока были извлечены из крыс, предварительно обработанных 250 и 500 мг / кг массы тела. экстракта MeOHGCM6 соответственно. Для сравнения, 2,31 ± 0,42 г желудочной слизи и 1,15 ± 0,36 мл желудочного сока было извлечено у крыс, предварительно обработанных 20 мг/кг массы тела OMP. 2,75 ± 0.49 г желудочной слизи и 1,75 ± 0,28 мл желудочного сока были извлечены у крыс, которых кормили аналогичным образом приготовленным экстрактом неродственного растения, которые служили в качестве контроля NSPE. Эта контрольная группа продуцировала большое количество желудочной слизи и желудочного сока, значительно по сравнению с крысами, получавшими экстракт MeOHGCM6. рН желудочной слизи крыс, предварительно получавших 2,5, 5,0, 250 и 500 мг/кг м.т. Экстракт MeOHGCM6 был 5,51 ± 0,86, 5,42 ± 0,71, 4,74 ± 0,38 и 3,82 ± 0,24 соответственно (таблица). Для сравнения, рН слизи крыс, обработанных разбавителем экстракта, 20 мг/кг b.ж. OMP, а также контроль NPSE составили 7,40 ± 0,15, 6,97 ± 0,37 и 4,35 ± 0,19 соответственно.

Таблица 2

Эффекты экстракта MeOHGCM6 Предварительная обработка на содержание крысиного желудка после EtOH-индуцированной травмой слизистой оболочки желудка

3 N = 6)

5


доза (мг / кг B.w.) производство слизи (G) объем желудочного сока (мл)
Diluent

2.45 ± 0,61
1,75 ± 0,50
7,40 ± 0,37
NSPE
500,0
2,75 ± 1,21
1,75 ± 0,69
4,35 ± 0,47 *
ОМР
20.0
291 ± 1,04
1,15 ± 0,88
6,97 ± 0,92
Meohgcm6
2,50242 233 ± 0,77
1.50 ± 0,61
5,51 ± 2,10

5,0
3,24 ± 1,39
1,50 ± 0,61
5,42 ± 1,73

250,0
1,54 ± 0,77
0,96 ± 0,62
4,74 ± 0,93 *
500,0 1,68 ± 0,47 0,96 ± 0,40 3,82 ± 0,58 *

эффекты профилактического лечения с экстрактом MeOHGCM6 предварительная обработка продукции NP-SH желудка после острого повреждения слизистой оболочки желудка, вызванного EtOH

Уровень NP-SH в желудке определяли в железе крыс, предварительно обработанных экстрактом MeOHGCM6, после острого повреждения слизистой оболочки желудка, вызванного EtOH из крысиного желудка.Уровень NP-SH составлял 0,15 ± 0,01 нмоль/г ткани у крыс, которых кормили разбавителем (таблица). Сопоставимый уровень (0,15 ± 0,01 нмоль/г ткани) был получен в желудке крыс, предварительно получавших 2,5 мг/кг массы тела. Экстракт MeOHGCM6. Уровни NP-SH в группах крыс, предварительно получавших 5,0, 250 и 500 мг/кг м.т. Экстракт MeOHGCM6 составлял 0,23 ± 0,01 нмоль/г ткани, 0,33 ± 0,03 нмоль/г ткани и 0,41 ± 0,02 нмоль/г ткани соответственно, и это показало значительное дозозависимое увеличение. Уровень NP-SH в ткани группы крыс, предварительно получавших ОМП, равнялся 0.33 ± 0,03 нмоль/г, и он был сравним с его аналогом у крыс, предварительно получавших 250 мг/кг массы тела. Экстракт MeOHGCM6.

Таблица 3

Таблица 3

Эффекты экстракта MeOHGCM6 Предварительная обработка на производство желудка NP-SH в ETOH-индуцированной травме слизистой оболочки желудка

3

N = 6)

8 = 6)

8


Доза (мг/кг массы тела) Концентрация NP-SH (нмоль/г ткани)
Разбавитель
15 ± 0,04
NSPE
500,0
0,23 ± 0,03
ОМР
20,0
0,33 ± 0,83 *
MeOHGCM6
2,5
0,15 ± 0.57

50243 5.0 0,23 ± 0.28

250,0
250,0
0,33 ± 0,69 *
50000.0 0,41 ± 0,53*

Влияние обработки экстрактом MeOHGCM6 на поражения желудка после индуцированного EtOH острого повреждения слизистой оболочки желудка

острое повреждение слизистой оболочки желудка. Макроскопическое исследование желудка крыс, получавших EtOH, показало четко очерченные очаговые геморрагические изъязвления или четко очерченные геморрагические эрозии с красными линиями разного размера вдоль длинной оси железистой части желудка (рис. А).Основные поражения желудка, вызванные EtOH, имели размер примерно 1290,13 ± 88,16 мм 2 и наблюдались у крыс, предварительно обработанных разбавителями экстракта (таблица). Эти результаты согласуются с ранее опубликованными данными [31]. Снижение язвой площади на 675-304,02 мм 2 , 298,93 ± 56,06 мм 2 , 52,80-204 2 , 52,80 ± 20,25 мм 2 и 7,20 ± 3,72 мм 2 наблюдалось в группах крыс, предварительно обработанных 2,5, 5,0 , 250 и 500 мг/кг м.т. Экстракт MeOHGCM6, соответственно, по сравнению с площадью язвы в желудке контрольной группы, получавшей растворитель (1290.13 ± 88,16 мм 2 ) (таблица). Практически не было отмечено никаких поражений (> 98%) у крыс, предварительно обработанных OMP перед обработкой EtOH (рис. C). Крысы, предварительно обработанные 500 мг/кг м.т. Экстракт MeOHGCM6 показал почти полное (>99%, p < 0,05) ингибирование EtOH-индуцированного изъязвления, сравнимое или лучше, чем у крыс, получавших 20 г/кг массы тела. OMP (рисунок G, таблица ).

Влияние обработки экстрактом MeOHGCM6 на поражения желудка после острого повреждения слизистой оболочки желудка, вызванного EtOH. Крыс кормили различными концентрациями экстракта MeOHGCM6 за 30 минут до кормления 1 мл абсолютного EtOH. Крыс умерщвляли через час и быстро извлекали желудок и разрезали его по большой кривизне. ( A ) Разбавитель. ( B ) НСПЕ. ( C ) ОМП. ( D ) 2,5 мг/кг м.т. MeOHGCM6. ( E ) 5 мг/кг м.т. MeOHGCM6. ( F ) 250 мг/кг м.т. MeOHGCM6. ( G ) 500 мг/кг м.т. MeOHGCM6. В необработанных контрольных желудках были обнаружены обширные некротические поражения слизистой оболочки, вызванные EtOH, в основном в теле (стрелки).Клетки фотографировали с помощью камеры Nikon D70. Показан один архетипический набор фотографий.

Таблица 4 9001

Эффекты экстракта MeOHGCM6 Предварительная обработка на размере EtOH-индуцированных желудка-поражений

23

3 лечение ( N = 6)

8 3 доза (мг / кг b.w.)

)
UA (мм 2 ) ) ) ) ) ) )
Разбавитель

1290.13 ± 215,95

NSPE
500,0
664,27 ± 143,01 *
48,51
ОМР
20,0
17,47 ± 14,20 *
98,65
Meohgcm6
29
675,00 ± 744,69 *
47,68
47.68

5.0
298.93 ± 137.31 *
76,83

250,0
52,80 ± 49,61 *
95,91
500,0 7,20 ± 9,11 * 99,44

Обсуждение

Воспаление является основным признаком многих заболеваний. Он затрагивает от 5% до 7% всего населения во всем мире [32]. Воспаление, возникающее в желудочно-кишечном тракте, по большому счету вызывает язву желудочно-кишечного тракта.Язвенная болезнь желудочно-кишечного тракта представляет собой серьезное экономическое бремя, поскольку лечение язвы составляет не менее 10% от общей стоимости лечения расстройств пищеварения [33,34]. Эффективное лечение этого воспалительного заболевания с использованием более безопасных и эффективных терапевтических средств остается недостижимой целью. Мы исследовали стандартизированный экстракт MeOHGCM6 малазийских красных водорослей, Gracilaria changii (Xia et Abbott) Abbott, Zhang et Xia, на предмет его потенциальной противовоспалительной, гастропротекторной и антиульцерогенной активности.

В настоящем исследовании приготовление экстракта было стандартизировано для обеспечения воспроизводимости результатов, и каждая партия экстракта была профилирована с помощью ЖХ/МС. Профилирование экстракта MeOHGCM6 с помощью ЖХ/МС позволило получить подробный хроматографический профиль компонентов экстракта. Высоковоспроизводимые профили пиков масс-спектра экстракта MeOHGCM6 использовали для обозначения фракции, идентифицированной здесь как стандартизированный экстракт MeOHGCM6, для всех последующих экспериментов. Предварительный анализ экстракта MeOHGCM6 выявил наличие двух возможных хлорофиллов, метил-10-гидроксифеофорбида и и 10-гидроксифеофитина в качестве основных компонентов экстракта MeOHGCM6.В соответствии с нашими выводами доказано, что феофитин a, , тип соединения, связанного с хлорофиллом, который был обнаружен в зеленых водорослях, обладает противовоспалительной активностью [35]. Неизвестно, способствовали ли эти два хлорофилла описанным здесь противовоспалительным эффектам, и это потребует дальнейшего изучения. Однако требуется подробное профилирование стандартизированного экстракта MeOHGCM6, чтобы охарактеризовать соединение, ответственное за задействованный механизм.

В исследовании была создана модель воспаления с использованием дифференцировки моноцитов в макрофагоподобные клетки.Характеристика макрофагоподобных клеток для выявления воспалительных эффектов важна, поскольку эти клетки играют важную роль в воспалительных и иммунных реакциях, а также отвечают за различные иммунные функции, такие как секреция медиаторов воспаления. Клетка U937 является подходящей моделью, поскольку дифференцировку этой клетки-предшественника в макрофагоподобные клетки можно удобно изучать в ответ на различные стимулы [36]. Дифференцировку определяли по морфологии клеток и физиологическим маркерам.Количество дифференцированных клеток увеличивалось, когда клетки U937 индуцировали к дифференцировке с увеличением концентрации ФМА (1–50 нМ) и более длительным периодом инкубации (24–48 часов). В нашем исследовании мы использовали жизнеспособные, интактные и метаболически активные дифференцированные клетки U937. Во время дифференцировки клеток U937 клетки оценивали по проценту жизнеспособных клеток. Дозозависимое снижение клеточной жизнеспособности дифференцированных клеток U937 наблюдали, когда клетки индуцировали к дифференцировке с увеличением концентрации ФМА (1–50 нМ) и более длительным периодом инкубации (24–48 часов).На основании этих результатов клетки U937 индуцировали для дифференцировки с помощью 10 нМ ФМА в течение 24 часов во всех последующих экспериментах. Эти условия исследования были выбраны для обеспечения того, чтобы моноцитарные клетки были более чем на 50% дифференцированы в макрофагоподобные клетки, не влияя на жизнеспособность клеток и метаболическую активность.

Клетки U937 во время дифференцировки (воспалительные явления, опосредованные макрофагами) затем использовали для исследования противовоспалительной активности экстракта MeOHGCM6. Результаты, представленные в этом исследовании, позволяют предположить, что экстракт MeOHGCM6 может оказывать значительное противовоспалительное действие на уровень ответа TNF-α.Снижение уровня ответа TNF-α было сопоставимо с бетаметазоном, коммерчески доступным противовоспалительным препаратом, обычно используемым для лечения воспаления [37]. В течение 0–8 часов после дифференцировки клеток U937 мы обнаружили быстрое повышение уровня ответа TNF-α. Однако ответ TNF-α клеток U937 во время дифференцировки был значительно заблокирован в присутствии 10 мкг/мл экстракта MeOHGCM6. Наши результаты также свидетельствуют о том, что экстракт MeOHGCM6 может оказывать значительное противовоспалительное действие на уровень экспрессии генов TNF-α и IL-6.Это было продемонстрировано способностью экстракта MeOHGCM6 подавлять уровень экспрессии генов TNF-α и IL-6 в процессе дифференцировки клеток U937. Подавляющее действие экстракта MeOHGCM6 на провоспалительные цитокины вряд ли связано с неспецифической ингибирующей активностью клеток, поскольку 10 мкг/мл, использованные для этих исследований, не были цитотоксичны для клеток. Этот вывод аналогичен предыдущим исследованиям, которые показали, что красные водоросли обладают способностью ингибировать воспаление in vitro и подавлять выработку медиаторов воспаления [38,39].

Наши результаты также свидетельствуют о том, что экстракт MeOHGCM6 обладает гастропротекторной и антиульцерогенной активностью. Это было подтверждено способностью лечения экстрактом MeOHGCM6 улучшать острое повреждение слизистой оболочки желудка, вызванное абсолютным EtOH. Наши результаты показали, что экстракт MeOHGCM6 при использовании для лечения крыс перед кормлением EtOH обеспечивает защиту желудочно-кишечного тракта от острого повреждения слизистой оболочки желудка, вызванного EtOH. Гастропротекторный эффект экстракта MeOHGCM6 зависел от дозы, и эффект лечения 500 мг/кг b.ж. был сравним с OMP, широко назначаемым ингибитором протонной помпы, который ингибирует секрецию желудочного сока, используемым для лечения язвы желудка [40]. Неспецифические полезные эффекты какого-либо растительного экстракта невозможны, поскольку мы показали, что крысы, предварительно обработанные неродственным, но аналогичным образом приготовленным растительным экстрактом (NSPE), не проявляли сходных желудочных реакций и существенного ингибирования острого раздражения слизистой оболочки желудка, вызванного EtOH. рана. Однако механизм, способствующий гастропротекторному действию экстракта MeOHGCM6, вероятно, отличается от механизма OMP.Экстракт уменьшал секрецию желудочного сока и желудочной слизи и снижал рН желудочного сока до 4,74 ± 0,38 при дозе 250 мг/кг массы тела. Напротив, OMP снижал секрецию желудочной слизи и нейтрализовал pH желудочного сока до 6,97 ± 0,37. Наши результаты лечения OMP аналогичны ранее опубликованным [41]. Нейтрализация pH желудка является одним из известных побочных эффектов OMP, которые могут способствовать изменению нормальной флоры желудка, таким образом, предрасполагая к диарейным заболеваниям. Снижение pH желудочного сока экстрактом MeOHGCM6 может быть полезным для восстановления нормальной флоры [42], что могло способствовать гастропротекторному и антиульцерогенному свойству экстракта MeOHGCM6.Наши результаты также показывают, что экстракт MeOHGCM6, подобный OMP, увеличивает содержание NP-SH в желудке. Было показано, что NP-SH оказывает гастропротекторное действие против агентов, индуцирующих кислородные радикалы, таких как EtOH [43,44]. Считается, что механизмы острого повреждения слизистой оболочки желудка, вызванного EtOH, возникают в результате истощения содержимого желудочной слизи, нарушения кровотока слизистой оболочки, кровоизлияния и некроза тканей слизистой оболочки, а также чрезмерной продукции свободных радикалов, которые приводят к усилению перекисного окисления липидов [45]. ].Тогда кислородные радикалы инициируют окислительный стресс, который способствует возникновению всех форм желудочно-кишечных язв. В соответствии с нашими выводами ранее сообщалось, что красные водоросли Gracilaria changii обладают активностью по удалению свободных радикалов [46]. Недавнее исследование также показало, что водоросли обладают антиоксидантными свойствами, которые могут быть полезны для профилактики или лечения язвы желудка [22,47-49].

Заключение

Мы продемонстрировали, что экстракт MeOHGCM6, стандартизированный ЖХ/МС, может модулировать опосредованную макрофагами избыточную продукцию провоспалительных цитокинов in vitro .Это свойство согласуется с его способностью оказывать гастрозащитное действие против вызванного EtOH острого повреждения слизистой оболочки желудка и улучшать заживление язв. Гастропротекторный потенциал экстракта MeOHGCM6 может быть частично обусловлен его способностью действовать и снижать кислотность желудка. Препарат на основе водорослей, обладающий противовоспалительной и желудочной противоязвенной активностью, имеет большое терапевтическое значение, так как большинство противовоспалительных средств, используемых в современной медицине, являются ульцерогенными.Однако необходимы дальнейшие исследования для выяснения точных молекулярных и клеточных механизмов действия и эффектов экстракта MeOHGCM6 при лечении хронических язв.

Конкурирующие интересы

Авторы заявляют об отсутствии конкурирующих интересов.

Вклад авторов

MHS провел большую часть экспериментов, проанализировал данные и написал рукопись; DA выполнил некоторые части эксперимента, предоставил часть реагентов/аналитических инструментов и проанализировал данные; KZ написал рукопись; SAB разработала эксперимент, предоставила реагенты/аналитические инструменты, проанализировала данные и написала рукопись.Все авторы прочитали и одобрили окончательный вариант рукописи.

Благодарности

Это исследование финансировалось Министерством науки, технологий и инноваций (MOSTI), Малайзии (грант на биотехнологические исследования № 06-02-02-003 BTK/ER/016) и Малайским университетом (грант Фонда последипломных исследований). № PS184/2007B). Мы искренне благодарим профессора доктора Пханг Сью Мой за помощь в идентификации и сборе Gracilaria changii , доктора Хабса Мохамада за подготовку и предоставление экстракта Gracilaria changii и профессора доктора С.Махмуду Амину Абдулле за помощь в исследованиях на животных.

Ссылки

  • Вильярреал Г., Загорски Дж., Валь С.М. Энциклопедия наук о жизни (ELS) Лондон: Nature Publishing Group; 2001. Воспаление: острое. [Google Scholar]
  • Sacca R, Cuff CA, Ruddle NH. Медиаторы воспаления. Курр Опин Иммунол. 1997; 9: 851–857. doi: 10.1016/S0952-7915(97)80189-6. [PubMed] [CrossRef] [Google Scholar]
  • Wakefield D, Kumar RK. Энциклопедия наук о жизни (ELS) Лондон: Nature Publishing Group; 2001.Воспаление: хроническое. [Google Scholar]
  • Зонненберг А. В кн.: Болезни органов пищеварения в США: эпидемиология и влияние. Эверхарт Дж. Э., редактор. Вашингтон, округ Колумбия: Публикация Национального института здравоохранения; 1994. Язвенная болезнь; стр. 357–408. [Google Scholar]
  • Грэм Д.Ю. Инфекция Helicobacter pylori в патогенезе язвенной болезни двенадцатиперстной кишки и рака желудка: модель. Гастроэнтерол. 1997; 113(6):1983–1991. doi: 10.1016/S0016-5085(97)70019-2. [PubMed] [CrossRef] [Google Scholar]
  • Аль-Мофлех И.А., Аль-Рашед Р.С.Нестероидные, противовоспалительные лекарственные поражения желудочно-кишечного тракта и связанные с ними побочные реакции: эпидемиология, патогенез и лечение. Саудовская J Гастроэнтерол. 2007;13(3):107–113. doi: 10.4103/1319-3767.33460. [PubMed] [CrossRef] [Google Scholar]
  • Якуб Дж., Джафри В., Джафри Н., Ислам М., Абид С., Хамид С., АлиШах Х., Шейх Х. Распространенность не- Helicobacter pylori язвы двенадцатиперстной кишки в Карачи, Пакистан . Мир J Гастроэнтерол. 2005;11(23):3562–3565. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Benjamini E, Sunshine G, Leskowitz S.Иммунология: краткий курс. 3. Нью-Йорк: John Wiley and Sons, Inc.; 1996. [Google Scholar]
  • Tripathi KD. Основы медицинской фармакологии. 5. Нью-Дели: Медицинское издательство Jaypee Brothers (P) Ltd; 2003. Лекарства от язвенной болезни; стр. 587–598. [Google Scholar]
  • Tytgat GNJ. Лечение язвенной болезни. пищеварение. 1998; 59: 446–452. doi: 10.1159/000007522. [PubMed] [CrossRef] [Google Scholar]
  • Даджани Э.З., Кламут М.Дж. Новые терапевтические подходы к язве желудка и двенадцатиперстной кишки: обновление.Мнение эксперта. Инвестируйте в наркотики. 2000;9(7):1537–1544. doi: 10.1517/13543784.9.7.1537. [PubMed] [CrossRef] [Google Scholar]
  • Смит А.Дж. Лекарственное и фармацевтическое использование натуральных продуктов из морских водорослей: обзор. J Прикладной Phycol. 2004;16(4):245–262. [Google Scholar]
  • Дхаргалкар В.К., Перейра Н. Морские водоросли: перспективное растение тысячелетия. Научная культура. 2005; 4: 60–66. [Google Scholar]
  • Канг ДЖИ, Хан МНА, Пак НХ, Чо ДЖИ, Ли МЦ, Фуджи Х, Хун ЮК. Жаропонижающее, обезболивающее и противовоспалительное действие морских водорослей Sargassum fulvellum и Sargassum thunbergii у мышей.J Этнофармакол. 2008; 116: 187–190. doi: 10.1016/j.jep.2007.10.032. [PubMed] [CrossRef] [Google Scholar]
  • Гонсалес Р., Родригес С., Ромей С., Анчета О., Гонсалес А., Арместа Дж., Ремирес Д., Мерино Н. Противовоспалительная активность экстракта фикоцианина при колите, вызванном уксусной кислотой при крысы. Фармакол рез. 1999;39(1):55–59. doi: 10.1006/phrs.1998.0409. [PubMed] [CrossRef] [Google Scholar]
  • Yeh CC, Yang JL, Lee JC, Tseng CN, Chan YC, Hseu YC, Tang JY, Chuang LY, Huang HW, Chang FR, Chang HW.Антипролиферативное действие метанольного экстракта Gracilaria tenuistipitata на раковые клетки ротовой полости включает апоптоз, повреждение ДНК и окислительный стресс. Дополнительный альтернативный мед. BMC. 2012;12:142. doi: 10.1186/1472-6882-12-142. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Khan MNA, Cho JY, Lee MC, Kang JY, Park NG, Fujii H, Hong YK. Выделение двух противовоспалительных и одной провоспалительной полиненасыщенных жирных кислот из бурых водорослей Undaria pinnatifida .J Agr Food Chem. 2007; 55: 6984–6988. doi: 10.1021/jf071791s. [PubMed] [CrossRef] [Google Scholar]
  • Khan MNA, Choi JS, Lee MC, Kim E, Nam TJ, Fujii H, Hong YK. Противовоспалительная активность метанольных экстрактов различных видов морских водорослей. Дж. Энвир Биол. 2008;29(4):465–469. [PubMed] [Google Scholar]
  • Lee HJ, Dang HT, Kang GJ, Yang EJ, Park SS, Yoon WJ, Jung JH, Kang HK, Yoo ES. Две еноновые жирные кислоты, выделенные из Gracilaria verrucosa , подавляют выработку медиаторов воспаления путем снижения активности NF-κB и STAT1 в стимулированном липополисахаридами Raw 264.7 кл. Арка 2009;32(3):453–462. doi: 10.1007/s12272-009-1320-0. [PubMed] [CrossRef] [Google Scholar]
  • Kwon MJ, Nam TJ. Полисахарид морской водоросли Capsosiphon fulvescens индуцирует апоптоз в клетках рака желудка AGS через IGF-IR-опосредованный путь PI3K/Akt. Cell Biol Int. 2007;31(8):768–775. doi: 10.1016/j.cellbi.2007.01.010. [PubMed] [CrossRef] [Google Scholar]
  • Синица А., Ким В.Дж., Ким С.М., Пол Р., Синица А., Квасничка Ф., Чопикова Ю., Парк Ю.И. Структура и противоопухолевое действие фукоидана, выделенного из спорофилла корейской бурой водоросли Undaria pinnatifida .Карбогидр Полим. 2010;81:41–48. doi: 10.1016/j.carbpol.2010.01.052. [CrossRef] [Google Scholar]
  • Вонг П.Ф., Тан Л.Дж., Нави Х., АбуБакар С. Протеомика красных водорослей, Gracilaria changii (Gracilariales, Rhodophyta) J Phycol. 2006; 42: 113–120. doi: 10.1111/j.1529-8817.2006.00182.x. [CrossRef] [Google Scholar]
  • Phang SM. В сб.: Систематика водорослей водорослей применительно к некоторым тихоокеанским видам. Том V. Эбботт И.А., изд. Ла-Хойя, Калифорния: Публикация Калифорнийского колледжа морских грантов; 1994.Некоторые виды Gracilaria из полуостровной Малайзии и Сингапура; стр. 125–134. [Google Scholar]
  • Пханг С.М., Шахаруддин С., Норайша Х., Сасекумар А. Исследования Gracilaria changii (Gracilariales, Rhodophyta) из мангровых зарослей Малайзии. Гидробиология. 1996;326(27):347–352. [Google Scholar]
  • Мохамад Х., Зайнудин Н., Шахаром Ф., Мохамад К., Абдулла С.А. Протокол очистки и экстракции Gracilaria changii . ДЖЕМС. 2006;1(2):107–112. [Google Scholar]
  • Розмарин А.Г., Вейл С.К., Рознер Г.Л., Гриффин Д.Д., Арнаут М.А., Тенен Д.Г.Дифференциальная экспрессия генов CDllb/CD18 (моль) и миелопероксидазы при дифференцировке миелоидных клеток. Кровь. 1989; 73: 131–136. [PubMed] [Google Scholar]
  • Kikuchi H, Lizuka R, Sugiyama S, Gon G, Mori H, Arai M, Mizumoto K, Imajoh-Ohmi S. Дифференцировка моноцитов модулирует апоптотический ответ на цитотоксические антитела против Fas и фактор некроза опухоли α в клетках монобласта U937 человека. Дж. Лейкок Биол. 1996; 60: 778–783. [PubMed] [Google Scholar]
  • Yeung MC, Liu J, Lau AS. Существенная роль индуцируемой интерфероном двухцепочечной РНК-активируемой протеинкиназы PKR в апоптозе, индуцированном фактором некроза опухоли, в клетках U937.Proc Nat Acad Sci USA. 1996;93:12451–12455. doi: 10.1073/pnas.93.22.12451. [Статья бесплатно PMC] [PubMed] [CrossRef] [Google Scholar]
  • Wong PF, AbuBakar S. Сравнительное транскрипционное исследование эффектов высокого внутриклеточного цинка на клетки карциномы простаты. Oncol Rep. 2010; 23:1501–1516. [PubMed] [Google Scholar]
  • Седлак Дж., Линдси Р.Х. Оценка общих, связанных с белками и небелковых сульфгидрильных групп в ткани с помощью реактива Эллмана. Анальная биохимия. 1968; 25: 192–205. [PubMed] [Google Scholar]
  • Lima ZP, Severi JA, Pellizzon CH, Brito ARMS, Solis PN, Caceres A, Giron LM, Vilegas W, Hiruma-Lima CA.Можно ли использовать водный отвар цветков манго как противоязвенное средство? J Этнофармакол. 2006; 106: 29–37. doi: 10.1016/j.jep.2005.11.032. [PubMed] [CrossRef] [Google Scholar]
  • Williams JP, Meyers JA. Иммуноопосредованные воспалительные заболевания (IMID): экономические и клинические затраты. Am J Manag Care. 2002;8(21):664–681. [PubMed] [Google Scholar]
  • Brown DM, Everhart JE. В: Заболевания пищеварительного тракта в Соединенных Штатах: эпидемиология и влияние. Эверхарт Дж. Э., редактор. Вашингтон, округ Колумбия: Публикация Национального института здравоохранения; 1994.Стоимость болезней органов пищеварения в США; стр. 57–82. [Google Scholar]
  • Sandler RS, Everhart JE, Donowitz M, Adams E, Cronin K, Goodman C, Gemmen E, Shah S, Avdic A, Rubin R. Бремя отдельных заболеваний органов пищеварения в США. Гастроэнтерол. 2002; 122:1500–1511. doi: 10.1053/gast.2002.32978. [PubMed] [CrossRef] [Google Scholar]
  • Okai Y, Higashi-Okai K. Мощная противовоспалительная активность феофитина a , полученного из съедобных зеленых водорослей, Enteromorpha prolifera (Sujiao-nori) Int J lmmunopharmacol.1997;19(6):355–358. doi: 10.1016/S0192-0561(97)00070-2. [PubMed] [CrossRef] [Google Scholar]
  • Hass R, Lonnemann G, Mānnel D, Topley N, Hartmann A, Köhler L, Resch K, Goppelt-Strube M. Регуляция TNF-α, IL-1 и IL- 6 синтез в дифференцирующихся клетках монобластоидного лейкоза человека U937. Лейкемия рез. 1991;15(5):327–339. doi: 10.1016/0145-2126(91)-H. [PubMed] [CrossRef] [Google Scholar]
  • Illanes J, Dabancens A, Acuña O, Fuenzalida M, Guerrero A, Lopez C, Lemus D. Влияние бетаметазона, сулиндака и хинакринных препаратов на воспалительный неоангиогенез, вызванный полиуретановой губкой имплантирован в мышь.Биол Рез. 2002; 35:3–4. [PubMed] [Google Scholar]
  • Bergé JP, Debiton E, Dumay J, Durand P, Barthomeuf C. In vitro Противовоспалительная и антипролиферативная активность сульфолипидов красной водоросли Porphyridium cruentum . J Agr Food Chem. 2002;50:6227–6232. doi: 10.1021/jf020290y. [PubMed] [CrossRef] [Google Scholar]
  • Lee HJ, Dang HT, Kang GJ, Yang EJ, Park SS, Yoon WJ, Jung JH, Kang HK, Yoo ES. Две еноновые жирные кислоты, выделенные из Gracilaria verrucosa , подавляют выработку медиаторов воспаления путем снижения активности NF-κB и STAT1 в стимулированном липополисахаридами Raw 264.7 кл. Арк Фарм Рез. 2009;32(3):453–462. doi: 10.1007/s12272-009-1320-0. [PubMed] [CrossRef] [Google Scholar]
  • Мартелли А., Маттиоли Ф., Мерето Э., Кампарт ГБ, Сини Д., Бергамаски Г., Брамбилла Г. Оценка генотоксичности омепразола в батарее анализов in vitro и in vivo. Токсикология. 1998; 130:29–41. doi: 10.1016/S0300-483X(98)00101-2. [PubMed] [CrossRef] [Google Scholar]
  • Larsson H, Hakanson R, Mattsson H, Ryberg B, Sundler F, Carlsson E. Омепразол: его влияние на секрецию желудочного сока, гастрин и клетки ECL.Токсикол патол. 1988;16(2):267–272. doi: 10.1177/019262338801600220. [PubMed] [CrossRef] [Google Scholar]
  • Малайраджан П., Гопалакришнан Г., Нарасимхан С., Кавимани С. Противоязвенная активность Ficus glomerata . Фарм Биол. 2007;45(9):674–677. doi: 10.1080/13880200701574562. [CrossRef] [Google Scholar]
  • Szabo S, Trier JS, Frankel PW. Сульгидрильные соединения могут опосредовать цитозащиту желудка. Наука. 1981; 214: 200–202. doi: 10.1126/science.7280691. [PubMed] [CrossRef] [Google Scholar]
  • Селеньи И., Брюн К.Возможная роль свободных радикалов кислорода в индуцированном этанолом повреждении слизистой оболочки желудка у крыс. Дайджест Dis Sci. 1988; 33: 865–871. doi: 10.1007/BF01550977. [PubMed] [CrossRef] [Google Scholar]
  • Birdane FM, Cemek M, Birdane YO, Gülçin İ, Büyükokuroğlu ME. Благотворное влияние Foeniculum vulgare на вызванное этанолом острое повреждение слизистой оболочки желудка у крыс. Мир J Гастроэнтерол. 2007;13(4):607–611. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Шринивасан С., Ибрагим Д., Мохд-Кассим М.Дж.Н. Активность по удалению свободных радикалов и общее количество фенольных соединений Gracilaria changii .Int J Nat Eng Sci. 2007;1(3):115–117. [Google Scholar]
  • Okuzumi J, Takahashi T, Yamane T, Kitao Y, Inagake M, Ohya K, Nishino H, Tanaka Y. Ингибирующее действие фукоксантина, природного каротиноида, на N-этил-N’-нитро-N -Нитрозогуанидин-индуцированный канцерогенез двенадцатиперстной кишки у мышей. Рак Летт. 1993; 68: 159–168. doi: 10.1016/0304-3835(93)

    -V. [PubMed] [CrossRef] [Google Scholar]

  • Yan X, Chuda Y, Suzuki M, Nagata T. Фукоксантин как основной антиоксидант в Hijikia fusiformis , обыкновенной съедобной морской водоросли.Биоски Биотехнолог Биохим. 1999; 63: 605–607. doi: 10.1271/bbb.63.605. [PubMed] [CrossRef] [Google Scholar]
  • Ранкович Б.Р., Косанич М.М., Станойкович Т.П. Антиоксидантная, противомикробная и противораковая активность лишайников Cladonia furcata, Lecanora atra и Lecanora muralis. BMC Комплемент Alter Med. 2012;11:97. [Бесплатная статья PMC] [PubMed] [Google Scholar]

Морские водоросли и гипертрофический гастрит, клиническое исследование фазы IV по данным FDA

Резюме:

Мы изучаем 71 человека, которые принимают морские водоросли или страдают гипертрофическим гастритом.Нет сообщений о гипертрофическом гастрите у людей, принимающих морские водоросли.

Клиническое исследование фазы IV создано eHealthMe на основе отчетов FDA и регулярно обновляется.

Используя большие медицинские данные и алгоритмы искусственного интеллекта, eHealthMe позволяет всем желающим проводить клинические испытания IV фазы для выявления побочных эффектов лекарств и мониторинга эффективности. Наши оригинальные исследования упоминались более чем в 600 рецензируемых медицинских изданиях, включая The Lancet, Mayo Clinic Proceedings и Nature.Совсем недавно были добавлены клинические испытания фазы IV для вакцин против COVID 19, проверьте здесь.



Что такое водоросли?

Морские водоросли содержат активные ингредиенты хлореллы . eHealthMe изучает 8 пользователей морских водорослей на предмет их эффективности, альтернативных лекарств и многого другого.

Что такое гипертрофический гастрит?

По данным eHealthMe, гипертрофический гастрит (разрастание слизистой оболочки желудка с воспалением) связан с 30 лекарствами и 33 состояниями.

Вы принимаете морские водоросли и у вас гипертрофический гастрит?

Проверьте, не связан ли гипертрофический гастрит с приемом лекарств или с каким-либо заболеванием

Как использовать исследование?

Вы можете обсудить исследование со своим врачом, чтобы полностью обсудить и понять все риски и преимущества лекарств.

Связанные исследования

Альтернативные препараты, плюсы и минусы морских водорослей:
Лечение гипертрофического гастрита и многое другое:
Вакцины против COVID, связанные с гипертрофическим гастритом:
Насколько тяжелым был Гастрит гипертрофический и когда вылечился:
Расширение на все препараты, содержащие ингредиенты
хлореллы :
Все препараты, связанные с гипертрофическим гастритом:
Все состояния, связанные с гипертрофическим гастритом:

Как исследование использует данные?

В исследовании используются данные FDA.Он основан на хлорелле (активные ингредиенты морских водорослей) и морских водорослях (торговая марка). Другие препараты с такими же активными ингредиентами (например, дженерики) не учитываются. Дозировка препаратов в исследовании не рассматривается.

Кто такой eHealthMe?

Используя большие медицинские данные и проверенные алгоритмы искусственного интеллекта, eHealthMe предоставляет всем желающим платформу для проведения клинических испытаний фазы IV. Мы изучаем миллионы пациентов и еще 5000 каждый день. Результаты нашего исследования наркотиков в реальных условиях упоминаются в более чем 600 рецензируемых медицинских публикациях, включая The Lancet, Mayo Clinic Proceedings и Nature.Результаты нашего анализа доступны для исследователей, медицинских работников, пациентов (отзывы) и разработчиков программного обеспечения (открытый API).

ПРЕДУПРЕЖДЕНИЕ, ОТКАЗ ОТ ОТВЕТСТВЕННОСТИ, ИСПОЛЬЗОВАНИЕ ДЛЯ ПУБЛИКАЦИИ

ПРЕДУПРЕЖДЕНИЕ : НЕ ПРЕРЫВАЙТЕ ПРИЕМ ЛЕКАРСТВ без предварительной консультации с врачом, так как это может быть опасно для вашего здоровья.

ОТКАЗ ОТ ОТВЕТСТВЕННОСТИ : Все материалы, доступные на eHealthMe.com, предназначены только для информационных целей и не заменяют медицинскую консультацию, диагностику или лечение, предоставляемые квалифицированным поставщиком медицинских услуг.Вся информация предназначена только для наблюдения. Наши клинические исследования фазы IV сами по себе не могут установить причинно-следственную связь. Разные люди могут реагировать на лекарства по-разному. Были приложены все усилия, чтобы вся информация была точной, актуальной и полной, но никаких гарантий на этот счет не дается. Вы используете сайт eHealthMe и его содержимое на свой страх и риск.

Если вы используете это исследование eHealthMe при публикации, подтвердите это ссылкой: название исследования, URL-адрес, дата доступа.

Последние исследования eHealthMe:

Морские водоросли и здоровье | Духовность и здоровье

Из-за своих «волшебных» целебных свойств водоросли раньше считались продуктом роскоши. Сегодня это важная часть аюрведической медицины (индуистская система лечения из Индии), талассотерапии (лечение соленой водой), фитотерапии (фитотерапия) и макробиотической кухни. Водоросли использовались в качестве лекарств в Китае и Японии на протяжении сотен лет, а морские водоросли были (и остаются) существенной частью ежедневного рациона и традиционной травяной медицины в этих странах.Морские водоросли в этих регионах считаются лекарством от туберкулеза, ревматизма, простуды, открытых ран и кишечных глистов. В последние годы морские водоросли пропагандировались различными движениями за здоровье и «гуру здоровья». Он считается суперпродуктом со многими преимуществами для вашего здоровья! Предполагается, что он помогает бороться или предотвращать распространенные заболевания, включая проблемы с щитовидной железой, накопление окисленного холестерина, гастрит, артрит, симптомы менопаузы, проблемы с кожей и эзофагит. Кроме того, морские водоросли, особенно бурые водоросли, содержат антиоксиданты, защищающие от сердечно-сосудистых заболеваний и некоторых форм рака.Из-за потенциальных преимуществ антиоксидантов исследования положительных эффектов морских водорослей получили импульс. Однако важно понимать, что эти заявления о пользе для здоровья недостаточно изучены и часто не доказаны.

Несколько важных наблюдений: в районах, где население питается морскими водорослями и другими продуктами, содержащими морскую воду, меньше случаев сердечно-сосудистых заболеваний и высокого кровяного давления. В 1927 году японский профессор Сёдзи Кондо из Университета Тохоку предположил, что существует корреляция между районами Японии, где потребляется много морских водорослей (прибрежные районы), и более высокой продолжительностью жизни, особенно среди женщин.Эти люди в любом случае ели меньше еды и потребляли меньше соли. Морские водоросли содержат значительно больше клетчатки, чем фрукты и овощи, и быстрее насыщают. Он также имеет вкус умами ; потому что это так вкусно, добавляя морские водоросли в свой рацион, люди обычно используют меньше соли и едят меньшие порции.

Польза для здоровья от потребления морских водорослей в основном основана на старых традициях, писаниях и опыте. На сегодняшний день исследования сосредоточены на связи между потреблением морских водорослей и снижением риска сердечно-сосудистых заболеваний и рака.Есть несколько важных способов, которыми морские водоросли способствуют здоровому питанию: Они содержат много минералов и витаминов, которые легко усваиваются организмом. Кроме того, из-за высокой концентрации клетчатки в морских водорослях сахара в пищеварительной системе всасываются медленнее, что приводит к более медленному повышению уровня сахара в крови (тот же эффект, что и цельная пшеница). Наконец, морские водоросли содержат много полезных жирных кислот и незаменимых аминокислот.

Польза салата из морских водорослей вакамэ при артериальном давлении

Раньше я думал о морских водорослях просто как о полезном цельнопищевом источнике минералов, таких как йод, для которого они являются наиболее концентрированным диетическим источником.Действительно, всего полчайной ложки мягких морских водорослей, таких как араме или дульсе, или два листа нори в день обеспечат вам всю необходимую дневную норму йода. Но потребление морских водорослей рекомендуется не только как цельнопищевой источник йода, но и, по-видимому, «для профилактики заболеваний, связанных с образом жизни, включая рак, сердечно-сосудистые и цереброваскулярные заболевания…». На основании чего?

Как я обсуждаю в своем видео Салат из морских водорослей вакамэ может снизить кровяное давление , причина в том, что японцы живут долго и едят водоросли, поэтому есть предположение, что морские водоросли могут иметь «влияние на продолжительность жизни», основанное на наводящих на размышления сообщениях.Но когда мы видим длинные списки предполагаемых полезных свойств той или иной пищи, например, «соединения, обнаруженные в [водорослях], обладают различной биологической активностью, включая антикоагулянтную, противовирусную, антиоксидантную, противоаллергическую, противораковую, анти- воспалительные, антиожирительные и нейропротекторные свойства», нам нужно знать, основаны ли они на клинических данных, то есть на исследованиях с реальными людьми, или на так называемых доклинических данных, то есть на пробирках и лабораторных животных. Я имею в виду, что мы должны делать с исследованием, в котором говорится о влиянии «реструктурированной свинины из морских водорослей» на крыс? Эти исследователи пытались использовать морские водоросли, а также другие ингредиенты, чтобы «улучшить имидж» мясного продукта.Исследователи также пробовали добавлять в мясо виноградные косточки, пробовали льняное семя, пробовали грецкие орехи, пробовали пурпурный рис и даже пробовали «травку».

Когда вы смотрите на эпидемиологические исследования, в которых вы сравниваете рацион питания и уровень заболеваемости среди населения, вы видите, что японские дошкольники, которые едят морские водоросли, как правило, имеют более низкое кровяное давление, предполагая, что «морские водоросли могут оказывать благотворное влияние на кровяное давление у детей. ” Это может иметь смысл, учитывая все минералы и клетчатку в водорослях, но причину и следствие невозможно доказать с помощью такого рода исследований.Возможно, другие компоненты диеты, которые сопровождали употребление морских водорослей, имели значение.

Еще сложнее проводить такие исследования на взрослых, так как многие люди принимают лекарства от высокого кровяного давления. Исследователи из Токийского университета применили новаторский подход, сравнив диеты людей, принимающих лекарства разной интенсивности: низкие дозы одного лекарства от артериального давления, высокие дозы одного лекарства и несколько лекарств. И, хотя у всех было искусственно нормализовано кровяное давление «в результате эффективных лекарств», те, кто ел больше всего фруктов и морских овощей, как правило, принимали меньшую дозу одного препарата, поддерживая диетическую роль морских водорослей.Интересное открытие, но почему бы просто не проверить его?

Двойное слепое перекрестное исследование показало, что волокна морских водорослей снижают кровяное давление, по-видимому, за счет выведения натрия из организма. Настоящие морские водоросли нельзя было использовать в исследовании, потому что испытуемых нельзя было обмануть плацебо, но почему бы просто не положить цельные порошкообразные водоросли в таблетки? Это было, наконец, предпринято десятью годами позже. По сравнению с теми, кто ничего не делал, у испытуемых, получавших ежедневную дозу высушенного порошка вакамэ в капсулах, наблюдалось прекрасное падение артериального давления.Исследователи, однако, опресняли водоросли, удалив около двух третей естественного содержания натрия. Итак, мы до сих пор не знаем, действительно ли употребление салата из морских водорослей поможет при артериальном давлении. Что нам нужно, так это рандомизированное контролируемое исследование с простыми водорослями. Никто никогда не проводил такого исследования, пока… они не сделали!

Шесть граммов вакаме со всем содержанием натрия привели к значительному снижению артериального давления, особенно у тех, кто начал с высокого давления.Субъекты испытали лишь незначительные побочные эффекты, которых можно было ожидать при увеличении потребления клетчатки. Хорошая вещь о вмешательстве на основе цельных продуктов, основанных на растениях, заключается в том, что мы иногда получаем хороших побочных эффектов, таких как разрешение гастрита (воспаление желудка), которое было у некоторых субъектов, а также исчезновение хронических головных болей.


Какие другие продукты могут помочь при высоком кровяном давлении? См.:

Для получения дополнительной информации о профилактике и лечении гипертонии, одного из наших главных убийц, см.:

Хотите узнать больше о морских водорослях и йоде? Выезд:

Мое видео Соль Земли: натрий и растительная диета дополнительно затрагивает проблему натрия.

Здоровье,
Майкл Грегер, доктор медицины

PS: Если вы еще этого не сделали, вы можете подписаться на мои бесплатные видео  здесь   и посмотреть мои презентации за год в прямом эфире:

Морские водоросли: безопасное и эффективное лечение рефлюксной болезни

Рефлюкс – нормальное физиологическое явление каждого человека. Между тем, гастроэзофагеальная рефлюксная болезнь (ГЭРБ) означает, что ваш рефлюкс стал патологическим. Заболевание развивается по мере того, как содержимое желудка все чаще возвращается в пищевод, и процесс повторяется.Многие называют это неприятное ощущение «повышенной кислотностью желудка». Однако, по словам гастроэнтеролога Педиатрического центра Детской больницы Вильнюсского университета Вайдотаса Урбонаса, ASP, человека, который может чувствовать кислотность своего желудка, не существует. В большинстве случаев кислотность является выражением поступления желудочного сока в пищевод и предвестником возможной гастроэзофагеальной рефлюксной болезни.

Многократное попадание желудочного сока в пищевод может вызвать эзофагит или повредить органы за пищеводом, такие как голосовые связки или дыхательные пути.Содержимое желудка в пищеводе может привести к ожогу ран и даже повреждению зубной эмали.

ГЭРБ у подростков проявляется болями в сердце

Основными симптомами заболевания являются сыпь, чувство жжения и грызения за грудиной и отрыжка кислым или горьким содержимым. Также кашель, охриплость, потеря голоса, зуд в глубине горла, а также боли в груди, напоминающие симптомы инфаркта миокарда. Следует отметить, что ломота и боли в грудной области у взрослых чаще связаны с сердечными нарушениями, а у подростков, как правило, являются признаками ГЭРБ.Еще одним симптомом заболевания является боль в верхней части живота (эпигастрии). Если жалобы повторяются не реже двух раз в неделю и длятся месяц или дольше, высока вероятность наличия ГЭРБ.

Невинный кашель может спровоцировать заболевание

Двумя наиболее частыми и, по-видимому, наименее связанными с ГЭРБ симптомами являются хронический кашель, длящийся месяцами, и утренняя охриплость. Если охриплость начинается без причины (больной не простужается или что-то в этом роде), это может быть вызвано гастроэзофагеальным рефлюксом.ГЭРБ также может вызывать повторную пневмонию, одышку и приступы астмы.

С другой стороны, пациент, часто беспокоящий кашлем, коклюшем или пневмонией, также рискует иметь ГЭРБ в будущем. «Вот почему нам трудно определить, вызван ли хронический кашель ГЭРБ или наоборот. Дифференциация очень важна, потому что от этого зависит лечение», — пояснил гастроэнтеролог.

Рефлюкс также может вызывать нарушения сна.

Даже грудное молоко может вызывать рефлюксную патологию

По данным В.Урбонас, АСБ, ГЭРБ могут быть как первичным заболеванием с неизвестными или неясными причинами, так и вторичным заболеванием, осложнением другого заболевания, с ясными причинами: «В моей практике был случай: к нам обратился трехлетний ребенок. после безуспешного лечения ГЭРБ, а позже выяснилось, что у него опухоль головного мозга. К счастью, такие случаи редки. У моих пациентов обычно диагностируют пищевую аллергию, которая проявляется кожной сыпью, одышкой, диареей, тошнотой, рвотой и рефлюксом. Был ребенок, у которого был тяжелый рефлюкс, вызванный грудным молоком, но на искусственном молоке все было в порядке, лечился в нашем отделении.Таким образом, если у ребенка или взрослого наблюдается рефлюкс или частая рвота, в первую очередь следует искать предрасполагающие причины ГЭРБ».

Не менее важное значение имеет психоэмоциональное состояние (детский сад, школа или домашняя обстановка) больных ГЭРБ. Эмоциональный фон нередко вызывает нарушения пищеварения. Также на развитие заболевания влияет избыточный вес, тяжелый физический труд и занятия спортом, например плаванием.

Правильное питание помогает половине больных

По словам гастроэнтеролога, люди едят одинаковую пищу; большинство из них хорошо переносят любую пищу и не имеют нарушений пищеварения.Проблемы есть только у небольшой части. Это означает, что причиной может быть недостаточность пищеварительной системы, которая не переносит те или иные продукты.

Многие по опыту знают, что кислая, жареная, жирная, приправленная мятой пища, мучные блюда (мучная клейковина), газированные напитки и синтетические продукты (мюсли, чипсы, кетчуп и майонез) раздражают пищеварительную систему и вызывают раздражение. Яблочный сок и витамин С также могут оказывать негативное влияние на пищеварение. Кстати, люди, которые пытаются повысить свой иммунитет витамином С, приносят себе больше вреда, чем пользы, потому что аскорбиновая кислота может вызвать эрозию пищевода.
По мнению В. Урбонаса, ASP, особое значение для больных ГЭРБ имеет питание. Даже половина детей, находящихся на лечении, не нуждается ни в каких лекарствах. Вполне достаточно сбалансированного питания.

Невылеченное заболевание может закончиться раком

Чаще всего к гастроэнтерологу обращаются по поводу болей, сыпи и кислотного рефлюкса. Симптомы действительно неприятны и долго терпеть нельзя.
«Однако агрессивная и неправильно леченная ГЭРБ, когда пациенты находят информацию в Интернете или других источниках и занимаются самолечением, со временем могут осложниться.В пищеводе могут появиться кровоточащие раны. Если кровотечение длится месяц и дольше, может закончиться железодефицитной анемией», — предупредил доцент. «Число больных ГЭРБ в Литве за 15 лет выросло в 8 раз; в нашей больнице их более 600 в год».

При повторных воспалениях образуются стриктуры (рубцы): прохождение пищи в желудок затруднено, что может вызвать другое осложнение – сужение пищевода.

Пищевод Барретта — предраковая стадия пищевода.Если ГЭРБ становится хронической, ее обострения создают высокий риск развития аденокарциномы пищевода. Это одно из самых страшных онкологических заболеваний, потому что оно неизлечимо. Число больных в Литве ежегодно увеличивается; в год диагностируется около 200 случаев.

Снижение кислотности желудка опасно!

Лечение гастроэзофагеальной рефлюксной болезни является достаточно сложным процессом из-за практически невыявляемых причин заболевания. Первым этапом лечения является устранение предрасполагающих факторов: корректировка режима питания, режима труда и отдыха.Если они не помогают, назначают лекарства.

«Естественно, лечение ГЭРБ не что иное, как симптоматическое. К сожалению, другой альтернативы нет. Большинство людей пытаются снизить кислотность желудка, но это не выход. Желудочные кислоты неизбежны для нормальной функции желудка и разложения пищи. Снижая кислотность, мы нарушаем пищеварение. Химическая нейтрализация желудочной кислоты превращает завод по стерилизации желудочных ферментов в инкубатор бактерий. Замечено, что у пациентов с тяжелыми и хроническими заболеваниями, находящихся на лечении в отделениях интенсивной терапии ингибиторами кислотности, выше риск развития пневмонии и бактериального бронхита.Это связано с тем, что желудочные бактерии попадают в дыхательные пути и провоцируют указанные выше заболевания. Слишком низкое количество кислот и пепсина в желудке повышает риск аллергии на белок и непереносимости некоторых продуктов», – предупредил гастроэнтеролог В. Урбонас об опасных аспектах снижения количества желудочной кислоты.

Морские наркотики | Бесплатный полнотекстовый | Связаны ли инфекция Helicobacter pylori и потребление фукоидана с поглощением фукоидана?

1. Введение

Фукоидан представляет собой сложный сульфатированный полисахарид, который в основном содержится в бурых морских водорослях.Фукоидан обладает широким спектром биологической активности, включая противовоспалительное, иммуномодулирующее, антиоксидантное, противоопухолевое и противоинфекционное действие [1,2,3,4,5]. Несколько исследователей сообщили о потенциальной роли фукоидана в качестве средства против Helicobacter pylori (H. pylori) на основании его способности нарушать адгезию микроба к желудочному эпителию in vivo и in vitro [6,7,8,9]. . Ингибирующее действие фукоидана, полученного из Cladosiphon okamuranus (окинавский модзуку), на H. pylori было продемонстрировано in vitro Shibata et al.[6]. Их исследование показало, что связывание H. pylori с клеточными линиями желудка человека больше ингибировалось кладосифонным фукоиданом, чем фукоиданом, полученным из фукуса. Кроме того, фукоидан блокировал как Leb-, так и сульфатид-опосредованное прикрепление H. pylori к клеткам желудка. Они пришли к выводу, что ингибирующее действие кладосифонфукоидана на связывание H. pylori и клеток желудка может быть обусловлено покрытием этим компонентом бактериальной поверхности. Однако никакой бактериостатической или бактерицидной активности в отношении H.pylori для любого препарата фукоидана [9]. Сообщается, что фукоидан всасывается через кишечный тракт посредством энергозависимых процессов и пиноцитоза [10,11,12]. У японских добровольцев фукоидан был обнаружен в большей части мочи после перорального приема [13]. Поскольку скорость всасывания фукоидана через тонкий кишечник сильно различалась среди участников, было высказано предположение, что на его всасывание влияют различные факторы. Например, потребление окинавских модзуку (Cladosiphon okamuranus Tokida), бурых водорослей, содержащих фукоидан, является важным фактором, связанным с абсорбцией фукоидана.На основании предыдущего отчета Hehemann et al. [14] мы предположили, что микробиота желудочно-кишечного тракта может влиять на всасывание фукоидана. pylori — грамотрицательная спиралевидная микроаэрофильная бактерия. Он колонизирует всю слизистую оболочку желудка примерно у половины населения мира, а плохое социально-экономическое положение является важным фактором риска инфекции [15,16,17,18]. H. pylori вызывает язвенную болезнь и атрофический гастрит, а также ассоциирован с первичной В-клеточной лимфомой желудка и аденокарциномой желудка.Иммунная система хозяина не может устранить инфекцию, и она сохраняется без лечения. Многие исследования были сосредоточены на модификации желудочной среды, вызванной инфекцией H. pylori. Например, инфекция H. pylori может привести к дефициту витаминов, таких как витамин С, витамин А, α-токоферол, витамин В 12 и фолиевая кислота, а также основных минералов [19,20,21]. Кроме того, желудочная инфекция H. pylori влияет на локальные и отдаленные микробные популяции и реакцию хозяина. Поскольку фукоидан может связываться с H.pylori и нарушают его прикрепление к желудочному эпителию [6,7,8], предполагается, что инфекция H. pylori влияет на всасывание фукоидана. В этом исследовании мы изучили влияние инфекции H. pylori на абсорбцию фукоидана, извлеченного из окинавского модзуку, у японских добровольцев. Хотя абсорбция фукоидана у людей чрезвычайно низка, концентрация фукоидана после перорального приема примерно в 10 раз выше в моче, чем в сыворотке [22]. Поэтому концентрации фукоидана в моче измеряли до и после перорального приема модзуку фукоидана.

3. Обсуждение

Настоящее исследование выявило связь между инфекцией H. pylori и абсорбцией фукоидана. В частности, абсорбция фукоидана была значительно снижена среди H. pylori-позитивных субъектов в возрасте ≥40 лет, которые ели модзуку по крайней мере один раз в месяц, тогда как среди H. pylori-негативных субъектов не было обнаружено никакой связи, независимо от частоты употребления модзуку и возраста. Кроме того, абсорбция фукоидана не снижалась среди H. pylori-положительных субъектов, которые употребляли модзуку один раз в 2-3 месяца или реже; следовательно, потребление модзуку влияет на всасывание фукоидана.Хотя точные механизмы, с помощью которых инфицирование H. pylori и употребление модзуку снижают всасывание фукоидана, не установлены, постулируются некоторые возможности.

Поскольку значения ΔMax фукоидана были одинаковыми у H. pylori-негативных и H. pylori-позитивных субъектов среди участников в возрасте ≥40 лет, H. pylori с меньшей вероятностью напрямую снижала абсорбцию фукоидана в этой возрастной группе. За исключением H. pylori-позитивных участников в возрасте ≥ 40 лет, которые регулярно употребляли модзуку, значения ΔMax фукоидана были сходными для H.pylori-положительные и H. pylori-отрицательные субъекты. Кроме того, частота потребления модзуку среди участников с положительным результатом на H. pylori была одинаковой у лиц в возрасте до 40 лет и среди лиц в возрасте ≥40 лет; следовательно, частота потребления модзуку не связана напрямую с поглощением фукоидана. Учитывая, что положительная реакция на H. pylori и регулярное употребление модзуку были связаны со сниженной абсорбцией фукоидана у субъектов в возрасте ≥40 лет, но не у более молодых субъектов, продолжительность H.pylori и частота модзуку оказываются важными для всасывания фукоидана.

Как частое употребление модзуку и инфекция H. pylori нарушают всасывание фукоидана у лиц в возрасте ≥40 лет? H. pylori может изменять секреторную и закисляющую функции желудка, поскольку проникает в этот орган. Хотя всасывание питательных веществ не происходит в желудке, инфекция H. pylori может повлиять на пищеварение и всасывание питательных веществ, таких как витамин B 12, витамин C , витамин A, витамин E и фолиевая кислота [19,20,21].Шибата и др. [7] сообщили, что модзуку фукоидан может связываться с H. pylori и ингибировать его прикрепление к слизистой оболочке желудка при рН 2,0 и 4,0, но не при рН 7,4. Хорошо известно, что H. pylori редко вызывает атрофический гастрит у молодых людей (вызванный H. pylori атрофический гастрит довольно часто встречается у пожилых [15, 16, 17, 18]. Когда гипохлоргидрия возникает после индуцированного H. pylori при атрофическом гастрите увеличивается внутрижелудочный рН, что приводит к ингибированию способности H. pylori связываться с фукоиданом.Однако абсорбция фукоидана не снижалась у H. pylori-позитивных субъектов в возрасте ≥40 лет, которые редко употребляли модзуку, что свидетельствует о влиянии длительного приема модзуку на абсорбцию фукоидана. Аморнлердписон и др. сообщили, что фукоидан, присутствующий в модзуку, действует как антагонист рецептора H 2 (аналогично циметидину), снижая кислотность желудочного сока и повышая рН в желудке [23]. В совокупности атрофический гастрит, вызванный H. pylori, и длительный прием модзуку могут заметно снизить секрецию кислоты, что, в свою очередь, приведет к неэффективности H.pylori для связывания фукоидана и снижения его всасывания в тонком кишечнике у людей в возрасте ≥40 лет. Таким образом, возможный механизм, с помощью которого инфекция H. pylori приводит к снижению секреции желудочного сока и абсорбции фукоидана, недостаточно изучен, чтобы делать определенные выводы, и возможны другие механизмы, кроме гипохлоргидрии, после инфекции H. pylori.

Следует отметить, что значимые положительные корреляции базальных уровней фукоидана как с титрами H. pylori, так и со значениями ΔMax фукоидана были выявлены у H.pylori-положительные субъекты в возрасте до 40 лет, которые часто употребляли фукоидан. Такие корреляции не были обнаружены в соответствующей группе участников в возрасте ≥40 лет, а также не наблюдались у H. pylori-положительных субъектов, которые редко ели модзуку, или у H. pylori-негативных субъектов. Поскольку значение положительной корреляции, наблюдаемой у H. pylori-позитивных субъектов в возрасте до 40 лет, которые часто употребляли фукоидан, неясно, необходимы дальнейшие исследования для выяснения связи инфекции H. pylori и приема модзуку с абсорбцией фукоидана с использованием большого количества предметы.

Интересно, что базальные уровни фукоидана значительно повышались при инфицировании H. pylori и употреблении модзуку. Поскольку известно, что H. pylori влияет на всасывание различных питательных веществ, эта желудочная бактерия может участвовать в базальном всасывании фукоидана. В последние годы значительное внимание привлекла «ось питание-микробиом кишечника-физиология» [24,25,26,27,28]. Поскольку H. pylori может вызывать резкие изменения разнообразия микробиоты желудочно-кишечного тракта [29, 30, 31], предполагается, что этот микроб увеличивает базальные уровни фукоидана, изменяя микробиоту желудочно-кишечного тракта.Базальные уровни фукоидана также были значительно выше у H. pylori-отрицательных субъектов, которые регулярно употребляли модзуку, чем у их коллег, которые редко употребляли модзуку, что подтвердило наши предыдущие результаты [13]. Мы предположили, что японцы могли получить пищеварительные ферменты от модзуку, потому что водоросли широко потребляются в этом районе. Из-за ограниченных данных общее значение инфекции H. pylori и потребления модзуку для базовых уровней фукоидана неясно.

Это исследование имело несколько ограничений.Во-первых, не исключались субъекты, получавшие эрадикационную терапию H. pylori и перенесшие гастрэктомию до начала исследования. Исследование также не исключало субъектов, которые использовали дополнительные и альтернативные лекарства, которые могут повлиять на абсорбцию фукоидана.

Во-вторых, набор ELISA на основе мочи (URINELISA) использовался для анализа инфекции H. pylori, и высокая точность этого теста была подтверждена несколькими исследователями [32,33]. Недостатком этого теста является то, что протеинурия может привести к ложноположительным результатам; поэтому уровень белка в моче следует измерять в будущих исследованиях.Мы планируем изучить взаимосвязь инфекции H. pylori с абсорбцией фукоидана с использованием наборов ELISA на основе сыворотки или дыхательного теста с мочевиной 13 C ( 13 C-UBT) в будущих исследованиях. Кроме того, специфичность нашего ELISA фукоидана был ограничен. Мы проанализировали уровни фукоидана в моче, используя поликлональные антитела к фукоидану окинавского модзуку, которые слабо перекрестно реагировали с фукоиданом Fucus vesiculosus [22]. Поскольку бурые водоросли комбу (Laminaria japonica) и вакаме (Undaria pinnatifida) являются традиционными продуктами питания в Японии, фукоидан, содержащийся в этих водорослях, может перекрестно реагировать с нашим антителом.Необходимы дальнейшие исследования для выяснения влияния потребления модзуку на всасывание фукоидана в кишечнике с использованием ИФА с моноклональными антителами.

4. Материалы и методы

4.1. Субъекты

Мы опубликовали брошюры с описанием целей, методов и исключений из нашего исследования под названием «Связь инфекции H. pylori с абсорбцией мозуку фукоидана» в Интернете и набрали добровольцев. С апреля 2014 года по июнь 2016 года заявки подали 262 японца.Они заполнили анкету, в которой оценивали пол, возраст и потребление модзуку. Мы зарегистрировали 259 добровольцев, которые заполнили анкеты и собрали образцы мочи, как и планировалось. Испытуемых разделили на пять возрастных групп: 20–29, 30–39, 40–49, 50–50 и старше 60 лет.

Частота употребления модзуку была разделена на пять групп следующим образом: примерно 1–3 раза в неделю, примерно раз в 2 недели, примерно раз в месяц, примерно раз в 2–3 месяца и редко (табл. 1).

Это исследование было проведено в соответствии с Хельсинкской декларацией. Протокол исследования одобрен Этическим комитетом компании South Product Co., Ltd. (UMIN000039117). После объяснения исследования и его цели все участники дали информированное согласие.

4.2. Пероральный прием фукоидана и сбор образцов мочи

Субъекты воздерживались от приема морских водорослей и фукоидана за день до теста и в день теста, чтобы избежать влияния диеты.Субъекты перорально выпили две порции фукоидана (1500 мг/бутылка) в 9:00 утра. Образцы мочи извлекали четыре раза, а именно до (0) и через 3, 6 и 9 ч после приема фукоидана. Образцы мочи были собраны службой доставки посылок.

В этом исследовании испытуемые перорально потребляли 3 г модзуку фукоидана. Напиток изготовлен компанией South Product Co., Ltd.

4.3. Анализ уровней фукоидана в образцах мочи
Уровни фукоидана в моче анализировали с использованием метода сэндвич-ИФА, разработанного нашей лабораторией [22].Воспроизводимость метода ELISA с фукоиданом была следующей. CV внутри и между анализами для сыворотки, плазмы и мочи с использованием высоких и низких концентраций фукоидана находились в диапазоне 1,5–13,4%. Концентрация предела обнаружения нашего ELISA была менее 1 нг/мл.
4.4. Анализ на анти-H. pylori Титры антител в моче
Образцы однократной мочи были получены и хранились при температуре 2–8 °C до использования. Антитела IgG в моче к H. pylori измеряли с использованием набора ELISA на основе мочи (URINELISA ® , Otsuka Pharmaceutical Co., Ltd.), в котором в качестве источника антигена используется VacA- и CagA-положительный штамм H. pylori, выделенный от японского пациента с гастритом. Этот результат теста на основе ELISA считался положительным, когда индекс отсечки 1,0 (оптическая плотность = 0,218) или выше был получен после измерения оптической плотности в соответствии с инструкциями производителя [32,33,34].

Значение ΔMax фукоидана рассчитывали путем вычитания базового значения (до приема внутрь) из самого высокого уровня фукоидана в моче после приема фукоидана.Если базальный уровень фукоидана был выше, чем после приема фукоидана, то значение ΔMax фукоидана регистрировали как 0,

4,5. Статистический анализ

Значения фукоидана в моче после приема фукоидана были проанализированы с использованием двухфакторного дисперсионного анализа (ANOVA) или однофакторного дисперсионного анализа с последующим применением теста Тьюки для множественных сравнений. SAS версии 9.4 (программное обеспечение для статистического анализа 9.4, SAS Institute Inc., Кэри, Северная Каролина, США) использовали для проведения статистического анализа.

Для анализа межгрупповых различий использовали U-критерий Манна-Уитни.Статистические корреляции анализировали с использованием коэффициента ранговой корреляции Спирмена. Кроме того, был проведен множественный регрессионный анализ с инфекцией H. pylori в качестве зависимой переменной и возрастом и потреблением модзуку в качестве независимых переменных. Результаты выражали в виде отношения рисков и 95% доверительного интервала. Данные выражены как среднее значение ± стандартное отклонение. P <0,05 указывает на статистически значимую разницу.

Фукоидан из Sargassum hemiphyllum ингибирует инфекцию и воспаление Helicobacter pylori

  • Huang, H.Л., Ко, С. Х., Ян, Ю. Ю. и Ван, С. К. Антиадгезионное и противовоспалительное действие экстрактов плодов нони ( Morinda citrifolia ) на клетки AGS во время инфекции Helicobacter pylori . J. Agric Food Chem. 62 , 2374–2383 (2014).

    КАС пабмед Google ученый

  • Ferlay, J. и др. Заболеваемость раком и смертность во всем мире: источники, методы и основные закономерности в GLOBOCAN 2012. Междунар. J. Рак 136 (5), E359–E386 (2015).

    КАС пабмед Google ученый

  • Lee, Y.C. и др. Связь между эрадикацией Helicobacter pylori и заболеваемостью раком желудка: систематический обзор и метаанализ. Гастроэнтерология 150 (5), 1113–1124 (2016).

    ПабМед Google ученый

  • Куо Ю.Т. и др. Первичная устойчивость Helicobacter pylori к антибиотикам в Азиатско-Тихоокеанском регионе: систематический обзор и метаанализ. Ланцет Гастроэнтерол. Гепатол. 2 (10), 707–715 (2017).

    ПабМед Google ученый

  • Салих, Б. А. Инфекция Helicobacter pylori в развивающихся странах: как долго бремя?. Саудовская Дж. Гастроэнтерол. 15 (3), 201 (2009).

    ПабМед ПабМед Центральный Google ученый

  • Ольбе, Л., Карлссон, Э. и Линдберг, П. Экспедиция по ингибиторам протонного насоса: истории болезни омепразола и эзомепразола. Нац. Преподобный Друг Дисков. 2 (2), 132–139 (2003).

    КАС пабмед Google ученый

  • Fischbach, L. & Evans, E.L. Метаанализ: влияние статуса устойчивости к антибиотикам на эффективность тройной и четырехкратной терапии первой линии для Helicobacter pylori . Алимент Фарм.тер. 26 (3), 343–357 (2007).

    КАС Google ученый

  • Саравана, П.С., Чо, Ю.Дж., Пак, Ю.Б., Ву, Х.К. и Чун, Б.С. Структурная, антиоксидантная и эмульгирующая активность фукоидана из Saccharina japonica с использованием жидкостной экстракции под давлением. Углевод. Полим. 153 , 518–525 (2016).

    КАС пабмед Google ученый

  • Хсу, Х.Y. и др. Фукоидан индуцирует изменения в переходе от эпителия к мезенхиме и уменьшает метастазирование путем усиления деградации убиквитин-зависимого рецептора TGFβ при раке молочной железы. Канцерогенез 34 , 874–884 (2013).

    КАС пабмед Google ученый

  • Хсу, Х.Ю. и др. Ингибирование фукоиданом рака легких in vivo и in vitro: роль Smurf2-зависимого убиквитинового протеасомного пути в деградации рецептора TGFβ. Oncotarget 5 , 7870–7885 (2014).

    ПабМед ПабМед Центральный Google ученый

  • Chen, M.C., Hsu, W.L., Hwang, P.A. & Chou, T.C. Низкомолекулярный фукоидан ингибирует опухолевый ангиогенез посредством подавления передачи сигналов HIF-1/VEGF в условиях гипоксии. Mar. Drugs 13 , 4436–4451 (2015).

    КАС пабмед ПабМед Центральный Google ученый

  • Тенгделиус М. и др. Синтез и биологическая оценка фукоидан-миметических гликополимеров посредством свободнорадикальной полимеризации, опосредованной цианоксилом. Биомакромол 15 , 2359–2368 (2014).

    КАС Google ученый

  • Chua, E.G., Verbrugghe, P., Perkins, T.T. & Tay, C.Y. Fucoidans нарушают адгезию Helicobacter pylori к клеткам AGS in vitro. Evid.-Based Complement Alt 2015 , 1–6 (2015).

    Google ученый

  • Беседнова Н. Н., Запорожец Т. С., Сомова Л. М., Кузнецова Т. А. Перспективы использования экстрактов и полисахаридов морских водорослей для профилактики и лечения заболеваний, вызванных Helicobacter pylori. Helicobacter 20 (2), 89–97 (2015).

    КАС пабмед Google ученый

  • Апостолова Е. и др. Иммуномодулирующие и противовоспалительные эффекты фукоидана: обзор. Полимеры 12 (10), 2338 (2020).

    КАС ПабМед Центральный Google ученый

  • Ni, L. и др. Противовоспалительная активность in vitro и in vivo богатого фукозой фукоидана, выделенного из Saccharina japonica . Междунар. Дж. Биол. макромол. 156 , 717–729 (2020).

    КАС пабмед Google ученый

  • Лу, Дж. и др. Фукоидан, извлеченный из Новой Зеландии Undaria pinnatifida — физико-химическое сравнение с пятью другими фукоиданами: уникальная биологическая активность низкомолекулярной фракции в клеточных линиях рака молочной железы. Март Лекарства 16 (12), 461 (2018).

    КАС ПабМед Центральный Google ученый

  • Джин В. и др. Структурные характеристики и антикомплементарная активность полисахаридов из Sargassum hemiphyllum . Гликоконж. J. 37 (5), 553–563 (2020).

    КАС пабмед Google ученый

  • Хван, Пенсильвания и др. Ингибирование воспалительных реакций, индуцированных липополисахаридами (ЛПС), экстрактом сульфатированного полисахарида Sargassum hemiphyllum в клетках макрофагов RAW 264.7. Дж. Сельское хозяйство. Пищевая хим. 59 (5), 2062–2068 (2011).

    КАС пабмед Google ученый

  • Ислам, М.N. и др. Противовоспалительная активность съедобной бурой водоросли Saccharina japonica и входящих в ее состав феофорбида а и феофитина а в стимулированных ЛПС клетках макрофагов RAW 264.7. Пищевая хим. Токсикол. 55 , 541–548 (2013).

    КАС пабмед Google ученый

  • Wittschier, N., Faller, G. & Hensel, A. Водные экстракты и полисахариды из корней солодки ( Glycyrrhiza glabra L.) подавляют адгезию Helicobacter pylori к слизистой оболочке желудка человека. J. Этнофармакол. 125 (2), 218–223 (2009).

    КАС пабмед Google ученый

  • Сюй, К. и др. Антиадгезионный эффект кислого полисахарида из Алоэ вера L. var. chinensis (Haw.) Berger о связывании Helicobacter pylori с клеточной линией MKN-45. Дж. Фарм. Фармакол. 62 (12), 1753–1759 (2010).

    КАС пабмед Google ученый

  • Лутай, Н., Нильссон, И., Вадстрем, Т. и Люнг, А. Влияние гепарина, фукоидана и других полисахаридов на адгезию энтерогепатических видов Helicobacter к мышиным макрофагам. Заяв. Биохим. Биотехнолог. 164 (1), 1–9 (2011).

    КАС пабмед Google ученый

  • Сим, Дж. С. и др. Ингибирование адгезии Helicobacter pylori к клеткам Kato III интактным и низкомолекулярным сульфатом ахарана. Гликоконж. J. 28 (6), 411–418 (2011).

    КАС пабмед Google ученый

  • Шибата, Х. и др. Ингибирующее действие Cladosiphon fucoidan на адгезию Helicobacter pylori к клеткам желудка человека. Дж. Нутр. науч. Витаминол. 45 (3), 325–336 (1999).

    КАС пабмед Google ученый

  • Styer, C.M. et al. Экспрессия адгезина BabA во время экспериментального заражения Helicobacter pylori . Заразить. Иммун. 78 (4), 1593–1600 (2010).

    КАС пабмед ПабМед Центральный Google ученый

  • Сенкович О.А. и др. Helicobacter pylori AlpA и AlpB связывают ламинин хозяина и влияют на воспаление желудка у песчанок. Infect immun 79 , 3106–3116 (2011).

    КАС пабмед ПабМед Центральный Google ученый

  • Шибата, Х. и др. Профилактическое действие Cladosiphon fucoidan против инфекции Helicobacter pylori у монгольских песчанок. Helicobacter 8 (1), 59–65 (2003).

    КАС пабмед Google ученый

  • Конно, Х., Охта М., Баба М., Судзуки С. и Накамура С. Роль циркулирующих белков IL-8 и VEGF в прогрессировании рака желудка. Науки о раке. 94 (8), 735–740 (2003).

    КАС пабмед Google ученый

  • Yokoe, T. & Morishita, Y. Тенденции уровней IL-6 и IL-8 у пациентов с рецидивирующим раком молочной железы: предварительный отчет. Рак молочной железы 7 (3), 187–190 (2000).

    КАС пабмед Google ученый

  • млн лет, Дж. и др. Ассоциации между полиморфизмами генов цитокинов и восприимчивостью к инфекции Helicobacter pylori и родственным Helicobacter pylori раку желудка, язвенной болезни: метаанализ. PLoS ONE 12 (4), e0176463 (2017).

    ПабМед ПабМед Центральный Google ученый

  • Piao, J. Y. et al. Helicobacter pylori активирует передачу сигналов IL-6-STAT3 в клетках рака желудка человека: возможная роль активных форм кислорода. Helicobacter 21 (5), 405–416 (2016).

    КАС пабмед Google ученый

  • Сан, Дж. и др. Влияние NaCl и вакуолизирующего цитотоксина Helicobacter pylori на экспрессию и жизнеспособность цитокинов. Мир Дж. Гастроэнтерол. 12 (14), 2174 (2006).

    КАС пабмед ПабМед Центральный Google ученый

  • Турани, М. и др. Ассоциация уровней TNF-α, но не IL-1β с наличием инфекции Helicobacter pylori увеличивала риск развития пептической язвы. Цитокин 110 , 232–236 (2018).

    КАС пабмед Google ученый

  • Фокс, Дж. Г. и др. Хозяин и микробные компоненты влияют на рак, вызванный Helicobacter pylori , в мышиной модели гипергастринемии. Гастроэнтерология 124 , 1879–1890 (2003).

    ПабМед Google ученый

  • Чжан, Дж. З., Лю, К. М., Пэн, Х. П. и Чжан, Ю. Связь генетических вариаций генов пути IL-6/IL-6R с риском рака желудка у населения Китая. Ген 623 , 1–4 (2017).

    КАС пабмед Google ученый

  • Морадипур, А., Хосрави А., Мехраби М.Р. и Фарьядиан С. Корреляция 16s рРНК с уровнями цитокинов в сыворотке крови, TNF-α и IL-1β, у субъектов с положительным тестом на антиген стула Helicobacter pylori (HPSA). J. Основной рез. Мед. науч. 3 (2), 35–40 (2016).

    Google ученый

  • Шибата, Х. и др. Свойства фукоидана Cladosiphon okamuranus tokida для защиты слизистой оболочки желудка. BioFactors 11 (4), 235–245 (2000).

    КАС пабмед Google ученый

  • Бэк, Х.И. и др. Влияние добавок фукоидана на Helicobacter pylori у людей. FASEB J. 24 , 347 (2010).

    Google ученый

  • Чиу, Ю. Х., Чан, Ю. Л., Ли, Т. Л. и Ву, К. Дж. Ингибирование вирусной инфекции японского энцефалита сульфатированными полисахаридными экстрактами из Ulva lactuca. Март биотехнолог. 14 (4), 468–478 (2012).

    КАС Google ученый

  • Дюбуа М., Жиль К. А., Гамильтон Дж. К., Реберс П. А. и Смит Ф. Колориметрический метод определения сахаров. Природа 168 (4265), 167–167 (1951).

    КАС ОБЪЯВЛЕНИЯ пабмед Google ученый

  • Доджсон, К. С.& Прайс, Р.Г. Заметка об определении содержания сложноэфирных сульфатов в сульфатированных полисахаридов. Биохим. J. 84 (1), 106–110 (1962).

    КАС пабмед ПабМед Центральный Google ученый

  • Берджес, Дж. А., Фишер, А. Е. и Харрисон, П. Дж. Сравнение анализов белка Лоури, Брэдфорда и Смита с использованием различных стандартов белка и белка, выделенного из морской диатомовой водоросли Thalassiosira pseudonana . Мар. Биол. 115 (2), 187–193 (1993).

    КАС Google ученый

  • Чале-Дзул, Дж., Му-Пук, Р., Робледо, Д. и Фрейле-Пелегрин, Ю. Гепатопротекторный эффект фукоидана из бурых водорослей Turbinaria tricostata. Дж. Заявл. Фикол. 27 (5), 2123–2135 (2015).

    КАС Google ученый

  • Лин, К. и др. I2-катализируемая окислительная конденсация альдоз с диаминами: синтез альдонафтимидазолов для анализа углеводов. Молекулы 15 (3), 1340–1353 (2010).

    КАС пабмед ПабМед Центральный Google ученый

  • Мемон, Г. Р., Мария, Г., Мемон, А. Ф. и Сиял, А. Р. Анализ гастрита Helicobacter pylori по Сиднейской классификации. Дж. Мухаммад Мед.Сб. Мирпурхас 10 (2), 42–45 (2019).

    Google ученый

  • Мита, М. и др. Металлотионеин является решающим защитным фактором против Helicobacter pylori -индуцированных эрозивных поражений желудка в мышиной модели.

  • Добавить комментарий

    Ваш адрес email не будет опубликован.