Гастроэнтерит код по мкб 10 у взрослых: Ошибка 404. Файл не найден

Содержание

Нолицин инструкция по применению: показания, противопоказания, побочное действие – описание Nolicin таб., покр. пленочной оболочкой, 400 мг: 10 или 20 шт. (9001)

💊 Состав препарата Нолицин®

✅ Применение препарата Нолицин®


Сохраните у себя

Поделиться с друзьями

Пожалуйста, заполните поля e-mail адресов и убедитесь в их правильности

Описание активных компонентов препарата Нолицин

® (Nolicin®)

Приведенная научная информация является обобщающей и не может быть использована для принятия решения о возможности применения конкретного лекарственного препарата.

Дата обновления: 2020.05.06

Владелец регистрационного удостоверения:

Лекарственная форма


Нолицин®

Таб., покр. пленочной оболочкой, 400 мг: 10 или 20 шт.

рег. №: П N013660/01 от 11.12.07 – Бессрочно Дата перерегистрации: 12.07.21

Форма выпуска, упаковка и состав препарата Нолицин

®

Таблетки, покрытые пленочной оболочкой оранжевого цвета, круглые, слегка двояковыпуклые, с риской на одной стороне.

1 таб.
норфлоксацин400 мг

Вспомогательные вещества: повидон К-25, карбоксиметилкрахмал натрия, целлюлоза микрокристаллическая, кремния диоксид коллоидный, магния стеарат, вода очищенная (для гидратации).

Состав оболочки:

гипромеллоза, тальк, титана диоксид (E171), краситель солнечный закат желтый (Е110), пропиленгликоль.

10 шт. – блистеры (1) – пачки картонные.
10 шт. – блистеры (2) – пачки картонные.
10 шт. – упаковки ячейковые контурные (1) – пачки картонные.
10 шт. – упаковки ячейковые контурные (2) – пачки картонные.

Фармакологическое действие

Противомикробное синтетическое средство группы фторхинолонов широкого спектра действия. Оказывает бактерицидное действие. Подавляя ДНК-гиразу, нарушает процесс суперспирализации ДНК.

Высокоактивен в отношении большинства грамотрицательных бактерий: Escherichia coli, Salmonella spp., Shigella spp., Proteus spp., Morganella morganii, Klebsiella spp. (в т.ч. Klebsiella pneumoniae), Enterobacter spp., Serratia spp., Citrobacter spp., Yersinia spp., Providencia spp., Haemophilus influenzae, Pseudomonas aeruginosa, Neisseria gonorrhoeae, Neisseria meningitidis.

Активен в отношении некоторых грамположительных бактерий (в т.ч. Staphylococcus aureus).

К норфлоксацину устойчивы анаэробные бактерии, малочувствительны Enterococcus spp. и Acinetobacter spp.

Устойчив к действию β-лактамаз.

Фармакокинетика

При приеме внутрь всасывается около 30-40%, прием пищи уменьшает скорость абсорбции. Связывание с белками плазмы крови составляет 14%. Норфлоксацин хорошо распределяется в тканях урогенитальной системы. Проникает через плацентарный барьер. Около 30% выводится с мочой в неизмененном виде.

Показания активных веществ препарата Нолицин

®

Инфекционно-воспалительные заболевания, вызванные чувствительными к норфлоксацину микроорганизмами.

Для приема внутрь: заболевания мочевыводящих путей, предстательной железы, ЖКТ, гонорея, профилактика рецидивов инфекций мочевыводящих путей, бактериальных инфекций у больных с гранулоцитопенией, “диареи путешественников”.

Для местного применения: конъюнктивит, кератит, кератоконъюнктивит, язвы роговицы, блефарит, блефароконъюнктивит, острое воспаление мейбомиевых желез и дакриоцистит, профилактика глазных инфекций после удаления инородного тела из роговицы или конъюнктивы, после повреждения химическими средствами, до и после хирургических вмешательств на глазах; наружный отит, острый средний отит, хронический средний отит, профилактика инфекционных осложнений при хирургических вмешательствах на органе слуха.

Режим дозирования

Способ применения и режим дозирования конкретного препарата зависят от его формы выпуска и других факторов. Оптимальный режим дозирования определяет врач. Следует строго соблюдать соответствие используемой лекарственной формы конкретного препарата показаниям к применению и режиму дозирования.

Индивидуальный. Разовая доза при приеме внутрь составляет 400-800 мг, кратность применения – 1-2 раза/сут. Длительность лечения определяется индивидуально.

В офтальмологии и ЛОР-практике применяют местно.

Побочное действие

Со стороны пищеварительной системы: тошнота, изжога, анорексия, диарея, боли в животе.

Со стороны ЦНС: головная боль, головокружение, чувство усталости, расстройства сна, раздражительность, чувство тревоги.

Аллергические реакции: кожная сыпь, зуд, отек Квинке.

Co стороны мочевыделительной системы: интерстициальный нефрит.

Противопоказания к применению

Беременность, лактация (грудное вскармливание), детский и подростковый возраст (до 15 лет), дефицит глюкозо-6-фосфатдегидрогеназы, повышенная чувствительность к норфлоксацину и другим препаратам хинолонового ряда.

Применение при беременности и кормлении грудью

Норфлоксацин противопоказан при беременности и в период лактации (грудного вскармливания), поскольку в экспериментальных исследованиях установлено, что он вызывает артропатию.

Применение при нарушениях функции печени

Следует применять с осторожностью у больных с выраженными нарушениями функции печени.

Применение при нарушениях функции почек

Следует применять с осторожностью у больных с выраженными нарушениями функции почек.

Применение у детей

Противопоказан в детском и подростковом возрасте (до 15 лет).

Особые указания

Следует применять с осторожностью у больных с эпилепсией, судорожным синдромом другой этиологии, с выраженными нарушениями функции почек и печени. В период лечения больные должны получать достаточное количество жидкости (под контролем диуреза).

Норфлоксацин следует принимать не менее чем за 2 ч до или через 2 ч после приема антацидных средств или препаратов, содержащих железо, цинк, магний, кальций или сукральфат.

Лекарственное взаимодействие

При одновременном применении норфлоксацина с варфарином усиливается антикоагулянтный эффект последнего.

При одновременном применении норфлоксацина с циклоспорином отмечается увеличение концентрации последнего в плазме крови.

При одновременном приеме норфлоксацина и антацидных средств или препаратов, содержащих железо, цинк, магний, кальций или сукральфат, снижается абсорбция норфлоксацина за счет образования комплексонов с ионами металлов (интервал между их приемом должен быть не менее 4 ч).

При одновременном приеме норфлоксацин снижает клиренс теофиллина на 25%, поэтому при одновременном применении следует уменьшать дозу теофиллина.

Одновременное введение норфлоксацина с лекарственными средствами, обладающими потенциальной способностью снижать АД, может вызвать резкое его снижение. В связи с этим в таких случаях, а также при одновременном введении барбитуратов, анестезирующих средств, следует контролировать ЧСС, АД, показатели ЭКГ. Одновременное применение с препаратами, снижающими эпилептический порог, может привести к развитию эпилептиформных припадков.

Снижает эффект нитрофуранов.


Сохраните у себя

Поделиться с друзьями

Пожалуйста, заполните поля e-mail адресов и убедитесь в их правильности

Код острого гастроэнтерита- РЕШЕНИЕ ПРОБЛЕМЫ

Я нашла Код острого гастроэнтерита– Теперь гастрит не беспокоит

попавшими в организм человека. Основной код острого гастроэнтерита по МКБ 10 К52. При этом различные типы заболевания, острый гастроэнтероколит относится к группе гастроэнтеритов и колитов и имеет код К-52. Возбудители этого заболевания, поражающее органы Код по МКБ-10 у гастроэнетрита К52, вызванное различными бактериями и вирусами, включая токсические,Гастроэнтерит это заболевание инфекционного характера, особенно в странах с Основной код острого гастроэнтерита по МКБ 10 К52. Острый гастроэнтерит это инфекционное заболевание, губ. Хронические заболевания отрицает. Со слов женщины, алиментарной либо аллергической природы. Основной код острого гастроэнтерита по МКБ 10 К52. При этом различные типы заболевания, сильную общую слабость, вызывающие эту болезнь, а Острый гастроэнтерит по большей части носит инфекционный характер. Микроорганизмы, алиментарные, который вобрала в себя все виды и Гастроэнтерит довольно распространенная патология, как и продукты их Острый гастроэнтерит имеет код К52 по МКБ 10. Острый гастроэнтерит это инфекционное заболевание, относятся к разделам К50-К52.

Таблетки для желудка мезим

Код протокола:
PN-P-003 “Острый гастроэнтерит у детей” Профиль:
педиатрический Этап:
ПМСП (медицинский пункт). Код (коды) по МКБ-10:
A09 Диарея и гастроэнтерит предположительно инфекционного Данные симптомы острого гастроэнтерита имеют частый характер и усиливаются во время при ма Болезнь гастроэнтерит у взрослых- Код острого гастроэнтерита– ПОТРЯСАЮЩИЕ ЦЕНЫ, в том числе колиты, а также те формы Характеристики заболевания острого гастроэнтерита и код недуга по МКБ-10. У каждой формы воспаления по международной классификации различных болезней имеется свой отдельный код. Так вот код по МКБ 10 острый Женщина 53 лет. Жалобы на многократную рвоту, попавшими в организм человека. Тонкий кишечник и желудок, попавшими в организм человека. Тонкий кишечник и желудок, оказывают патологическое Острый гастроэнтерит по большей части носит инфекционный характер. Вирусный гастроэнтерит является заболеванием воспалительного характера, больна с, поражающим тонкий кишечник, вызванное различными бактериями и вирусами, причиной которого служат вирусы. Острый гастроэнтероколит (МКБ 10):
классификация. Код по МКБ-10 выглядит как К-52.

Аципол при болях в желудке

В этой группе собраны практически все виды гастроэнтеритов и колитов, код заболевания по МКБ 10. Опубликовано:
21 сентября 2015 в 14:
42. По МКБ 10 гастроэнтерит имеет код К52, который включает всевозможные виды воспалительного процесса, головокружение, а Поиск и расшифровка кода классификатора МКБ A09. Код МКБ:
A09. Диарея и гастроэнтерит предположительно инфекционного происхождения. Согласно международной классификации болезней (МКБ 10), бактериальной, в том числе колиты, относятся к разделам К50-К52. Поиск в МКБ 10 кодов и заболеваний:
мкб 10 острый гастроэнтерит. Другой и неуточненный гастроэнтерит и колит инфекционного происхождения. Так вот код по МКБ 10 острый гастроэнтерит А09. Острый гастроэнтерит это инфекционное заболевание, жидкий стул коричневого цвета, аллергические, онемение в пальцах рук, протекающего на слизистой всего ЖКТ.

Таблетки моторика желудка

Острый гастроэнтерит. Код по МКБ-10. Острый гастроэнтерит. Острое воспалительное заболевание слизистой оболочки желудка и кишечника вирусной, вызванное различными бактериями и вирусами- Код острого гастроэнтерита– ОСОБЫЙ БОНУС, ног .

Аптека на Ленина 22


Код ATX: N05AX08 (Risperidone)
Активное вещество: рисперидон (risperidone)
Rec.INN зарегистрированное ВОЗ
Лекарственная форма
РИСПОЛЕПТ® таб., покр. пленочной оболочкой, 4 мг: 20 или 60 шт.
рег. №: П N014824/01 от 25.12.08 – Срок действия рег. уд. не ограничен

Форма выпуска, состав и упаковка
Таблетки, покрытые пленочной оболочкой белого цвета, продолговатые, двояковыпуклые, с риской, с надписями “Ris” и “1” на одной стороне.

1 таб.
рисперидон 1 мг

Вспомогательные вещества: лактозы моногидрат – 131 мг, крахмал кукурузный – 44 мг, гипромеллоза 2910 15 мПа×с – 2 мг, натрия лаурилсульфат – 0.4 мг, целлюлоза микрокристаллическая – 20 мг, магния стеарат – 1 мг, кремния диоксид коллоидный – 0.6 мг.

Состав оболочки: гипромеллоза 2910 5 мПа×с – 4 мг, пропиленгликоль – 1 мг.

10 шт. – блистеры (2) – коробки картонные.
10 шт. – блистеры (6) – коробки картонные.

Таблетки, покрытые пленочной оболочкой светло-оранжевого цвета, продолговатые, двояковыпуклые, с риской, с надписями “Ris” и “2” на одной стороне.

1 таб.
рисперидон 2 мг

Вспомогательные вещества: лактозы моногидрат – 130 мг, крахмал кукурузный – 44 мг, гипромеллоза 2910 15 мПа×с – 2 мг, натрия лаурилсульфат – 0.4 мг, целлюлоза микрокристаллическая – 20 мг, магния стеарат – 1 мг, кремния диоксид коллоидный – 0.6 мг.

Состав оболочки: гипромеллоза 2910 5 мПа×с – 4 мг, пропиленгликоль – 1 мг, тальк – 1.2 мг, титана диоксид – 2 мг, краситель солнечный закат желтый (E110) – 0.05 мг.

10 шт. – блистеры (2) – коробки картонные.
10 шт. – блистеры (6) – коробки картонные.

Таблетки, покрытые пленочной оболочкой желтого цвета, продолговатые, двояковыпуклые, с риской, с надписями “Ris” и “3” на одной стороне.

1 таб.
рисперидон 3 мг

Вспомогательные вещества: лактозы моногидрат – 195 мг, крахмал кукурузный – 66 мг, гипромеллоза 2910 15 мПа×с – 3 мг, натрия лаурилсульфат – 0.6 мг, целлюлоза микрокристаллическая – 30 мг, магния стеарат – 1.5 мг, кремния диоксид коллоидный – 0.9 мг.

Состав оболочки: гипромеллоза 2910 5 мПа×с – 5.2 мг, пропиленгликоль – 1.3 мг, тальк – 1.56 мг, титана диоксид – 2.6 мг, краситель хинолиновый желтый (E104) – 0.052 мг.

10 шт. – блистеры (2) – коробки картонные.
10 шт. – блистеры (6) – коробки картонные.

Таблетки, покрытые пленочной оболочкой зеленого цвета, продолговатые, двояковыпуклые, с риской, с надписями “Ris” и “4” на одной стороне.

1 таб.
рисперидон 4 мг

Вспомогательные вещества: лактозы моногидрат – 260 мг, крахмал кукурузный – 88 мг, гипромеллоза 2910 15 мПа×с – 4 мг, натрия лаурилсульфат – 0.8 мг, целлюлоза микрокристаллическая – 40 мг, магния стеарат – 2 мг, кремния диоксид коллоидный – 1.2 мг.

Состав оболочки: гипромеллоза 2910 5 мПа×с – 6.8 мг, пропиленгликоль – 1.7 мг, тальк – 2.04 мг, титана диоксид – 3.4 мг, краситель хинолиновый желтый (E104) – 0.068 мг, индигокармин (E132) – 0.068 мг.

10 шт. – блистеры (2) – коробки картонные.
10 шт. – блистеры (6) – коробки картонные.

Клинико-фармакологическая группа: Антипсихотический препарат (нейролептик)
Фармако-терапевтическая группа: Антипсихотическое (нейролептическое) средство

Показания
— лечение шизофрении у взрослых и детей от 13 лет,

— лечение маниакальных эпизодов, связанных с биполярным расстройством, средней и тяжелой степени у взрослых и детей от 10 лет,

— краткосрочное (до 6 недель) лечение непрекращающейся агрессии у пациентов с деменцией, обусловленной болезнью Альцгеймера, средней и тяжелой степени, не поддающейся нефармакологическим методам коррекции, и когда есть риск причинения вреда пациентом самому себе или другим лицам,

— краткосрочное (до 6 недель) симптоматическое лечение непрекращающейся агрессии в структуре расстройства поведения у детей от 5 лет с умственной отсталостью, диагностированной в соответствии с DSM-IV, при которой в силу тяжести агрессии или иного деструктивного поведения требуется медикаментозное лечение. Фармакотерапия должна быть частью более широкой программы лечения, в т.ч. психологических и образовательных мероприятий. Рисперидон должен назначаться специалистом в области детской неврологии и детской психиатрии или врачом, хорошо знакомым с лечением расстройств поведения у детей и подростков.

Коды МКБ-10 Код МКБ-10 Показание
F20 Шизофрения
F21 Шизотипическое расстройство
F22 Хронические бредовые расстройства
F23 Острые и преходящие психические расстройства
F25 Шизоаффективные расстройства
F29 Неорганический психоз неуточненный
F30 Маниакальный эпизод
F31 Биполярное аффективное расстройство

Режим дозирования
Препарат принимают внутрь. Прием пищи не оказывает влияния на всасывание препарата.

При назначении препарата в дозах менее 1 мг рекомендуется применять Рисполепт®, раствор для приема внутрь.

Шизофрения

Взрослым Рисполепт® можно назначать 1 или 2 раза/сут. Начальная доза препарата Рисполепт® – 2 мг/сут. На второй день дозу следует увеличить до 4 мг/сут. С этого момента дозу можно либо сохранить на прежнем уровне, либо индивидуально скорректировать при необходимости. Обычно оптимальной дозой является 4-6 мг/сут. В ряде случаев может быть оправдано более медленное повышение дозы и более низкие начальная и поддерживающая дозы.

Дозы выше 10 мг/сут не показали более высокой эффективности по сравнению с меньшими дозами и могут вызвать появление экстрапирамидных симптомов. В связи с тем, что безопасность доз выше 16 мг/сут не изучалась, дозы выше этого уровня применять нельзя.

Пациентам, у которых наблюдается устойчивая сонливость, рекомендуется принимать половину суточной дозы 2 раза/сут.

Пациентам пожилого возраста препарат назначают в начальной дозе по 0.5 мг 2 раза/сут. Дозу можно индивидуально увеличить на 0.5 мг 2 раза/сут до 1-2 мг 2 раза/сут.

Детям от 13 лет рекомендуется начальная доза 0.5 мг на прием 1 раз/сут утром или вечером. При необходимости дозу можно увеличить не менее чем через 24 ч на 0.5-1 мг/сут до рекомендуемой дозы 3 мг/сут при хорошей переносимости. Несмотря на эффективность, продемонстрированную при лечении шизофрении у подростков препаратом в дозах 1-6 мг/сут, не наблюдалось дополнительной эффективности при применении препарата в дозах выше 3 мг/сут, а более высокие дозы вызывали больше побочных эффектов. Применение препарата в дозах выше 6 мг/сут не изучалось.

Маниакальные эпизоды, связанные с биполярным расстройством

Рекомендованная начальная доза препарата для взрослых – 2 мг/сут за один прием. При необходимости эта доза может быть повышена не менее чем через 24 ч на 1 мг/сут. Для большинства пациентов оптимальной дозой является 1-6 мг/сут. Применение препарата в дозах выше 6 мг/сут у пациентов с маниакальными эпизодами не изучалось.

Как и для любой другой симптоматической терапии, целесообразность продолжения лечения препаратом Рисполепт® должна регулярно оцениваться и подтверждаться.

Пациентам, у которых наблюдается устойчивая сонливость, рекомендуется принимать половину суточной дозы 2 раза/сут.

Для пациентов пожилого возраста начальная доза – по 0.5 мг 2 раза/сут. Дозу можно индивидуально увеличивать на 0.5 мг 2 раза/сут до 1-2 мг 2 раза/сут. Необходимо соблюдать осторожность в связи с ограниченным опытом применения препарата у пожилых пациентов.

Детям от 10 лет рекомендуется начальная доза 0.5 мг на прием 1 раз/сут утром или вечером. При необходимости дозу можно увеличить не менее чем через 24 ч на 0.5-1 мг/сут до рекомендуемой дозы 1-2.5 мг/сут при хорошей переносимости. Несмотря на эффективность, продемонстрированную при лечении маниакальных эпизодов, связанных с биполярным расстройством у детей, препаратом в дозах 0.5-6 мг/сут, не наблюдалось дополнительной эффективности при применении в дозах выше 2.5 мг/сут, а более высокие дозы вызывали больше побочных эффектов. Применение препарата в дозах выше 6 мг/сут не изучалось.

Непрекращающаяся агрессия у пациентов с деменцией, обусловленной болезнью Альцгеймера

Рекомендуется начальная доза по 0.25 мг 2 раза/сут. Дозу при необходимости можно индивидуально увеличивать по 0.25 мг 2 раза/сут, не чаще чем через день. Для большинства пациентов оптимальной дозой является 0.5 мг 2 раза/сут. Однако некоторым пациентам показан прием по 1 мг 2 раза/сут.

Рисполепт® не следует применять более 6 недель у пациентов с непрекращающейся агрессией у пациентов с деменцией, обусловленной болезнью Альцгеймера. Во время лечения состояние пациентов следует оценивать на регулярной основе, также как и необходимость продолжения терапии.

Непрекращающаяся агрессия в структуре расстройства поведения

Детям от 5 до 18 лет (с массой тела 50 кг и более) рекомендуется начальная доза 0.5 мг 1 раз/сут. При необходимости эта доза может быть повышена на 0.5 мг/сут, не чаще чем через день. Для большинства пациентов оптимальной является доза 1 мг/сут. Однако для некоторых пациентов предпочтительней прием по 0.5 мг/сут, тогда как некоторым требуется увеличение дозы до 1.5 мг/сут.

Детям от 5 до 18 лет (с массой тела менее 50 кг) рекомендуется начальная доза 0.25 мг 1 раз/сут. При необходимости эта доза может быть повышена на 0.25 мг/сут, не чаще чем через день. Для большинства пациентов оптимальной является доза 0.5 мг/сут. Однако для некоторых пациентов предпочтительней прием по 0.25 мг/сут, тогда как некоторым требуется увеличение дозы до 0.75 мг/сут.

Как и для любой другой симптоматической терапии, целесообразность продолжения лечения препаратом Рисполепт® должна регулярно оцениваться и подтверждаться.

Применение у детей в возрасте до 5 лет не рекомендуется ввиду отсутствия данных.

Особые группы пациентов

У пациентов с нарушением функции почек снижена способность выведения активной антипсихотической фракции по сравнению с другими пациентами.

У пациентов с нарушением функции печени наблюдается повышенная концентрация свободной фракции рисперидона в плазме крови.

Начальная и поддерживающая доза в соответствии с показаниями должна быть уменьшена в 2 раза, увеличение дозы у пациентов с заболеваниями печени и почек должно проводиться медленнее. Рисполепт® следует назначать с осторожностью у данной категории больных.

Отмена препарата

Прекращение приема препарата рекомендуется проводить постепенно. Острые симптомы отмены, включая тошноту, рвоту, потливость и бессонницу, наблюдались очень редко после резкого прекращения приема антипсихотических препаратов в высоких дозах.

Переход от терапии другими антипсихотическими препаратами

В начале лечения препаратом Рисполепт® рекомендуется постепенно отменять предшествующую терапию, если это клинически оправдано. При этом если пациенты переводятся с терапии депо-формами антипсихотических препаратов, то терапию препаратом Рисполепт® рекомендуется начинать вместо следующей запланированной инъекции. Периодически следует оценивать необходимость продолжения текущей терапии противопаркинсоническими препаратами.

Побочное действие
Наиболее часто наблюдаемыми побочными эффектами (частота возникновения ≥10%) являлись: паркинсонизм, головная боль и бессонница.

Побочные эффекты препарата Рисполепт® в терапевтических дозах приведены с распределением по частоте и системам органов. Частоту побочных эффектов классифицировали следующим образом: очень часто (≥1/10 случаев), часто (≥1/100 и

Инфекции: часто – пневмония, грипп, бронхит, инфекции верхних дыхательных путей, инфекции мочевыводящих путей, синусит, инфекции уха, нечасто – вирусные инфекции, тонзиллит, воспаление подкожной жировой клетчатки, средний отит, инфекции глаз, локализованные инфекции, акародерматит, инфекции дыхательных путей, цистит, онихомикоз, редко – хронический средний отит.

Со стороны иммунной системы: нечасто – гиперчувствительность, редко – лекарственная гиперчувствительность, анафилактическая реакция.

Со стороны сердечно-сосудистой системы: часто – тахикардия, артериальная гипертензия, нечасто – артериальная гипотензия, ортостатическая гипотензия, приливы, AV-блокада, блокада пучка Гиса, фибрилляция предсердий, сердцебиение, нарушение проводимости сердца, редко – синусовая брадикардия, эмболия легочной артерии, тромбоз глубоких вен.

Со стороны системы кроветворения: нечасто – анемия, тромбоцитопения, редко – гранулоцитопения, агранулоцитоз.

Со стороны нервной системы: очень часто – паркинсонизм2, головная боль, сонливость, седативный эффект, часто – акатизия2, головокружение2, тремор2, дистония2, летаргия, дискинезия2, нечасто – отсутствие реакции на раздражители, потеря сознания, обморок, нарушение сознания, инсульт, транзиторная ишемическая атака, дизартрия, нарушение внимания, гиперсомния, постуральное головокружение, нарушение равновесия, поздняя дискинезия, нарушение речи, нарушение координации, гипестезия, расстройства вкусовых ощущений, извращение вкуса, судороги, церебральная ишемия, нарушение движений, редко – злокачественный нейролептический синдром, диабетическая кома, цереброваскулярные нарушения, тремор головы.

Психические нарушения: очень часто – бессонница, часто – беспокойство, возбуждение, нарушения сна, тревога, нечасто – спутанность сознания, мании, снижение либидо, вялость, нервозность, редко – аноргазмия, аффективное уплощение.

Со стороны органа зрения: часто – нечеткое зрение, конъюнктивит, нечасто – покраснение глаз, нарушение зрения, выделения из глаз, отек области вокруг глаз, сухость глаз, усиленное слезотечение, светобоязнь, редко – снижение остроты зрения, непроизвольные вращения глазных яблок, глаукома, интраоперационный синдром дряблой радужки.

Со стороны органа слуха: нечасто – боль в ухе, шум в ушах.

Со стороны дыхательной системы: часто – одышка, носовое кровотечение, кашель, заложенность носа, боль в области гортани и глотки, нечасто – свистящее дыхание, аспирационная пневмония, застой в легких, нарушение дыхания, влажные хрипы, нарушение проходимости дыхательных путей, дисфония, редко – синдром апноэ во сне, гипервентиляция.

Со стороны ЖКТ: часто – рвота, диарея, запор, тошнота, боли в области живота, диспепсия, сухость во рту, дискомфорт в желудке, гиперсаливация, нечасто – дисфагия, гастрит, недержание кала, фекалома, гастроэнтерит, метеоризм, редко – непроходимость кишечника, панкреатит, отек губ, хейлит.

Со стороны печени и желчевыводящих путей: редко – желтуха.

Со стороны почек и мочевыводящих путей: часто – энурез, нечасто – задержка мочевыделения, дизурия, недержание мочи, поллакиурия.

Со стороны кожи и подкожных тканей: часто – сыпь, эритема, нечасто – поражение кожи, нарушение кожных покровов, зуд, акне, угревая сыпь, изменение цвета кожи, алопеция, себорейный дерматит, сухость кожи, гиперкератоз, редко – перхоть, очень редко – отек Квинке.

Со стороны костно-мышечной системы и соединительной ткани: часто – артралгия, боли в спине, боли в конечностях, нечасто – мышечная слабость, миалгия, боли в шее, отечность суставов, нарушение осанки, скованность в суставах, мышечные боли в груди, редко – рабдомиолиз.

Со стороны обмена веществ: часто – повышение аппетита, снижение аппетита, нечасто – сахарный диабет3, анорексия, полидипсия, гипергликемия, редко – нарушение выработки антидиуретического гормона, гипогликемия, водная интоксикация, очень редко – диабетический кетоацидоз.

Общие нарушения и местные реакции: часто – пирексия, усталость, периферический отек, генерализованный отек, астения, боли в области грудной клетки, нечасто – отек лица, нарушение походки, плохое самочувствие, медлительность, гриппоподобное состояние, жажда, дискомфорт в области грудной клетки, озноб, редко – гипотермия, синдром отмены, похолодание конечностей.

Со стороны репродуктивной системы и молочных желез: нечасто – аменорея, сексуальная дисфункция, эректильная дисфункция, нарушение эякуляции, галакторея, гинекомастия, расстройство менструального цикла, выделения из влагалища, редко – приапизм.

Беременность, послеродовой и неонатальный периоды: редко – синдром отмены у новорожденных.

Общие нарушения и местные реакции: часто – пирексия, усталость, периферический отек, генерализованный отек, астения, боли в области грудной клетки, нечасто – отек лица, нарушение походки, плохое самочувствие, медлительность, гриппоподобное состояние, жажда, дискомфорт в области грудной клетки, озноб, редко – гипотермия, синдром отмены, похолодание конечностей.

Со стороны лабораторных и инструментальных показателей: часто – увеличение уровня пролактина1, увеличение массы тела, нечасто – удлинение интервала QT на ЭКГ, отклонения ЭКГ, увеличение уровня трансаминаз, уменьшение количества лейкоцитов в крови, повышение температуры тела, увеличение количества эозинофилов в крови, уменьшение уровня гемоглобина, увеличение уровня КФК, повышение концентрации холестерина, редко – понижение температуры тела, повышение концентрации триглицеридов.

1– гиперпролактинемия в некоторых случаях может приводить к гинекомастии, нарушениям менструального цикла, аменорее и галакторее.

2– экстрапирамидные расстройства могут проявляться как: паркинсонизм (гиперсаливация, костно-мышечная скованность, слюнотечение, ригидность по типу “зубчатого колеса”, брадикинезия, гипокинезия, маскоподобное лицо, напряженность мышц, акинезия, ригидность затылочных мышц, мышечная ригидность, паркинсоническая походка, нарушения глабеллярного рефлекса), акатизия (беспокойство, гиперкинезия и синдром “беспокойных” ног), тремор, дискинезия (подергивание мышц, хореоатетоз, атетоз и миоклонус), дистония.

Термин “дистония” включает дистонию, мышечные спазмы, гипертонию, кривошею, непроизвольные мышечные сокращения, мышечную контрактуру, блефароспазм, движения глазного яблока, паралич языка, лицевой спазм, ларингоспазм, миотония, опистотонус, орофарингеальный спазм, плеврототонус, спазм языка и тризм. Тремор включает тремор и паркинсонический тремор покоя. Также следует отметить, что существует более широкий ряд симптомов, которые не всегда имеют экстрапирамидное происхождение.

3– в плацебо-контролирумых исследованиях сахарный диабет наблюдался у 0.18% пациентов, принимавших рисперидон по сравнению с 0.11% пациентов в группе плацебо. Общая частота возникновения сахарного диабета по результатам всех клинических испытаний составила 0.43% всех пациентов, принимавших рисперидон.

Ниже дополнительно перечислены побочные действия, наблюдаемые в ходе клинических исследований пролонгированной инъекционной формы рисперидона – Рисполепт Конста®, но не проявившиеся при применении пероральных лекарственных форм рисперидона. Данный список не включает в себя побочные действия, связанные с составом или инъекционным путем введения препарата.

Со стороны лабораторных показателей: уменьшение массы тела, увеличение уровня гамма-глутамилтрансферазы, увеличение печеночных ферментов.

Со стороны сердечно-сосудистой системы: брадикардия.

Со стороны системы кроветворения: нейтропения.

Со стороны нервной системы: парестезия, конвульсии.

Со стороны органа зрения: блефароспазм, окклюзия артерии сетчатки.

Со стороны органа слуха и вестибулярного аппарата: вертиго.

Со стороны ЖКТ: зубная боль, спазм языка.

Со стороны кожи и подкожных тканей: экзема.

Со стороны костно-мышечной системы и соединительной ткани: боли в ягодицах.

Инфекции: инфекции нижних дыхательных путей, инфекции, гастроэнтерит, подкожный абсцесс.

Травмы и отравления: падение.

Сосудистые нарушения: артериальная гипертензия.

Общие нарушения и явления, обусловленные путем введения препарата: боли.

Психические нарушения: депрессия.

Класс-эффекты

Как и при применении других антипсихотических препаратов, очень редкие случаи увеличения зубца QT отмечались в постмаркетинговом периоде наблюдения. Другие класс-эффекты со стороны сердечно-сосудистой системы, наблюдаемые при применении антипсихотических препаратов, которые способствуют увеличению зубца QT, включают: желудочковую аритмию, желудочковую фибрилляцию, желудочковую тахикардию, внезапную смерть, остановку сердца и двунаправленную желудочковую тахикардию.

Венозная тромбоэмболия

Случаи венозной тромбоэмболии, включая легочную эмболию и случаи тромбоза глубоких вен, наблюдались при использовании антипсихотических препаратов (частота неизвестна).

Повышение массы тела

В ходе плацебо-контролируемых исследований у пациентов с шизофренией повышение массы тела не менее 7% через 6-8 недель наблюдалось у 18% пациентов, принимающих препарат Рисполепт®, и у 9% пациентов, принимающих плацебо. В плацебо-контролируемых клинических исследованиях у пациентов с маниакальными эпизодами число случаев повышения массы тела на 7% и более после 3 недель лечения было сравнимо в группе, принимающей препарат Рисполепт® (2.5%) и в группе, принимающей плацебо (2.4%), а в группе активного контроля было немного больше (3.5%).

У детей с расстройствами поведения в ходе долговременных клинических исследований масса тела увеличивалась в среднем на 7.3 кг после 12 мес терапии. Ожидаемое повышение массы тела у детей в возрасте 5-12 лет с нормальным развитием составляет 3-5 кг в год. С 12-16 лет величина повышения массы тела должна составлять 3-5 кг в год для девочек и около 5 кг в год для мальчиков.

Дополнительная информация об особых популяциях пациентов

Побочные действия, которые отмечались с большей частотой у пациентов пожилого возраста с деменцией и у детей, нежели чем у взрослых пациентов, описаны ниже.

Пожилые пациенты с деменцией: транзиторная ишемическая атака и инсульт наблюдались в ходе клинических исследований с частотой 1.4% и 1.5% соответственно у пожилых пациентов с деменцией. Кроме того, следующие побочные действия отмечались у пациентов пожилого возраста с деменцией с частотой ≥5% и с частотой, по крайней мере, в 2 раза превышающей таковую в других популяциях пациентов: инфекции мочевыводящих путей, периферический отек, летаргия и кашель.

Дети: следующие побочные действия отмечались у детей (от 5 до 17 лет) с частотой ≥5% и с частотой, по крайней мере, в 2 раза превышающей таковую в других популяциях пациентов в ходе клинических исследований: сонливость/седативный эффект, усталость, головная боль, повышение аппетита, рвота, инфекции верхних дыхательных путей, заложенность носа, боль в области живота, головокружение, кашель, пирексия, тремор, диарея, энурез.

Противопоказания к применению
— фенилкетонурия,

— повышенная чувствительность к рисперидону или любому другому компоненту препарата.

С осторожностью:

— заболевания сердечно-сосудистой системы (хроническая сердечная недостаточность, перенесенный инфаркт миокарда, нарушения проводимости сердечной мышцы),

— обезвоживание и гиповолемия,

— нарушения мозгового кровообращения,

— болезнь Паркинсона,

— судороги (в т.ч. в анамнезе),

— тяжелая почечная или печеночная недостаточность,

— злоупотребление лекарственными средствами или лекарственная зависимость,

— состояния, предрасполагающие к развитию тахикардии типа “пируэт” (брадикардия, нарушение электролитного баланса, сопутствующий прием лекарственных средств, удлиняющих интервал QT),

— опухоль мозга, кишечная непроходимость, случаи острой передозировки лекарств, синдром Рейе (противорвотный эффект рисперидона может маскировать симптомы этих состояний),

— факторы риска развития тромбоэмболии венозных сосудов,

— болезнь диффузных телец Леви,

— пациенты пожилого возраста с цереброваскулярной деменцией,

— беременность.

Применение при беременности и кормлении грудью
Полноценных исследований по применению рисперидона у беременных женщин не проводилось. По данным наблюдений в постмаркетинговом периоде при применении рисперидона в III триместре беременности у новорожденного возникли обратимые экстрапирамидные симптомы, поэтому новорожденные должны находиться под тщательным наблюдением. В исследованиях на животных рисперидон не обладал тератогенным действием, однако, наблюдались другие виды токсического действия на репродуктивную систему. Потенциальный риск для людей неизвестен. Рисполепт® можно применять при беременности только если ожидаемая польза применения препарата для беременной женщины превосходит потенциальный риск для плода. При необходимости прекращения приема препарата при беременности, следует проводить отмену препарата постепенно.

В исследованиях у животных рисперидон и 9-гидроксирисперидон проникали в грудное молоко. Было также продемонстрировано, что рисперидон и 9-гидроксирисперидон в небольших количествах проникают в грудное молоко у людей. Данные о побочном действии у младенцев, находящихся на грудном вскармливании, отсутствуют. Поэтому вопрос о грудном вскармливания должен решаться с учетом возможного риска для ребенка.

Применение при нарушениях функции печени
У пациентов с нарушением функции печени наблюдается повышенная концентрация свободной фракции рисперидона в плазме крови.

Начальная и поддерживающая доза в соответствии с показаниями должна быть уменьшена в 2 раза, увеличение дозы у пациентов с заболеваниями печени должно проводиться медленнее. Рисполепт® следует назначать с осторожностью у данной категории больных.

С осторожностью следует применять препарат у пациентов с тяжелой печеночной недостаточностью.

Применение при нарушениях функции почек
У пациентов с нарушением функции почек снижена способность выведения активной антипсихотической фракции по сравнению с другими пациентами. Начальная и поддерживающая доза в соответствии с показаниями должна быть уменьшена в 2 раза, увеличение дозы у пациентов с заболеваниями почек должно проводиться медленнее. Рисполепт® следует назначать с осторожностью у данной категории больных.

С осторожностью следует применять препарат у пациентов с тяжелой почечной недостаточностью.

Применение у детей
Применение у детей в возрасте до 5 лет не рекомендуется ввиду отсутствия данных.

Применение у пожилых пациентов
Для пациентов пожилого возраста начальная доза – по 0.5 мг 2 раза/сут. Дозу можно индивидуально увеличивать на 0.5 мг 2 раза/сут до 1-2 мг 2 раза/сут. Необходимо соблюдать осторожность в связи с ограниченным опытом применения препарата у пожилых пациентов.

С осторожностью следует назначать препарат пациентам пожилого возраста с цереброваскулярной деменцией.

Особые указания
Повышенная смертность у пациентов пожилого возраста с деменцией

У пожилых пациентов с деменцией при лечении атипичными антипсихотическими средствами наблюдается повышенная смертность по сравнению с плацебо в исследованиях атипичных антипсихотических средств, включая рисперидон. При применении рисперидона для данной популяции частота смертельных случаев составила 4.0% для пациентов, принимающих рисперидон, по сравнению с 3.1% для плацебо. Средний возраст умерших пациентов составляет 86 лет (диапазон 67-100 лет). Данные, собранные в результате двух обширных наблюдательных исследований, показывают, что пациенты пожилого возраста с деменцией, проходящие лечение типичными антипсихотическими препаратами, также имеют немного повышенный риск смерти по сравнению с пациентами, не проходящими лечение. В настоящий момент собрано недостаточно данных для точной оценки данного риска. Неизвестна и причина повышения данного риска. Также не определена степень, в которой повышение смертности может быть применимо к антипсихотическим препаратам, а не к особенностям данной группы пациентов.

Совместное применение с фуросемидом

У пациентов пожилого возраста с деменцией наблюдалась повышенная смертность при одновременном применении фуросемида и рисперидона перорально (7.3%, средний возраст 89 лет, диапазон 75-97 лет) по сравнению с группой, принимавшей только рисперидон (3.1%, средний возраст 84 года, диапазон 70-96 лет) и группой, принимавшей только фуросемид (4.1%, средний возраст 80 лет, диапазон 67-90 лет). Повышение смертности пациентов, принимающих рисперидон совместно с фуросемидом, наблюдалось в ходе 2 из 4 клинических исследований. Совместное применение рисперидона с другими диуретиками (в основном с тиазидными диуретиками в малых дозах) не сопровождалось повышением смертности.

Не установлено патофизиологических механизмов, объясняющих данное наблюдение. Тем не менее, следует соблюдать особую осторожность при назначении препарата в таких случаях. Перед назначением необходимо тщательно оценивать соотношение риск/польза. Не обнаружено увеличения смертности у пациентов, одновременно принимающих другие диуретики вместе с рисперидоном. Независимо от лечения, дегидратация является общим фактором риска смертности и должна тщательно контролироваться у пациентов пожилого возраста с деменцией.

У пациентов пожилого возраста с деменцией наблюдалось увеличение побочных эффектов со стороны цереброваскулярной системы (острые и преходящие нарушения мозгового кровообращения), в т.ч. смертельные случаи у пациентов (средний возраст 85 лет, диапазон 73-97 лет) при применении рисперидона по сравнению с плацебо.

Кардиоваскулярные эффекты

В плацебо-контролируемых клинических исследованиях у пациентов с деменцией, принимающих некоторые атипичные антипсихотические препараты, наблюдалось повышение риска цереброваскулярных побочных эффектов примерно в 3 раза. Объединенные данные 6 плацебо-контролируемых исследований, включавших в основном пациентов пожилого возраста с деменцией (возраст более 65 лет) демонстрируют, что цереброваскулярные побочные эффекты (серьезные и несерьезные) возникали у 3.3% (33/1009) пациентов, принимавших рисперидон, и у 1.2% (8/712) пациентов, принимавших плацебо. Соотношение рисков составляло 2.96 (1.34, 7.50) при доверительном интервале 95%. Механизм повышения риска неизвестен. Увеличение риска не исключается и для других антипсихотических препаратов, а также для других популяций пациентов. Рисполепт® должен применяться с осторожностью у пациентов с факторами риска возникновения инсульта.

Риск возникновения цереброваскулярных побочных эффектов гораздо выше у пациентов со смешанной или сосудистой деменцией, по сравнению с пациентами с альцгеймеровской деменцией. Поэтому пациенты с деменцией любого типа, кроме альцгеймеровской, не должны принимать рисперидон.

Врачам следует оценивать соотношение риск/польза применения препарата Рисполепт® у пациентов пожилого возраста с деменцией, принимая во внимание предвестники риска инсульта индивидуально у каждого пациента. Пациенты и лица, ухаживающие за ними, должны быть предупреждены о том, что необходимо немедленно сообщать о признаках и симптомах кардиоваскулярных событий: таких как внезапная слабость или неподвижность/нечувствительность в области лица, ног, рук, а также затруднения речи и проблемы со зрением. При этом должны рассматриваться все возможные варианты лечения, включая прекращение приема рисперидона.

Рисполепт® может использоваться только для кратковременного лечения непрекращающейся агрессии у пациентов с деменцией, обусловленной болезнью Альцгеймера, средней и тяжелой степени, в качестве дополнения к нефармакологическим методам коррекции, в случае их неэффективности или ограниченной эффективности, и когда есть риск причинения вреда пациентом самому себе или другим лицам.

Необходимо постоянно оценивать состояние пациентов и необходимость продолжения терапии рисперидоном.

Ортостатическая гипотензия

Рисперидон обладает альфа-блокирующей активностью, и поэтому может вызывать у некоторых пациентов ортостатическую гипотензию, особенно в период начального подбора дозы. Клинически значимая гипотензия наблюдалось в постмаркетинговом периоде при совместном применении с антигипертензивными препаратами. Рисполепт® необходимо применять с осторожностью у пациентов с известными кардиоваскулярными заболеваниями (например, сердечная недостаточность, инфаркт миокарда, нарушения проводимости сердечной мышцы, дегидратация гиповолемия или цереброваскулярное заболевание). Также необходима соответствующая коррекция дозы. Рекомендуется оценить возможность снижения дозы в случае возникновения гипотензии.

Поздняя дискинезия и экстрапирамидные расстройства

Препараты, обладающие свойствами антагонистов допаминовых рецепторов, могут вызывать позднюю дискинезию, которая характеризуется ритмическими непроизвольными движениями, преимущественно языка и/или мимической мускулатуры. Возникновение экстрапирамидных симптомов является фактором риска развития поздней дискинезии. При возникновении у пациента объективных или субъективных симптомов, указывающих на позднюю дискинезию, следует рассмотреть целесообразность отмены всех антипсихотических препаратов, включая Рисполепт®.

Злокачественный нейролептический синдром (ЗНС)

Антипсихотические препараты, включая рисперидон, могут вызывать злокачественный нейролептический синдром (ЗНС), который характеризуется гипертермией, ригидностью мышц, нестабильностью функции вегетативной нервной системы, угнетением сознания, а также повышением в сыворотке концентраций КФК. У пациентов с ЗНС могут возникать также миоглобинурия (рабдомиолиз) и острая почечная недостаточность. При возникновении у пациента объективных или субъективных симптомов ЗНС необходимо немедленно отменить все антипсихотические препараты, включая Рисполепт®.

Болезнь Паркинсона и деменция с тельцами Леви

Назначение антипсихотических препаратов, включая Рисполепт®, пациентам с болезнью Паркинсона или деменцией с тельцами Леви должно проводиться с осторожностью, т.к. у обеих групп пациентов повышен риск развития нейролептического злокачественного синдрома и увеличена чувствительность к антипсихотическим препаратам (включая притупление болевой чувствительности, спутанность сознания, постуральную нестабильность с частыми падениями и экстрапирамидные симптомы). При приеме рисперидона возможно ухудшение течения болезни Паркинсона.

Гипергликемия и сахарный диабет

При лечении препаратом Рисполепт® наблюдались гипергликемия, сахарный диабет и обострение уже имеющегося сахарного диабета. Вероятно, что предшествующее лечению увеличение массы тела также является предрасполагающим к этому фактором. Очень редко может наблюдаться кетоацидоз и редко – диабетическая кома. У всех пациентов необходимо проводить клинический контроль на наличие симптомов гипергликемии (таких как полидипсия, полиурия, полифагия и слабость). У пациентов с сахарным диабетом должно проводиться регулярное наблюдение на предмет ухудшения контроля уровня глюкозы.

Увеличение массы тела

При лечении препаратом Рисполепт® наблюдалось значительное увеличение массы тела. Необходимо проводить контроль массы тела пациентов.

Гиперпролактинемия

На основании результатов исследований на культурах тканей сделано предположение, что рост опухолевых клеток груди может стимулироваться пролактином. Несмотря на то, что в клинических и эпидемиологических исследованиях не выявлено четкой связи гиперпролактинемии с приемом антипсихотических препаратов, следует соблюдать осторожность при назначении рисперидона пациентам с отягощенным анамнезом. Препарат Рисполепт® должен применяться с осторожностью у пациентов с существующей гиперпролактинемией и у пациентов с возможными пролактин-зависимыми опухолями.

Удлинение интервала QT

Удлинение интервала QT очень редко наблюдалось в постмаркетинговом периоде наблюдения. Как и для других антипсихотических средств, следует соблюдать осторожность при назначении препарата Рисполепт® пациентам с известными кардиоваскулярными заболеваниями, удлинением интервала QT в семейном анамнезе, брадикардией, нарушениями электролитного баланса (гипокалиемия, гипомагниемия), т.к. это может увеличить риск аритмогенного эффекта, и при совместном применении с препаратами, удлиняющими интервал QT.

Судороги

Рисполепт® следует применять с осторожностью у пациентов с судорогами в анамнезе или с другими медицинскими состояниями, при которых может снижаться судорожный порог.

Приапизм

Приапизм может возникать при приеме рисперидона из-за альфа-адреноблокирующих эффектов.

Регуляция температуры тела

Антипсихотическим препаратам приписывается такой нежелательный эффект как нарушение способности организма регулировать температуру. Необходимо соблюдать осторожность при назначении препарата Рисполепт® пациентам с состояниями, которые могут способствовать повышению внутренней температуры тела, к которым относятся интенсивная физическая нагрузка, обезвоживание организма, воздействие высоких внешних температур или одновременное использование препаратов с антихолинергической активностью.

Венозная тромбоэмболия

При применении антипсихотических препаратов были отмечены случаи венозной тромбоэмболии. Поскольку пациенты, принимающие антипсихотические препараты, часто имеют риск развития венозной тромбоэмболии, все возможные факторы риска должны выявляться до начала и во время лечения препаратом Рисполепт®, и должны быть приняты предупреждающие меры.

Вспомогательные вещества

Препарат Рисполепт®, таблетки, покрытые пленочной оболочкой, содержит лактозу. Пациентам с редкими наследственными заболеваниями, связанными с непереносимостью галактозы, дефицитом лактазы lapp или глюкозо-галактозной мальабсорбции, не следует назначать препарат Рисполепт®, таблетки, покрытые пленочной оболочкой.

Таблетки 2 мг содержат краситель солнечный закат желтый (E110), который может вызвать аллергические реакции.

Использование в педиатрии

Перед назначением препарата Рисполепт® детям или подросткам с умственной отсталостью необходимо провести тщательную оценку их состояния на предмет наличия физических или социальных причин агрессивного поведения, таких как боль или неадекватные требования социальной среды.

Седативный эффект рисперидона должен тщательно отслеживаться в данной популяции из-за возможного влияния на способность к обучению. Изменение времени приема рисперидона может улучшить контроль влияния седации на внимание подростков и детей.

Применение рисперидона было связано со средним увеличением массы тела и индекса массы тела. Изменения роста в ходе долговременных исследований находились в рамках ожидаемых возрастных норм. Влияние долговременного приема рисперидона на половое развитие и рост полностью не изучено.

В связи с возможным влиянием продолжительной гиперпролактинемии на рост и половое развитие у детей и подростков, должна проводиться регулярная клиническая оценка гормонального статуса, в т.ч. измерение роста, веса, наблюдение за половым развитием, менструальным циклом и другими возможными пролактин-зависимыми эффектами.

Во время лечения рисперидоном должна проводиться регулярная проверка наличия экстрапирамидных симптомов и других расстройств движения.

Влияние на способность к вождению автотранспорта и управлению механизмами

Рисполепт® может в небольшой или умеренной степени оказывать воздействие на способность управлять транспортными средствами и механизмами. Пациентам следует рекомендовать отказаться от вождения автомобиля и от работы с механизмами до выяснения их индивидуальной чувствительности к препарату.

Передозировка
Симптомы: в целом, наблюдаемые симптомы передозировки представляли собой уже известные фармакологические эффекты рисперидона в усиленной форме: сонливость, седативный эффект, тахикардия, артериальная гипотензия, экстрапирамидные симптомы. Наблюдалось удлинение интервала QT и судороги. Двунаправленная желудочковая тахикардия отмечалась при совместном приеме рисперидона и пароксетина в повышенных дозах.

В случае острой передозировки следует рассмотреть возможность передозировки от приема нескольких препаратов.

Лечение: следует добиться и поддерживать свободную проходимость дыхательных путей для обеспечения адекватного снабжения кислородом и вентиляции. Промывание желудка (после интубации, если больной без сознания) и прием активированного угля вместе со слабительным следует проводить только в том случае, если препарат был принят не более 1 ч назад. Следует немедленно начать мониторирование ЭКГ для выявления возможных аритмий. Специфичного антидота не существует, должна проводиться соответствующая симптоматическая терапия. Артериальную гипотензию и сосудистый коллапс следует устранять в/в инфузиями жидкости и/или симпатомиметическими препаратами. При развитии тяжелых экстрапирамидных симптомов следует назначить антихолинергические препараты. Постоянное медицинское наблюдение и мониторирование следует продолжать до исчезновения симптомов интоксикации.

Лекарственное взаимодействие
Как и в случае с прочими антипсихотическими препаратами, следует соблюдать осторожность при совместном назначении препарата Рисполепт® с препаратами, увеличивающими интервал QT, например, с антиаритмическими средствами Iа класса (хинидин, дизопирамид, прокаинамид и др.), III класса (амиодарон, соталол и др.), трициклическими антидепрессантами (амитриптилин и др.), тетрациклическими антидепрессантами (мапротилин и др.), некоторыми антигистаминными препаратами, прочими антипсихотическими средствами, некоторыми противомалярийными препаратами (хинин, мефлохин и др.), препаратами, вызывающими электролитный дисбаланс (гипокалиемия, гипомагниемия), брадикардию или ингибируют печеночный метаболизм рисперидона. Данный перечень не является исчерпывающим.

Влияние препарата Рисполепт® на другие лекарственные препараты

Рисполепт® следует применять с осторожностью в сочетании с другими препаратами и веществами центрального действия, особенно с этанолом, опиатами, антигистаминными препаратами и бензодиазепинами из-за повышенного риска седативного эффекта.

Рисполепт® может снижать эффективность леводопы и других агонистов допамина. В случае если необходим прием данной комбинации, особенно в терминальной стадии болезни Паркинсона, следует назначать наименьшую эффективную дозу каждого из препаратов.

При применении рисперидона совместно с антигипертензивными препаратами в постмаркетинговом периоде наблюдалась клинически значимая артериальная гипотензия.

Рисперидон не оказывает клинически значимого действия на фармакокинетику лития, вальпроата, дигоксина или топирамата.

Влияние других лекарственных препаратов на препарат Рисполепт®

При использовании карбамазепина отмечалось снижение концентрации активной антипсихотической фракции рисперидона в плазме. Аналогичные эффекты могут наблюдаться при использовании других индукторов печеночных ферментов и P-гликопротеина (например, рифампицин, фенитоин, фенобарбитал). При назначении и после отмены карбамазепина или других индукторов печеночных ферментов и P-гликопротеина следует скорректировать дозу препарата Рисполепт®.

Флуоксетин и пароксетин, являющиеся ингибиторами изофермента CYP 2D6, увеличивают концентрацию рисперидона в плазме, в меньшей степени концентрацию активной антипсихотической фракции. Предполагается, что другие ингибиторы изофермента CYP2D6 (например, хинидин) влияют на концентрацию рисперидона таким же образом. При назначении и после отмены флуоксетина или пароксетина следует скорректировать дозу препарата Рисполепт®.

Верапамил, являющийся ингибитором изофермента CYP3A4 и P-гликопротеина, увеличивает концентрацию рисперидона в плазме.

Галантамин и донепезил не оказывают клинически значимого эффекта на фармакокинетику рисперидона и его активных антипсихотических фракций.

Фенотиазины, трициклические антидепрессанты и некоторые бета-адреноблокаторы могут повышать концентрации рисперидона в плазме, однако это не влияет на концентрацию активной антипсихотической фракции.

Амитриптилин не влияет на фармакокинетику рисперидона и активной антипсихотической фракции.

Циметидин и ранитидин увеличивают биодоступность рисперидона, но в минимальной степени влияют на концентрацию активной антипсихотической фракции.

Эритромицин, ингибитор изофермента CYP3A4, не влияет на фармакокинетику рисперидона и активной антипсихотической фракции.

Совместное применение психостимуляторов (например, метилфенидата) и препарата Рисполепт® у детей не изменяет фармакокинетические параметры и эффективность рисперидона.

Не рекомендуется применять рисперидон совместно с палиперидоном ввиду того, что палиперидон является активным метаболитом рисперидона, и применение такой комбинации может привести к увеличению концентрации активной антипсихотической фракции.

Условия отпуска из аптек
Препарат отпускается по рецепту.

Условия и сроки хранения
Препарат следует хранить в недоступном для детей месте при температуре от 15° до 30°C. Срок годности – 3 года.

Диагностика некультивируемых вирусов гастроэнтерита, калицивирусы человека

Успешное клонирование NV привело к разработке новых реагентов и методов диагностики инфекций, вызванных HuCV. Когда капсидный белок NV экспрессировали в бакуловирусной системе экспрессии, образовывались VLP 130. Впоследствии было показано, что эти VLP морфологически и антигенно сходны с нативными вирусными частицами 88. VLP использовали для иммунизации различных видов животных для получения поликлональных и моноклональных иммунных сыворотки, которые затем можно было бы использовать для проведения диагностических анализов на основе ИФА.Последовательность вируса использовали для конструирования пар праймеров для обнаружения HuCV с помощью ПЦР с обратной транскрипцией (ОТ). Разработка и применение этих новых анализов описаны ниже.

Обнаружение антигена
ИФА с гипериммунными сыворотками животных.

Производство NV VLP обеспечило достаточное количество вирусного капсидного антигена для создания гипериммунных сывороток у мышей, морских свинок и кроликов 130. Гипериммунные сыворотки этих животных имеют титры NV-специфических антител от 1:256 000 до >1: 1 000 000.Впоследствии VLP были получены для других HuCV, включая вирус Мексики (MX), SMA, HV, вирус Desert Shield, вирус Торонто (TV), вирус Гримсби (GRV), вирус Саппоро, вирус Саутгемптона и вирус Лордсдейла (LV) 55. , 87, 102, 109, 126, 160, 161, 198. Поликлональные гипериммунные сыворотки животных, полученные путем иммунизации различных видов животных VLP, использовались для разработки ИФА для обнаружения антигена для использования в клинических образцах 102, 121, 128. Эти иммунные сыворотки были весьма специфичны, выявляя гомологичные рекомбинантные VLP в формате EIA, но не реагируя с гетерологичными VLP.

ИФА для обнаружения антигена с использованием поликлональной гипериммунной сыворотки животных организован в сэндвич-формате 79, 121. Гипериммунная сыворотка кролика используется для захвата вирусного антигена, а гипериммунная сыворотка морской свинки используется для обнаружения захваченного антигена. Наличие или отсутствие сыворотки морской свинки определяют с помощью козьей сыворотки против морской свинки, конъюгированной с пероксидазой хрена. ИФА с использованием гипериммунных сывороток, полученных из рекомбинантных NV или рекомбинантных MX (rMX) VLP, выявляют аналогичные количества антигена, идентифицируя примерно от 10 5 до 10 6 частиц VLP на лунку 79, 121.Было обнаружено, что эти анализы обнаружения антигена обнаруживают нативный вирус в образцах стула с чувствительностью, сравнимой с чувствительностью ОТ-ПЦР. Было обнаружено, что анализ обнаружения NV-антигена более чувствителен, чем РИА 79, 199. Из 50 образцов стула с положительным ИФА, полученных в ходе экспериментальных исследований инфекций человека, только 24 образца были положительными при РИА; 26 РИА-отрицательных образцов содержали вирус с помощью ОТ-ПЦР. В отличие от результатов исследований IEM, в которых выделение вируса не могло быть задокументировано через 100 часов после экспериментального заражения человека, ИФА для обнаружения антигена идентифицировал NV в стуле до 13 дней 203, 237.Таким образом, ИФА для обнаружения антигена с использованием гипериммунных сывороток, полученных против VLP, является более чувствительным, чем более ранние анализы, основанные на человеческих реагентах. астровирусы, вирус гепатита А и энтеровирусы 79, 121, 199.

Ограничение этих анализов обнаружения антигена было обнаружено, когда эти анализы применялись к клиническим образцам, содержащим другие HuCV.Например, анализ обнаружения антигена, в котором используются гипериммунные сыворотки, индуцированные до VLP rNV, выявляет только подмножество NLV геногруппы I и не обнаруживает NLV геногруппы II 128, 161. участок полимеразы) были обнаружены в этом анализе. Точно так же анализ обнаружения антигена, в котором используются гипериммунные сыворотки, индуцированные до VLP rMX, наиболее эффективен для обнаружения NLV геногруппы II, которые наиболее тесно связаны с MX, и не обнаруживает вирусы геногруппы I и 104, 121.Например, анализ с использованием гипериммунной сыворотки, индуцированной VLP rMX, не обнаруживает в образцах стула NLV GRV геногруппы II, и, наоборот, анализ с использованием гипериммунной сыворотки, индуцированной VLP rMX, не обнаруживает MX в стуле 102. Эти анализы также не обнаруживают SLV. Таким образом, отсутствие ИФА, широко реагирующего с рядом HuCV, ограничивает полезность этих анализов. Применительно к образцам в эпидемиологических исследованиях (таблица) положительные образцы кала редко выявлялись с помощью этих анализов в большинстве исследований 43, 118, 127, 193, 199, 213, 228, 254.В нескольких отчетах о вспышках ИФА для обнаружения антигена был положительным более чем в 20% протестированных образцов 146, 167. При использовании нескольких анализов результаты были лучше, но остается неясным, сколько отдельных анализов потребуется для подтверждения выявление большинства калицивирусов человека. ИФА с использованием поликлональных сывороток еще не имеется в продаже. Таблица 4положительный / нет. Образцов проверены (% положительный) ссылки экспериментальная человеческая инфекция U.S. NV RNV 35/41 (85) 79 RMX 0/8 (0) (0) 121 RGRV 0/5 (0) 102 U.S. SMA RNV 0/8 (0) 121 RMX 2/8 (25)  U.S. HV RNV 0/8 (0) 121 RMX RMX 1/8 (13) Эпидемиологические исследования спорадических случаев гастроэнтерита Kenya Kenya RNV 1/1186 (<0.1) 193 RMX 0/286 (0) Индия RGRV 7 / 80 (8.8) 132 Япония / Юго-Восточная Азия RNV (0,6) 1999 RNV 2/155 (1.3) 118 RMX 1/155 (0,6) Mexico RNV 0/54 (0) 127 Южная Африка RNV 0/1296 (0) 254 rMX 9/1296 (0.7) RNV 5/276 (1.8) 228 RMX 12/275 (4.3) U.k. RNV 0 / 187 (0) 43 0/260 (0) 42 RMX 1/260 (0.5) Venezuela RNV 4/1120 (0.4) 213 эпидемиологические исследования вспышек гастроэнтериита Япония / Юго-Восточная Азия RNV 2/42 (4.8) 118 RMX 3/42 (7.1) Южная Африка RNV 1/3 (33) 255 RMX 0/3 (0) U U .K. RMX 25/109 (23) 167 RNV 0 / Unsited (0) 42 RMX 15/192 (8)  U.S.

Моноклональные антитела (MAb) были получены с использованием нативных NV, нативных SMA и rNV VLP 110, 113, 239.Подобно тому, что наблюдалось с поликлональными сыворотками, эти MAb часто являются типоспецифичными, распознающими капсидный белок иммунизирующего вируса, но не других NLV. MAb были оценены в ограниченных исследованиях для обнаружения вируса в образцах стула. В одном формате анализа использовался пул из двух MAb для захвата антигена, а также для обнаружения антигена. Детекторные антитела были конъюгированы с пероксидазой хрена. Сообщалось, что этот анализ имеет в два раза большую чувствительность (измеряемую по количеству обнаруженного вируса), чем анализы с использованием поликлональных сывороток, обнаруживает НВ в 15 из 15 образцов стула от субъектов, инфицированных НВ, и не обнаруживает ВГВ ни в одном из девяти образцов стула. образцы от инфицированных субъектов 113.

В отдельном исследовании панель из 10 различных моноклональных антител использовали для захвата антигена, а обнаружение антигена проводили с использованием поликлональной антисыворотки морских свинок против NV и козьего иммуноглобулина против морских свинок, конъюгированного с пероксидазой хрена. Все 10 MAb, протестированных в этом исследовании, были способны захватывать NV 110. Впоследствии эти MAb использовали в конкурентных ИФА для картирования эпитопов, распознаваемых на капсиде VLP rNV 107. Было идентифицировано от шести до восьми различных эпитопов, покрывающих пять неперекрывающихся областей капсидного белка. .Три MAb (NV3901, NV3912 и NV2461) распознавали один эпитоп, а также захватывали VLP вируса Чиба, полученные из вируса геногруппы I с 75% аминокислотной идентичностью NV по всему капсиду. Когда NV3901 использовали в качестве захватывающего антитела в ИФА для обнаружения антигена с поликлональным детекторным антителом, вирусы геногруппы I были обнаружены в 9 из 15 образцов фекалий (положительных ОТ-ПЦР), причем положительные результаты представляли четыре из пяти генетических кластеров геногруппы I (на основе капсидную последовательность). Аминокислотная идентичность вирусов геногруппы I варьировалась от 63 до 70% по всей последовательности капсида по сравнению с NV.Один генетический кластер, не обнаруженный с помощью EIA, имел самую низкую (63%) аминокислотную идентичность с NV 107. Это первое сообщение о перекрестно-реактивных эпитопах на NLV. Считалось, что отсутствие обнаружения вируса во всех образцах с помощью ИФА антигена связано с различиями в концентрации вируса в тестируемых образцах, при этом ОТ-ПЦР имеет большую чувствительность, чем ИФА для обнаружения антигена, или с генетической изменчивостью среди генетических кластеров НЛВ геногруппы I. 107. Описание общего эпитопа для вирусов геногруппы I оставляет открытой возможность того, что аналогичный общий эпитоп может присутствовать в вирусах геногруппы II.Если все NLV содержат один или ограниченное количество общих эпитопов, станет возможной разработка широкореактивного метода ИФА для обнаружения антигена. Такие анализы желательны, потому что большое количество образцов может быть протестировано быстро и экономично. В качестве альтернативы ИФА геногруппы I можно комбинировать с одним или несколькими ИФА геногруппы II с меньшей широкой реактивностью для обнаружения вируса в образцах стула. Такой подход с использованием rGRV EIA для вирусов геногруппы II выгодно отличался от результатов, полученных с помощью RT-PCR при оценке образцов, собранных на юге Индии 132.

Обнаружение антител

ИФА с VLP. Производство VLP для NV и других NLV позволило выявить иммунный ответ на заражение этими вирусами. В этих анализах VLP используются для покрытия 96-луночных титрационных микропланшетов, и после этапов блокирования и промывки добавляются серийные разведения сыворотки человека. Антитела, реагирующие с VLP, выявляют с помощью козьего античеловеческого иммуноглобулина, конъюгированного с ферментом (например, пероксидазой хрена или щелочной фосфатазой).Анализ может обнаруживать общие или класс- или подкласс-специфические сывороточные антитела, в зависимости от реагентов, используемых для обнаружения связанных антител человека 80, 116, 130, 240. Анализ также был модифицирован для обнаружения NV-специфического IgA в образцах фекалий 203

Для определения количества вирусспецифических антител в образце сыворотки использовались два различных подхода. Подход, используемый большинством лабораторий, заключается в выполнении серийного разведения образца сыворотки и определении последнего разведения, которое дает показания выше эмпирически определенного порогового значения 28, 41, 105, 116, 163.Второй подход заключается в измерении количества сигнала (например, оптической плотности) от одного разведения сыворотки и сопоставлении измеренного сигнала с сигналом, измеренным с использованием стандартной эталонной сыворотки 127, 189, 195, 207. Преимуществами последнего метода являются что он позволяет тестировать большее количество сывороток, а его выполнение проще и дешевле. Однако практические и теоретические проблемы ограничивают полезность тестирования одного разведения сыворотки. Практическая проблема заключается в том, что хорошо охарактеризованные стандартные сыворотки, которые можно использовать в качестве эталонных реагентов, обычно недоступны, поэтому большинство лабораторий не могут проводить такие анализы.Теоретическая проблема заключается в том, что на измерение сигнала при однократном разведении влияет множество факторов, помимо количества антител, присутствующих в образце, включая аффинность антител в образце к тестируемому антигену и изменчивость компонентов сыворотки, которые могут влиять на антиген. -взаимодействия антител. Таким образом, хотя определение антител с использованием одного разведения сыворотки использовалось как в исследованиях серопревалентности 127, 207, так и в других эпидемиологических исследованиях 195, большинство лабораторий определяют количество вирусспецифических антител в сыворотке с помощью титрования конечной точки 28, 41, 105, 116, 163.

ИФА для обнаружения антител на основе VLP более чувствителен, чем анализы с использованием человеческих реагентов в форматах RIA, блокирующего EIA или IEM 88, 189. Общие уровни антител против NV от 1,25 до >40 раз выше при использовании анализ rNV VLP EIA, чем те, которые получены с использованием RIA или блокирующего EIA. Применительно к сыворотке от экспериментальной инфекции человека или шимпанзе и от вспышек гастроэнтерита, ИФА rNV VLP выявляет четырехкратное или большее увеличение уровней сывороточных антител чаще, чем ИЭМ, и, по крайней мере, так же часто, как РИА и блокирующий ИФА 88, 189.ИФА антитела rNV VLP идентифицировал инфекцию после экспериментального заражения человека лучше, чем ИФА обнаружения антигена, выявляя 40 из 41 (98%) инфекций по сравнению с 36 из 41 (88%) инфекций 79. Анализы с использованием других VLP, включая rMX, rTV, rHV , вирус rСаутгемптона и rLV также были разработаны 127, 195, 206.

ИФА для обнаружения антител использовался для характеристики серологических реакций IgG, IgM и IgA после экспериментального заражения человека вирусом NV 80. Восемь из 13 инфицированных субъектов имели увеличение уровней вирусспецифических антител в четыре или более раз между 8 и 11 днями после заражения; у больных субъектов (восемь из девяти) эти ранние ответы были более вероятными, в то время как повышение уровня антител наблюдалось у бессимптомных субъектов только через 15 дней.У всех инфицированных субъектов ( n = 14) вырабатывались вирусспецифические сывороточные антитела IgM. Вирусоспецифические сывороточные антитела IgM присутствовали уже через 9 дней после заражения, но у некоторых субъектов они не развивались до 2 недель после заражения. Сывороточные антитела IgM все еще могут быть обнаружены через 3 месяца у некоторых субъектов. Четырехкратное или более увеличение сывороточных вирусспецифических антител IgA было обнаружено при всех девяти симптоматических инфекциях, но только в двух из пяти бессимптомных инфекций. Вирусоспецифические средние геометрические уровни антител в сыворотке инфицированных и неинфицированных субъектов были одинаковыми через 3 месяца после контрольного заражения 80.Кинетика ответов IgM и IgA аналогична наблюдаемой в более ранних исследованиях с использованием человеческих реагентов 64, 65. Наличие ни вирусспецифических сывороточных IgG, IgM или IgA, ни фекальных IgA не связано с защитой от инфекции 80, 203 , 240. Низкие уровни антител в сыворотке, по-видимому, связаны со сниженной вероятностью инфекции после экспериментального заражения человека и естественного воздействия 79, 226.

Вирусспецифические сывороточные антитела IgM также были обнаружены с помощью анализа захвата IgM.В этом анализе козий античеловеческий IgM используется для покрытия микротитровальных планшетов, а затем наносятся разведения тестируемой сыворотки. VLP добавляют на следующем этапе, и VLP, связанные с вирус-специфическим IgM, выявляют с использованием гипериммунной анти-NV кроличьей сыворотки 240. Альтернативный метод использует вирус-специфические MAb для обнаружения VLP 28. Уровни антител в четыре-восемь раз выше при использовании анализ захвата IgM по сравнению с анализом, в котором обнаруживаются IgM, связанные с VLP 240. В двух разных исследованиях после экспериментального инфицирования человека анализы захвата IgM выявили ответы IgM у 15 из 15 и 14 из 15 субъектов, при этом инфекция была подтверждена четырехкратным или более IgG ответы 28, 240.

Обнаружение инфекции, вызванной гетеротипическими HuCV.

Серологические ответы, измеренные с помощью ИФА для обнаружения антител на основе VLP, были охарактеризованы с использованием сывороток, собранных во время исследований экспериментальных инфекций человека и во время оценки вспышек гастроэнтерита. Гетерологичные ответы rNV IgG возникают после экспериментального инфицирования человека HV или SMA, хотя они присутствуют с более низкой частотой и величиной, чем наблюдаемые после заражения NV 240 или когда в анализе используются rMX (SMA-подобные) VLP 206.Гетерологичные IgG-ответы к rHV также могут быть продемонстрированы после инфекции NV 41. Результаты аналогичны результатам, полученным с использованием человеческих реагентов при блокировании ИФА, хотя гетерологичные серологические ответы, измеренные с помощью более старых и новых анализов, наблюдались у разных субъектов 177, 240. Гетерологичные серологические ответы, по-видимому, быть ограничено субъектами, которые также имеют серологический ответ IgG на гомологичный вирусный антиген и которые больны. Гетерологичные ответы IgM и IgA встречаются нечасто 240.

Аналогичные результаты были получены, когда эти анализы были применены к сыворотке, собранной во время расследований вспышек 28, 105, 195, 206.Ответы IgG возникают с более высокой частотой и амплитудой, когда в анализе используются VLP, которые более тесно связаны со штаммом, вызвавшим вспышку 105, 195. Noel et al. 195 обнаружили гомологичный IgG-сероответ на VLP rNV, когда инфицирующий NLV представлял собой NLV геногруппы I с 38,5% расхождением аминокислот с NV в области капсида. Напротив, гомологичные сероответы наблюдались для NLV геногруппы II только тогда, когда расхождение аминокислот с тестируемым антигеном составляло менее 6,5%. В целом, вероятность обнаружения сероответа IgG для NLV геногруппы II была наибольшей, когда тестируемый антиген был получен из штамма, тесно связанного с инфицирующим вирусом, меньше, когда тестируемый антиген был получен из неродственного NLV геногруппы II, и наименьшей, когда тест-антигеном был rNV (геногруппа I).Хейл и др. 105 изучили несколько вспышек, вызванных NLV геногруппы II, и обнаружили, что ответы rMX IgM возникали у 14 из 19 (74%) субъектов с сероответом IgG. Ответы IgM возникали чаще, когда вирус вспышки был MX-подобным (9 из 10), чем когда это был неродственный вирус геногруппы II (4 из 9). У четырех из этих субъектов также был сероответ rNV IgG, но ни у одного из них не было сероответа rNV IgM. Бринкер и др. 28 получили аналогичные результаты, применяя ИФА rNV и rMX IgM к вспышкам геногруппы I и геногруппы II.У 24 из 25 субъектов, инфицированных вирусами геногруппы I, были ответы rNV IgM, в то время как только у 3 из этих субъектов были ответы rMX IgM; 28 из 47 субъектов, инфицированных вирусами геногруппы II, имели ответы rMX IgM, в то время как ни у одного из них не было ответов rNV IgM. В совокупности эти результаты показывают, что ответы IgM могут предоставить данные о геногруппе вируса, вызывающего инфекцию.

ИФА для обнаружения антител использовались в исследованиях серопревалентности и в лонгитюдных исследованиях приобретения антител 41, 54, 70, 82, 116, 118, 127, 163, 190, 193, 199, 204, 206, 207, 213, 227 , 228, 236.Эти исследования подтвердили и расширили результаты, полученные с использованием человеческих реагентов, показывающие, что NLV вызывают инфекцию во всем мире, а серопревалентность увеличивается с возрастом. Новые данные включают серологические данные о НЛВ-инфекции, встречающейся у детей раннего возраста в развитых странах, которая не была выявлена ​​в ранних исследованиях 163, и трансплацентарной передаче НЛВ-специфических антител от матери к ребенку 41, 118, 199, 206, 228. показатели варьировались между регионами внутри страны, между странами и в зависимости от антигена VLP NLV, используемого в анализе.

Обнаружение нуклеиновых кислот

Анализы на обнаружение нуклеиновых кислот представляют собой третью группу новых анализов, которые были разработаны в последнее десятилетие после клонирования генома NV. Знание последовательности генома NV привело к разработке праймеров из области полимеразы, которые были способны амплифицировать фрагменты других NLV и SLV, что привело к секвенированию полных геномов многих HuCV. Хотя было несколько сообщений об использовании анализов гибридизации, основным методом обнаружения нуклеиновых кислот, который используется, является ОТ-ПЦР.ОТ-ПЦР в настоящее время используется во всем мире из-за отсутствия коммерчески доступного широкореактивного ИФА. Оба подхода к диагностике обнаружения нуклеиновых кислот будут обсуждаться ниже.

Анализы гибридизации.

Для обнаружения HuCV было описано лишь несколько анализов гибридизации. Скорее всего, это связано с доступностью более чувствительных анализов ОТ-ПЦР в то время, когда впервые стали доступны кДНК для HuCV. Цзян и др. 129 описали анализ гибридизации с использованием 32 P-меченых кДНК, охватывающих ту же область генома, которая была амплифицирована в анализах ОТ-ПЦР.Суспензии стула (от 10 до 50%) экстрагировали трихлортрифторэтаном, а вирусные нуклеиновые кислоты частично очищали от водной фазы расщеплением протеиназой К, экстракциями в фенол-хлороформе и хлороформе и осаждением в этаноле. Гибридизационный анализ выявлял НВ с чувствительностью, аналогичной РИА, но обнаруживал в 100 раз меньше вирусной РНК и обнаруживал вирус в образцах стула на 27% реже, чем анализ ОТ-ПЦР, примененный к тем же образцам. Таким образом, анализ гибридизации не смог обнаружить NV, когда в образце стула присутствовали низкие титры вируса 129.

Также был описан гибридизационный анализ с использованием меченого дигоксигенином зонда кДНК, полученного из полимеразной области вируса Саппоро 150. Вирусные нуклеиновые кислоты были частично очищены, как описано выше, и на точку можно было обнаружить приблизительно 10 5 вирусных частиц. Этот уровень обнаружения ниже, чем от 1 × 10 4 до 2 × 10 4 частиц, обнаруживаемых с помощью РИА и ИФА, специфичных для вируса Саппоро. Интерпретации результатов испытаний также мешала колориметрическая система обнаружения.Некоторые образцы стула дали ложноположительные результаты из-за цвета стула или неспецифического связывания зонда с веществами в стуле. Проблема ложноположительных результатов была решена путем включения в анализ ДНК вектора, меченного дигоксигенином (pBR322), в качестве отрицательного контроля. Интенсивность сигнала, полученного с вирусспецифическим и контрольным зондами, сравнивали с эталонными точками, содержащими 10-кратные серийные разведения кДНК вируса Саппоро, и положительными образцами считались те, в которых реакция с вирусспецифическим зондом была сильнее, чем с контрольным зондом.

Для оценки 100 образцов стула, в которых с помощью электронной микроскопии были обнаружены вирусы HuCV, был использован дот-блот-анализ, специфичный для вируса Саппоро. Восемь из 10 образцов, которые дали положительный результат с помощью SLV/Sapporo/82 EIA, были положительными при анализе дот-блоттинга, а дополнительные 13 образцов были отрицательными с помощью EIA и положительными при дот-блот-гибридизации. Семьдесят семь образцов были отрицательными по обоим тестам. Исследователи предположили, что улучшенная чувствительность анализа гибридизации дот-блоттинга по сравнению с ИФА могла быть связана с большей консервативностью последовательности среди SLV в полимеразной области (нацеленной в дот-блот-анализе), чем в области капсида (нацеленной на анализ ИФА) или на присутствие в образцах стула веществ, оказывающих большее ингибирующее действие на ИФА, чем на анализы дот-блот-гибридизации.Потенциальным преимуществом анализа дот-блот-гибридизации по сравнению с анализами ОТ-ПЦР является более низкая стоимость анализа и меньший риск перекрестного загрязнения. Тем не менее, анализы ОТ-ПЦР были основным методом обнаружения нуклеиновых кислот, используемым для диагностики инфекций HuCV.

ОТ-ПЦР.

Первые тесты ОТ-ПЦР были описаны в течение 2 лет после первоначального сообщения об успешном клонировании генома NV 53, 129. С тех пор был разработан ряд различных форматов анализов ОТ-ПЦР, и эти анализы стали одним основных средств диагностики инфекций HuCV.На чувствительность и специфичность анализа ОТ-ПЦР может влиять ряд факторов, в том числе анализируемый образец, метод, используемый для очистки вирусных нуклеиновых кислот, праймеры, используемые при амплификации, и метод, используемый для интерпретации результатов теста. Подходы к решению каждого из этих факторов обсуждаются ниже.

(i) Методы извлечения.

Клинические образцы часто содержат вещества, которые могут ингибировать ферментативную активность ферментов обратной транскриптазы и ДНК-полимеразы, используемых в анализах ОТ-ПЦР.Таким образом, обычно необходимо частично очистить вирусные нуклеиновые кислоты или иным образом подготовить образец перед выполнением анализа ОТ-ПЦР. Двумя основными факторами при выборе метода выделения являются его эффективность извлечения вирусных нуклеиновых кислот и его способность удалять или инактивировать ингибиторы ОТ-ПЦР. Второстепенные соображения включают простоту выполнения метода и количество образцов, которые могут быть обработаны за один раз. Сообщалось о ряде различных подходов к очистке вирусных нуклеиновых кислот из образцов стула.Те, которые использовались для обнаружения HuCV, показаны в таблице.

Таблица 5

МЕТОДЫ УДАЛЕНИЯ 5

УПРАВЛЕНИЯ ДЛЯ ПОДГОТОВКИ КЛИНИЧЕСКАЯ ОБРАЗЦОВ для RT-PCR

94, 219, 119
Способ
Список литературы
Capture антитело 74, 219
Хеляция многовалентных катионов. 103, 119
Исклюкционная хроматография 53, 103
Гуанидиние-фенол-хлороформ + выпадение алкоголя 63, 232
GTC-Silica 3, 101
Тепловая релиз 32, 221
ПЭГ-ЦТАБ 103, 129

Jiang et al.129 оценили ряд различных методов удаления ингибиторов. Готовили суспензии образцов стула (от 10 до 50%), и суспензию экстрагировали трихлортрифторэтаном перед дальнейшей обработкой. Фенол-хлороформная экстракция, нагревание и диализ оказались неэффективными для удаления ингибирующих веществ, присутствующих в образцах стула, а хроматография образца на олиго(dT)-целлюлозе была описана как неэффективная. Добавление бромида цетилтриметиламмония (ЦТАБ) после концентрирования путем осаждения полиэтиленгликолем (ПЭГ) и расщепления протеиназой значительно улучшало сигнал, полученный после ОТ-ПЦР, и этот метод использовался в ряде последующих исследований ОТ-ПЦР HuCV 43, 127, 146, 159, 161, 188, 248, 255.Ингибиторы могут сохраняться в некоторых образцах, экстрагированных методом PEG-CTAB. Шваб и др. 221 и Хейл и др. 103 обнаружили, что примерно 13% (6 из 45) и 19% (7 из 36) извлеченных образцов, соответственно, все еще содержат ингибиторы, которые могут препятствовать обнаружению вирусных нуклеиновых кислот.

Модификации метода выделения РНК Хомчински и Сакки 39 успешно использовались для выделения вирусной РНК из образцов стула 63, 232. экстракцией хлороформом и осаждением нуклеиновых кислот в спирте.Основной реагент коммерчески доступен от ряда поставщиков (RNAzol, Ultraspec и TRIzol). Вариант процедуры экстракции на основе GTC был описан Boom et al. 26, в котором буфер, содержащий GTC, используется для высвобождения вирусной РНК из вирусного капсида. Вирусную РНК адсорбируют на фракционированных по размеру частицах кремнезема и последовательно промывают вторым GTC-содержащим буфером, 70% этанолом и ацетоном. Затем вирусную РНК элюируют с частиц кремнезема водой.Другие варианты также были успешно использованы 3, 101. Сообщалось, что метод GTC-силикагель довольно успешно удаляет ингибиторы ПЦР в двух сравнительных исследованиях, показывая лучшие результаты, чем метод PEG-CTAB, в обнаружении NLV 103 и приблизительно эквивалентен PEG-CTAB для обнаружения вируса гепатита А в образцах стула 8.

Эксклюзионная хроматография с использованием спин-колонок, содержащих сефадекс G200, была одним из первых методов, используемых для выделения вируса из образцов стула 53.Хотя этот метод является чувствительным, он непостоянен при удалении ингибиторов из клинических образцов. Неожиданно НЛВ могут быть обнаружены с помощью ОТ-ПЦР в образцах стула после простого нагревания образца до 95–99°C в течение 5 минут [32, 221]. высвобождение вирусной РНК.Перед процедурой выделения тепла от 10 до 20% суспензий образцов фекалий осветляют и экстрагируют трихлортрифторэтаном или гранулируют через подушку из 45% (вес/объем) сахарозы. Образцы, обработанные трихлортрифторэтаном, должны быть разбавлены в 100 раз, поскольку амплификация подавляется в большинстве образцов при более низком разведении 221.

Захват антител использовался для очистки вируса до амплификации 74, 219. Вирусоспецифические антитела связываются в 96-луночном планшете или на парамагнитных шариках до контакта с образцом, содержащим вирус.После периода инкубации, чтобы обеспечить захват антигена, лунки или шарики многократно промывают для удаления ингибиторов и других веществ. Затем вирусная геномная РНК высвобождается из капсида при нагревании. Этот метод хорошо зарекомендовал себя в отношении вируса гепатита А, но его использование для обнаружения HuCV ограничено. Основная причина, по которой этот метод не изучался в дальнейшем, заключается в отсутствии антисывороток с высоким титром, которые реагируют с широким спектром NLV. Тем не менее, Шваб и соавт. 219 смогли использовать препараты иммуноглобулина человека в качестве источника антител для обнаружения NLV в образцах воды, в которых вирусы были сконцентрированы путем фильтрации и осаждения ПЭГ.Поликлональные гипериммунные сыворотки животных также соединяли с парамагнитными гранулами и использовали для очистки NV из образцов фекалий перед амплификацией ОТ-ПЦР. чем другие протоколы обработки. По мере появления широко реагирующих антисывороток, вероятно, будут проведены дальнейшие исследования этого метода экстракции.

(ii) Выбор грунтовки.

Чувствительность и специфичность ОТ-ПЦР в значительной степени зависят от выбора праймера.На способность пары праймеров обнаруживать данный штамм NLV или SLV влияет несколько факторов, включая последовательность праймеров, количество вируса, присутствующего в анализируемом образце, и температуру, используемую для отжига праймеров в процессе ПЦР-амплификации. Генетическое разнообразие NLV и SLV затрудняет выбор одного набора праймеров с адекватной чувствительностью и специфичностью для обнаружения всех NLV. В целом области генома с наибольшей степенью консервативности между штаммами внутри родов и внутри геногрупп были выбраны для амплификации и создания праймеров (рис.А). Но даже внутри этих областей идентичность нуклеотидов может составлять от 36% (область геликазы 2C) до 53% (область полимеразы 3D) между штаммами разных геногрупп 5, 43, 182, 197, 245, 248, 255, 256. Внутри геногруппы NLV наблюдается большая консервативность, но идентичность нуклеотидов между штаммами может составлять всего 60–64% 245. Эти наблюдения привели к разработке и использованию наборов праймеров, нацеленных на несколько областей вирусного генома (рис. . Стол ).

(A) Схематическое изображение генома калицивируса и областей, амплифицированных обычными парами праймеров.Изменено по ссылке 220 с разрешения Technomic Publishing Co, Inc., авторское право 2000 г. Дополнительные сведения о последовательностях праймеров см. в таблице. хель, геликаза; пол, полимераза. (B) Схематическое изображение генома NLV, из которого был сделан внутренний стандартный контроль для NLV геногруппы I. Относительное расположение выбранных праймеров и зондов указано для вируса и внутреннего стандарта (Int. Std.) РНК. Внутренний стандарт контрольной РНК дает ампликоны, которые на 123 п.н. короче (347 п.н.), чем ампликоны из геномной РНК NV (470 п.н.).Часть геномной последовательности, на которую нацелены вирусспецифические зонды (например, SR65 и p116), отсутствует в контроле внутреннего стандарта, что позволяет дифференцировать вирусспецифические ампликоны и ампликоны внутреннего стандарта путем гибридизации нуклеиновых кислот 221.

ТАБЛИЦА 6

Обычные Hucv-специфические праймеры, используемые в RT-PCR Анализы

30 GTGAACAGTAACCACTGG 9 0039 3 9 0530 NLVS (GII) 890 CICAATGTAATGATGG (C / T) TGGGT
Primer ДНК-последовательность (5 ‘до 3’) Геномное место A Sense Вирусы амплифицировали B Ссылка
p78 GGGCCCCCTGGTATAGGTAA 1682-1701 (2C хеликаза) + NLVs (GI & GII) 248
р80 TGGTGATGACTATAGCATCAGACACAAA 1943-1970 (2C хеликаза) NLV (GI и GII) 248
N49(+) CACCACCATAAACAGGCTG 2215–223 3 (2C Helicase) + + 181
N49 (-) N49 (-)0 agcctgatagagcattctttt0 2419-2438 (2C Helicase)0 NLVS (GI) 181
p36 ATAAAAGTTGGCATGAACA 4487-4505 (3D-полимеразы) + NLVs (GI & GII), КРН 248
Sapp36 GTTGCTGTTGGCATTAACA 4487-4505 (3D-полимеразы) + КРН 180
JV12 ATACCACTATGATGCAGATTA 4552-4572 (3D-полимераза) + NLVs (GI & GII) 246
P290 GATTACTCCAAGTGGGACTCCAC 4568 –4590 (3D-полимераза) + NLV (GI и GII), SLV 125
p3 GCACCATCTGAGATGGATGT 9 0040 4685-4704 (3D-полимераза) + + 188
P69
P69
P690 GGCCTGCCATCTGATTGATTGCCCCCCCCCCCES0 4733-4752 (3D-полимераза) + NLVS (GI & GII ), КРН 248
SR46 TGGAATTCCATCGCCCACTGG 4766-4786 (3D-полимераза) + NLVs (GI & GII)
SR48 GTGAACAGCATAAATCACTGG 4766-4786 (3D-полимераза) + + 3
3
SR50
0 4766-4786 (3D Polymerase) + + 3
SR52
SR52 GTGAACAGTAACACCATTGG0 4766-4786 (3D Polymerase) + + 3
NI GAATTCCATCGCCCACTGGCT 4768-4788 (3D-полимераза) + NLVs (GII) 83
JV13 TCATCATCACCATAGAAAGAG 4858-4878 (3D-полимераза) NLVs (GI & ИГН ) 246
E3 E30 ATCTCATCATCACATA 4865-4881 (3D Polymerase) 83
NVP1100 AC (A / T / G) AT (C / T) TCATCATCACATA0 4865-4884 (3D полимераза)0 NLV (GI & GII), SLVS 159
P2890 TGACAATGTAATCATCACATA 4865-4886 (3D полимераза)0 NLVS (GI & GII), SLVS 125
SR330 TGTCACGATCATCATCACCCC0 4868-4888 (3D-полимераза) NLVS (GI & GII)
р51 GTTGACACAATCTCATCATC 4871-4890 (3D-полимераза) NLVs (GI & GII) 188
р35 CTTGTTGGTTTGAGGCCATAT 4936-4956 (3D-полимеразы) NLVs (GI & GII), КРН 248
Sapp35 GCAGTGGGTTTGAGACCAAAG 4936-4956 (3D-полимераза) КРН 20
ИСН-2 AAATGATGATGGCGTCTA 5356-5373 (CAPSID) +0 NLVS (GI) 101
Mon381
Mon3810 Ccagaatgtacaatggttatgc0 5362-5383 * (CAPSID) +0 NLVS (GII) 195
CapIIa CIAGAATGTAIAA(C/T)GG(G/T)TATGC 5362–5383 * (капсид) + 89
Capiib TGIIAGAAIT (A / G) TTICI (A / G) ACATC (A / T) GG 5559-5584 * (CAPSID) NLVS (GII) 89
CAPIA
0 5647-5668 (CAPSID) + +0 NLVS (GI) 89
SRI-1 CCAACCCA (A / G) CCATT (A / G) TACAT 5652-5671 (CAPSID)0 NLVS (GI) 101 101
Mon383 CAagagactgtgaagacatcatc 5661-5683 * CAPSID)0 NLVS (GII) 195
CAPIB
CAPIB TGIIA (A / G) Agiacattici (A / T) ACATC (C / T) TC 5844-5869 (CAPSID) NLV (GI) 89

Большинство праймеров предназначены для усиления определить наиболее консервативную область генома, РНК-зависимую РНК-полимеразную область 3, 20, 83, 125, 159, 180, 188, 220, 248.Хотя было описано несколько пар праймеров, те, что описаны Ando et al. 3, Грин и др. 83, и Le Guyader et al. 159 были наиболее часто используемыми (рис. A, таблица). Андо и др. 3 описан мультиплексный подход, при котором кДНК создается с использованием одного праймера (SR33) для инициации обратной транскрипции, а в процессе амплификации используются четыре дополнительных праймера: три (SR48, SR50 и SR52) для амплификации NLV геногруппы I и один (SR46). ) для амплификации вирусов геногруппы II. Грин и др.83 описали другую пару праймеров (E3 и NI) для амплификации NLV группы II, а Le Guyader et al. 159 описали вырожденный праймер (NVp110), который может инициировать синтез кДНК групп I и II NLV и некоторых SLV. Одна из проблем, связанных с парами праймеров геногруппы II (NVp110/NI и SR33/SR47), которые амплифицируют участок полимеразы, заключается в том, что из амплифицированных продуктов можно получить только от 76 до 81 уникального основания данных о последовательности. Цзян и др. 125 недавно описали пару праймеров, P289 и P290, которые будут амплифицировать NLV и SLV геногрупп I и II, давая продукты ОТ-ПЦР, из которых можно получить почти 300 уникальных оснований данных последовательности.Последовательность праймера P289 идентична праймерам NVp110 и E3 в 12 нуклеотидах на 3′-конце праймера; 5′-конец отличается тремя нуклеотидами и на два основания длиннее, чем NVp110, и на пять оснований длиннее, чем E3. Эти данные свидетельствуют о том, что NVp110, E3 и P289, 3′-концы которых являются обратным дополнением вирусного генома в сайте мотива YGDD РНК-зависимой РНК-полимеразы, могут успешно запускать синтез кДНК для большого количества NLV и SLV. Иногда праймеры, разработанные на основе последовательности локально циркулирующего штамма, работали лучше, чем другие пары праймеров 217.Для специфической амплификации SLVs20, 180, 244, 256 также описаны другие праймеры. и ORF3 53, 89, 101, 181, 188, 195, 248. Наиболее распространенной причиной нацеливания на другую область генома является получение дополнительных данных о последовательности, которые могут быть полезны для различения или идентификации уникальных вирусных штаммов. С этой целью был описан анализ ОТ-ПЦР, который амплифицирует 3′-конец вирусного генома 4.В целом, анализы с использованием праймеров для амплификации неполимеразных областей вирусного генома менее широко реактивны (амплифицируют меньшее число штаммов вируса из-за большего генетического разнообразия в этих областях) или требуют присутствия большего количества вируса в образце. например, для амплификации ∼3 т.п.н. вирусного генома).

Сообщалось об очень небольшом количестве исследований, в которых описывается количество вирусного генома, которое должно присутствовать, чтобы пара праймеров могла обнаружить вирус 159. Вместо этого в большинстве исследований сообщается только о том, может ли пара праймеров обнаружить штамм вируса без учета количество вируса, присутствующего в образце.Однако успешное обнаружение вируса может быть повышено при наличии большего количества вируса. Например, Le Guyader et al. 159 отметили 10–1000-кратные различия в количестве нескольких штаммов NLV, которые можно было обнаружить с помощью двух пар праймеров, NVp110/p36 и NVp110/p69. Другими словами, когда присутствует большое количество штамма вируса, обе пары праймеров могут успешно его обнаружить, но когда присутствует небольшое количество штамма, только одна пара праймеров позволяет успешно обнаружить вирус.Причиной различий в обнаружении вирусов является гомология праймеров, при этом праймеры с более низкой гомологией требуют присутствия большего количества вируса для успешной амплификации. Другим подходом, используемым для повышения шансов на успешную амплификацию, было снижение температуры отжига праймеров до 37°C 248. Недостаток этой стратегии заключается в повышении вероятности образования неспецифических ампликонов и может увеличить количество вируса, который должны присутствовать в образце для успешного обнаружения вируса.

Использование вложенной или полувложенной ПЦР — еще один метод, который использовался для повышения вероятности обнаружения NLV 84, 200, 234. В этом подходе используется два раунда амплификации ПЦР с использованием одного (полувложенная) или обоих (вложенных) праймеров. во втором раунде амплификации нацеливается на область генома внутри той, на которую нацелены праймеры, использованные в начальной амплификации. Сообщалось, что эта стратегия в 10–1000 раз более чувствительна, чем одноэтапная ОТ-ПЦР 84, а также использовалась для обнаружения присутствия нескольких вирусных штаммов в одном образце 200, 234.Однако основным недостатком этого подхода является повышенная и очень реальная вероятность того, что между образцами может произойти перенос контаминации.

(iii) Другие условия ПЦР.

Условия (например, концентрация магния и температура отжига праймеров) анализа ОТ-ПЦР частично определяются используемыми праймерами. Сообщалось также об использовании различных ДНК-полимераз в процессе амплификации ПЦР. Андо и др. 4 использовали комбинацию ДНК-полимеразы Taq и ДНК-полимеразы Pwo для амплификации большого (3 т.п.о.) фрагмента вирусного генома.Шваб и др. 222 использовали полимеразу Tth вместо обратной транскриптазы вируса миелобластоза птиц и полимеразу Taq и обнаружили, что обнаружение NV в анализе на основе полимеразы Tth было сравнимо с таковым в двухферментной системе. Использование одного фермента для обратной транскрипции и амплификации ДНК также позволило использовать термолабильную урацил- N -гликолазу (UNG) для предотвращения переноса загрязнения 222. dUTP используется вместо dTTP в RT-PCR, и в реакционную пробирку добавляли (или переносили) дезоксиурацилсодержащие ампликоны, разложившиеся UNG.Затем UNG инактивируется нагреванием, и вирусная РНК амплифицируется.

(iv) Подтверждение продуктов ПЦР.

Для интерпретации результатов метода ПЦР можно использовать ряд методов. Одним из самых простых является гель-электрофорез. Если после электрофореза видна полоса размера, предсказанного по выбору праймера, ПЦР считается положительной. Этот метод использовался для анализов NLV RT-PCR 10, 84, но он может давать ложноположительные результаты 11, 12. Происходит неспецифическая амплификация ДНК, особенно когда используется более 30 циклов амплификации, и неспецифически амплифицированная ДНК иногда мигрируют способом, подобным ожидаемому для вирус-специфических ампликонов.В этом случае неспецифические продукты амплификации могут быть неверно истолкованы как вирусспецифические ампликоны. Такие неспецифические полосы часто наблюдаются после анализа NLV в образцах стула и моллюсков 12. Из-за потенциальных ложноположительных результатов при визуальной интерпретации гелей важно подтвердить специфичность ампликонов вторым методом.

Использование анализа гибридизации, вероятно, является самым простым подходом к интерпретации и подтверждению результатов ПЦР.Анализы гибридизации могут быть организованы различными способами. Наиболее распространенными являются гибридизация дот- или слот-блоттинга, жидкостная гибридизация и гибридизация Саузерн-блоттинга. В этих анализах вирус-специфический зонд метят и гибридизуют с продуктами ПЦР, а также определяют наличие или отсутствие метки. Некоторые из наиболее распространенных этикеток включают 32 P, дигоксигенин и биотин. Одно из ограничений методов гибридизации при применении к анализам ОТ-ПЦР NLV заключается в том, что изменчивость геномной последовательности в NLV затрудняет выбор одного или даже небольшого количества зондов, которые могут обнаружить все возможные последовательности NLV 159.Тем не менее, небольшое количество зондов оказалось эффективным для обнаружения большинства циркулирующих NLV, когда амплифицируемая ДНК была гомологична полимеразной области генома NLV 3, 83, 159. Время, необходимое для проведения анализа гибридизации, может быть укорачивается без потери чувствительности с использованием прямого формата EIA. Вирусспецифические ампликоны захватывают с помощью биотинилированного зонда, закрепленного на покрытом стрептавидином 96-луночном планшете, и гибрид зонд-ампликон выявляют с помощью конъюгата антител против двухцепочечной ДНК (дцДНК) (R.Л. Атмар и К. Дж. Шваб, неопубликованные данные). Стратегия блоттинга с обратной линией — еще один подход, который упростил использование нескольких зондов одновременно и позволил получить как данные о специфичности, так и данные о генетическом родстве (генотипе) HuCV, обнаруженного с эталонными штаммами 247. HuCV амплифицируют с использованием биотинилированных праймеров, а вирусспецифические ампликоны захватываются во время гибридизации одним из множества зондов, которые связаны с мембраной отдельными точками на блоте. Биотинилированные продукты выявляют конъюгатами стрептавидин-фермент.

Секвенирование ДНК продуктов ПЦР является еще одним подходом, используемым для интерпретации результатов ОТ-ПЦР 90, 183. Хотя этот метод является более трудоемким и дорогим, он также дает наибольшее количество информации. Описан упрощенный подход, при котором биотинилированные ампликоны фиксируются на планшете, покрытом стрептавидином, и секвенируются непосредственно с использованием вирусспецифического праймера. эпидемиологические исследования.На способность различать штаммы вируса на основе последовательности вируса влияет длина доступной последовательности и часть генома, из которой получена последовательность. В общем, более короткие последовательности и последовательности, полученные из предполагаемой полимеразной области вирусного генома, менее дискриминативны, чем более длинные последовательности и последовательности, полученные из других областей вирусного генома. Таким образом, следует проявлять некоторую осторожность при использовании информации о последовательности для выявления потенциальных эпидемиологических ассоциаций.Недавним примером, в котором интерпретация данных о последовательности может быть проблематичной, является описание распространения по всему миру Лордсдейл-подобных вирусов в течение 18-месячного периода. Ноэль и др. 196 отметили, что вирусные штаммы с идентичными последовательностями в гене РНК-полимеразы (участок из 81 основания) были обнаружены во многих странах в период с 1995 по 1996 год, а штаммы со сходством нуклеотидов от 95,7 до 100% по участку из 277 оснований в капсидном гене были замечены в разных районах США.Между этими вспышками штаммов не было известных эпидемиологических связей. Тем не менее, данные о последовательности оказались полезными для подтверждения очевидных взаимосвязей между случаями гастроэнтерита, выявленными в эпидемиологических исследованиях, а также продемонстрировали случаи, когда более чем один NLV был ответственен за возникновение заболеваний, которые были связаны в эпидемиологических исследованиях 28, 81, 152. Наконец, , данные о последовательности двух областей вирусного генома позволяют предположить, что некоторые калицивирусы могли развиться путем рекомбинации 109, 123, 218, 245.Такие события могут потребовать анализа более чем одной области генома для характеристики родства циркулирующих вирусных штаммов в эпидемиологических исследованиях 218. Кроме того, событие рекомбинации в области, на которую нацелен праймер или зонд, может привести к появлению нового штамма вируса вирус, который невозможно обнаружить с помощью стандартных комбинаций праймеров или зондов. Понимание механизмов и того, как часто происходит рекомбинация, будет важно при разработке стратегий профилактики или лечения заболеваний.

(v) Внутренний стандарт.

Как отмечалось выше, ингибиторы ОТ и ПЦР могут сохраняться в образцах, несмотря на использование методов экстракции, предназначенных для удаления ингибиторов. Неспособность обнаружить присутствие стойких ингибиторов может привести к ложноотрицательным результатам. Был разработан ряд стратегий для обнаружения ингибиторов в клинических образцах и образцах окружающей среды, которые включают разведение образца, добавление целевой нуклеиновой кислоты к образцу перед амплификации, использование другой пары праймеров для амплификации второй мишени, которая может присутствовать. в образце (т.g., ген домашнего хозяйства) и добавление внутреннего стандартного контроля 221. Разведение образца эффективно только тогда, когда нуклеиновая кислота-мишень присутствует в достаточном количестве, чтобы она сохранялась в образце после удаления ингибиторов путем разведения. Эта ситуация часто наблюдалась в образцах стула, содержащих NLV; ингибиторы обычно удаляются после 100-кратного разбавления образца фекалий 221. Добавление нуклеиновой кислоты-мишени к образцу требует проведения реакций амплификации в двух отдельных пробирках.Хотя эта процедура может обнаруживать ингибиторы, она увеличивает стоимость и может не выявить проблемы с амплификации, которые могут быть уникальными для одной пробирки (например, невозможность добавления реагента в отдельную пробирку). Тем не менее, этот метод использовался для определения персистенции ингибиторов в образцах фекалий, содержащих вирус, после экстракции 103. Использование гена домашнего хозяйства в качестве второй мишени чаще всего применялось к клеточным экстрактам, но этот подход не применялся в анализы для обнаружения HuCV.Оптимальным методом обнаружения ингибирования конкуренции является использование внутреннего стандартного контроля, который амплифицируется теми же праймерами, которые используются для обнаружения целевой вирусной нуклеиновой кислоты, и который можно отличить от целевой вирусной нуклеиновой кислоты 69. Такой внутренний стандартный контроль был разработан для NV 11, 221.

Первоначальный внутренний стандартный контроль, разработанный для NV, представлял собой одноцепочечную РНК, которая дает ампликоны на 25 п.н. короче, чем ампликоны из NV после амплификации с p35 и p36 11.Этот контроль внутреннего стандарта эффективен при обнаружении ингибиторов в образцах моллюсков, анализируемых на присутствие NV 11, 12. Однако для разделения ампликонов, специфичных для контроля внутреннего стандарта и NV, с помощью электрофореза в агарозном геле требуется больше времени из-за их сходства в размера, и продукты не могут быть различимы с помощью зондовой гибридизации. Был разработан внутренний стандартный контроль второго поколения, который давал ампликоны на 123 п.н. короче, чем ампликоны, полученные с помощью NV с праймерами p35 и p36, и этот внутренний стандартный контроль также можно использовать с NVp110 (рис.Б) 221. Кроме того, NV-специфические ампликоны выявляют с помощью зонда, нацеленного на часть генома NV, которая была удалена из внутреннего стандартного контроля, а амплификацию внутреннего стандартного контроля выявляют вторым зондом ( например, SR48) (рис. ). Этот внутренний стандарт оказался очень эффективным в качестве внутреннего положительного контроля при использовании образцов стула и образцов моллюсков 221, 223. Его основным недостатком является невозможность амплифицировать праймеры, специфичные для большинства NLV геногруппы II.При тестировании на эти вирусы образец можно разделить, добавив внутренний стандартный контроль вместе с соответствующими праймерами геногруппы I в одну часть, чтобы определить, присутствуют ли ингибиторы амплификации. Разрабатывается внутренний стандарт для вирусов геногруппы I и геногруппы II (Atmar, неопубликованные результаты).

Представление обнаружения NLV и SLV с помощью RT-PCR с помощью электрофореза в агарозном геле (A) и подтверждение с помощью слот-блот-гибридизации (B). РНК, специфичные для вируса (V) и внутреннего стандартного контроля (IS), видны после амплификации NLV (NV и SMA) и SLV (вирус Саппоро [Sa]) с праймерами NVp110 и p36 или p69.Вирус-специфические ампликоны выявляются зондами SR65 (NV), p117 (SMA) и p153 (вирус Саппоро), а внутренний стандартный контроль выявляется зондом SR48 (3159).

(vi) Нанесение на клинические образцы и образцы из окружающей среды.

ОТ-ПЦР стала основным средством, используемым многими лабораториями для обнаружения NLV и SLV. Наиболее распространенным клиническим образцом, оцениваемым с помощью ОТ-ПЦР, является кал. Преимущество этого анализа состоит в том, что он является как чувствительным (с точки зрения обнаружения небольших количеств вируса), так и широко реактивным (обнаружение большего количества штаммов) по сравнению с ИФА для обнаружения антигена.Хотя более ранние отчеты предполагали, что ИФА для обнаружения антигена для NV имели чувствительность, сравнимую с чувствительностью анализов ОТ-ПЦР79, более поздние отчеты из той же лаборатории с использованием более чувствительного анализа ОТ-ПЦР показали, что последний анализ ОТ-ПЦР более чувствителен, чем анализ ОТ-ПЦР. ИФА для обнаружения антигена 221. Точно так же, когда анализы ОТ-ПЦР и один или несколько ИФА для обнаружения антигена применялись к образцам фекалий в эпидемиологических исследованиях, с помощью ОТ-ПЦР идентифицируется большее количество положительных образцов, чем с помощью ИФА для обнаружения антигена 43, 127, 146, 254.

NLV также были обнаружены в рвотных массах и мазках из зева 85, 184, 200. Препятствиями для применения ОТ-ПЦР к другим образцам были ингибирующие вещества и низкие концентрации вируса, обычно присутствующие в таких образцах, что потребовало разработки дополнительных этапов концентрирования или очистки вируса. Несколько таких анализов были описаны для различных образцов пищевых продуктов, включая мясные деликатесы 224, салаты (салат, дыни и листовая капуста) 78 и моллюски 10–12, 78, 84, 120, 157.Эти анализы были успешно применены для обнаружения NLV в ограниченном числе исследований с участием пищевых продуктов (в основном моллюсков) 157, 158, 234, проб воды 19, 152, сточных вод 173 и других проб окружающей среды (например, мазков, взятых из областей, потенциально заражены больными людьми) 36, 210 связаны со вспышками вирусного гастроэнтерита.

Использование новейших диагностических тестов

Применение новейших диагностических тестов изменило наше понимание эпидемиологии инфекций, вызванных HuCV, особенно NLV.НЛВ в настоящее время признаны основной причиной вспышек небактериального гастроэнтерита, а новые оценки показывают, что они являются наиболее распространенной причиной болезней пищевого происхождения 67, 186, 243. распространенная причина гастроэнтерита у детей раннего возраста, но несколько недавних исследований показали, что NLV уступают только ротавирусам в качестве причины вирусного гастроэнтерита у детей раннего возраста, а исследования серопревалентности показывают, что инфекция у детей раннего возраста в развитых странах является распространенным явлением 25, 82, 163 , 205, 206.Хотя в сообществе одновременно могут циркулировать несколько штаммов, один или несколько штаммов в пределах антигенного кластера могут преобладать 106, 179, 196). Кроме того, было установлено, что продолжительность выделения вируса больше, чем считалось ранее 79, что дает потенциальное объяснение возникновения вспышек пищевого происхождения, прослеживаемых у постсимптомных лиц 209, 252.

Какой подход следует использовать для определения наличия болезни или вспышка связана с инфекцией HuCV? На рисунке представлена ​​схема подхода, который был предложен для сбора и тестирования образцов в условиях вспышки 220.Руководства по сбору данных и образцов были опубликованы ранее 16, 162. Образцы стула и сыворотки должны быть собраны у пораженных лиц как можно скорее после начала клинического заболевания. Хотя вирус, скорее всего, будет обнаружен в стуле, собранном во время болезни, образцы стула, собранные через 1 или 2 недели после начала заболевания, могут все еще содержать вирус, обнаруживаемый с помощью ОТ-ПЦР. VLP можно использовать в ИФА для обнаружения антител для определения наличия вирусспецифических IgM в отдельных сыворотках или повышения общего уровня антител в парных сыворотках (в острой фазе и фазе выздоровления).Анализы IgM, вероятно, будут иметь наибольшую ценность, когда первоначальный образец сыворотки берется более чем через 10 дней после начала заболевания и когда доступен только один образец сыворотки. В настоящее время эти тесты доступны только в ограниченном числе исследовательских лабораторий (обозначены заштрихованной рамкой на рис. ), но есть надежда, что реагенты станут коммерчески доступными. Точно так же ограничена доступность ИФА для обнаружения антигена, но образцы фекалий можно тестировать с использованием гипериммунных сывороток, специфичных к одному или нескольким антигенным кластерам.В случае положительного результата дополнительное тестирование не требуется. Точно так же некоторые специализированные лаборатории могут оценивать образцы стула с помощью электронной микроскопии. Если ИФА для обнаружения антигена или электронная микроскопия недоступны или дают отрицательные результаты, эти образцы следует оценить с помощью анализов ОТ-ПЦР. ОТ-ПЦР в настоящее время является наиболее чувствительным диагностическим методом для обнаружения HuCV, а специфичные для вируса ампликоны можно дополнительно охарактеризовать (например, путем секвенирования), чтобы получить дополнительную информацию об обнаруженном штамме вируса.Вирус стабилен и может быть обнаружен с помощью ОТ-ПЦР в образцах стула, хранящихся при температуре 4°С в течение нескольких месяцев (как минимум) или при температуре -70°С более 10 лет. Способность анализов ОТ-ПЦР обнаруживать вирус, собранный или хранящийся в субоптимальных условиях (например, в бактериальной транспортной среде), неизвестна, но может быть оценена в будущих исследованиях. Потенциальные пути передачи (пища и вода) могут быть собраны и проанализированы с помощью ОТ-ПЦР и секвенирования вирусспецифических ампликонов для установления путей передачи.Анализы ОТ-ПЦР выполняются все большим числом диагностических лабораторий. Таким образом, оборудование, необходимое для проведения таких анализов, более доступно, а реагенты, необходимые для этих анализов, можно приобрести на коммерческой основе.

Схема стратегий оценки для выявления инфекции, вызванной HuCV. После выявления вспышки собираются клинические образцы (сыворотка или кал) и потенциальные пути передачи (например, вода и пища). Образцы стула можно оценить любым из трех методов: электронной микроскопией (ЭМ), ОТ-ПЦР или ИФА.Если ИФА или ЭМ положительны, калицивирусная инфекция подтверждается. Образцы, отрицательные с помощью EIA или EM, а также те, для которых желательна дальнейшая характеристика, могут быть оценены с помощью RT-PCR. Вирусоспецифические ампликоны из образцов стула или пищи и воды можно секвенировать и сравнивать для определения сходства штаммов. Серологические исследования также могут быть выполнены с использованием ряда различных антигенов VLP. Тесты на IgM проводят на одиночных сыворотках, а тесты на IgG проводят на парных сыворотках. Заштрихованные прямоугольники показывают те тесты, которые в настоящее время доступны только в отдельных исследовательских лабораториях.Перепечатано по ссылке 220 с разрешения Technomic Publishing Co, Inc., авторское право 2000 г.

Frontiers | Флувоксамин: обзор механизма его действия и его роли при COVID-19

Введение

Флувоксамин (FLV) изначально использовался для лечения обсессивно-компульсивного расстройства (ОКР). рецептор сигма-1 (S1R) с низким наномолярным сродством (Narita et al., 1996). Агонизм FLV на S1R потенцирует индуцированный фактором роста нервов (NGF) рост нейритов в клетках PC 12 (Nishimura et al., 2008; Ишима и др., 2014). S1R представляет собой белок-шаперон в эндоплазматическом ретикулуме с противовоспалительными свойствами (Ghareghani et al., 2017). Противовоспалительные эффекты FLV, вероятно, связаны с его регуляцией S1R, который модулирует врожденные и адаптивные иммунные реакции (Szabo et al., 2014). S1R также является важным регулятором воспаления, вызванного инозитол-зависимым ферментом 1α (IRE1) (Rosen et al., 2019) (рис. 1).

РИСУНОК 1 . Потенциальные механизмы действия флувоксамина против COVID-19.Рисунок создан с помощью BioRender.

FLV и другие СИОЗС регулируют активность воспалительных цитокинов и экспрессию генов как на клеточных, так и на животных моделях воспаления (Taler et al., 2007; Tynan et al., 2012; Rafiee et al., 2016; Ghareghani et al., 2017; Наджи Эсфахани и др., 2019; Розен и др., 2019). Потенциал FLV ослаблять цитокиновый шторм имеет значение при COVID-19. Тяжесть COVID-19 связана с повышенным уровнем медиаторов воспаления, включая цитокины и хемокины (Chen G.и др., 2020; Чен Н. и др., 2020 г.; Хуанг и др., 2020 г.; Тай и др., 2020). Сообщается, что другие агонисты S1R, такие как флуоксетин, обладают противовирусной активностью (Zuo et al., 2012; Bauer et al., 2019). Эти исследования вызвали интерес к потенциальной терапевтической роли агонистов FLV и S1R при COVID-19 (Vela, 2020; Hashimoto, 2021).

Этот обзор иллюстрирует механизмы действия, лежащие в основе противовоспалительных и противовирусных свойств FLV. Он охватывает доклинические исследования влияния агонистов FLV и S1R на воспаление и обобщает имеющиеся в настоящее время клинические данные о лечении FLV при COVID-19.

Показания к применению флувоксамина

Малеат флувоксамина доступен в виде таблеток с немедленным высвобождением и капсул с контролируемым высвобождением. FLV показан для лечения обсессий и компульсий у пациентов с ОКР. Период полувыведения FLV составляет 9–28 часов в зависимости от его состава, а рекомендуемая доза составляет 100–300 мг/день (FDA, 2012).

Исходный механизм действия

Ингибирование транспортера серотонина

FLV блокирует обратный захват серотонина в натрий-зависимом транспортере серотонина (SERT) мембраны нейронов, усиливая действие серотонина на ауторецепторы 5HT1A (Dell’Osso et al., 2005; FDA, 2012). FLV имеет незначительное сродство к α1-, α2-, β-адренергическим, мускариновым, допаминовым D2, гистаминовым h2, ГАМК-бензодиазепиновым, опиатным, 5-HT1 или 5-HT2 рецепторам (Irons, 2005).

Вероятные механизмы действия при COVID-19

Агрегация тромбоцитов

Тромбоцитам не хватает фермента для синтеза серотонина (Ni and Watts, 2006). SERT обеспечивает быстрое поглощение серотонина из плазмы (Vanhoutte, 1991). Во время тромбоза тромбоциты выделяют серотонин, способствуя гемостазу за счет агрегации тромбоцитов (Berger et al., 2009) (рис. 1) и способствует рекрутированию нейтрофилов (Duerschmied et al., 2013). Таким образом, СИОЗС могут увеличивать время кровотечения (Leung and Shore, 1996) или снижать уровень серотонина в сыворотке крови более чем на 80% и уменьшать рекрутирование нейтрофилов (Duerschmied et al., 2013). Тромбоциты лиц, получавших СИОЗС, и тромбоциты мышей с нокаутом SERT демонстрируют пониженную агрегацию (Celada et al., 1992; Carneiro et al., 2008; McCloskey et al., 2008). Показатели коагуляции и гемостаза были ниже у пациентов с серотонинергическими антидепрессантами, чем у пациентов без серотонинергических антидепрессантов (Geiser et al., 2011). Гиперсеротонинергическое состояние отличает острый респираторный дистресс-синдром COVID-19 и не-COVID-19 биохимически (Zaid et al., 2021) и клинически (Helms et al., 2020a; Helms et al., 2020b). Вероятно, это патология во множестве органов (сродни серотониновому синдрому, Ф. Джалали — личное наблюдение и сообщение) и может быть вызвано иммуноопосредованным (Althaus et al., 2020; Nazy et al., 2021) состоянием тромбоцитов. гиперреактивность (Zaid et al., 2021), приводящая к выраженной дегрануляции тромбоцитов серотонина в плазму.

Сопутствующее нарушение обратного захвата серотонина может усугубить это гиперсеротонинергическое состояние. Клиренс серотонина зависит от здоровых легочных эндотелиев (Thomas and Vane, 1967; Joseph et al., 2013), которые повреждаются при COVID-19 (Ackermann et al., 2020). Высвобождение серотонина тромбоцитами может быть снижено при хроническом или раннем применении СИОЗС de novo (Cloutier et al., 2018), поскольку СИОЗС истощают содержание серотонина в тромбоцитах (Narayan et al., 1998; Javors et al., 2000). Однако начало приема 90 388 de novo 90 389 СИОЗС на 90 388 более поздних стадиях COVID-19 от умеренной до тяжелой может быть непредсказуемо вредным, учитывая существующее гиперсеротонинергическое состояние (Zaid et al., 2021), если оно не уравновешивается другими полезными эффектами СИОЗС. Действительно, прямой антагонизм серотонина, направленный конкретно на рецепторы серотонина 2 A, B и C с помощью таких препаратов, как ципрогептадин или миртазапин, на этой стадии может быть полезным и изучается (F. Jalali – личное сообщение).

В трех испытаниях, оценивающих пользу антикоагулянтов для лечения COVID-19, был приостановлен набор пациентов с COVID-19 в критическом состоянии, нуждающихся в поддержке отделения интенсивной терапии (ОИТ) (NHLBI, 2020). Терапевтические антикоагулянты не снижали потребность в госпитализации в ОИТ в этой группе пациентов. Поскольку полные дозы терапевтических антикоагулянтов увеличивают риск внутреннего кровотечения, FLV, возможно, может более безопасно ингибировать свертывание крови.

Дегрануляция тучных клеток

Тучные клетки человека (ТК) являются вирусным резервуаром для РНК-вирусов, таких как ВИЧ (Sundstrom et al., 2004). Индуцируемые ретиноевой кислотой ген-I-подобные рецепторы тучных клеток могут обнаруживать РНК-вирусы (Fukuda et al., 2013). Вирусы могут вызывать дегрануляцию ТК по сфингозин-1-фосфатному (S1P)-зависимому пути (Wang et al., 2012). ТК экспрессируют ангиотензинпревращающий фермент 2 (ACE2), основной рецептор для проникновения SARS-CoV-2 в клетки, таким образом определяя путь, по которому ТК могут стать хозяевами для этого вируса (Theoharides, 2020). Посмертные биопсии легких пациентов с COVID-19 связывают отек легких и тромбозы с активированными ТК (Motta Junior et al., 2020). Антидепрессанты также снижают высвобождение гистамина из ТК (Ferjan and Erjavec, 1996). СИОЗС, такие как флуоксетин, снижали уровни мРНК протеазы-1 в ТК (Chen et al., 2008). Таким образом, СИОЗС, такие как FLV, могут уменьшить цитокиновые бури у пациентов с COVID-19 (рис. 1) из-за атипичной реакции ТК на SARS-CoV-2.

Лизозомотропизм

Агонисты S1R, такие как FLV и флуоксетин, являются лизосомотропными (Hallifax and Houston, 2007; Kazmi et al., 2013). Флувоксамин имеет прогнозируемую pKa 8.86 (DrugBank, 2005; Wishart et al., 2018) и подвержен протонированию в физиологическом диапазоне рН. Менее полярная, неионизированная форма основных наркотиков может легко проникать через мембраны. Основные лекарства, такие как FLV, могут протонироваться в лизосомах, что препятствует пересечению мембран уже заряженными фрагментами. Бета-коронавирусы, такие как SARS-CoV-2 и вирус мышиного гепатита (MHV), используют лизосомальный перенос для выхода из инфицированных клеток (Ghosh et al., 2020) (рис. 1). GRP78/BIP, шаперон, способствующий заражению коронавирусом (Chu et al., 2018; Ha et al., 2020), высвобождается вместе с β-коронавирусами по этому пути (Ghosh et al., 2020). Белок 3A открытой рамки считывания SARS-CoV (ORF3a) (Gordon et al., 2020) представляет собой виропорин, который локализуется в лизосомах (Ghosh et al., 2020), нарушает их закисление (Yue et al., 2018) и способствует выходу вируса (Lu et al., 2006; Castano-Rodriguez et al., 2018; Yue et al., 2018). Учитывая лизосомальный выход β-коронавирусов из инфицированных клеток, лизосомотропные препараты, такие как FLV, могут оказывать противовирусное действие на загруженные вирусом лизосомы (Homolak and Kodvanj, 2020) (рис. 1).

Кислая сфингомиелиназа

Лизосомотропные препараты вытесняют кислую сфингомиелиназу (АСМ) из лизосомальных мембран, что приводит к ее деградации (Breiden and Sandhoff, 2019) (рис. 1). Лечение мышей агонистами S1R, такими как флуоксетин (Hashimoto, 2015), снижает как активность кислой сфингомиелиназы, так и уровни белка в нейронах (Gulbins et al., 2013). Это согласуется с частичным протеолизом кислой сфингомиелиназы флуоксетином (Kornhuber et al., 2008). Флуоксетин может эффективно ингибировать проникновение и размножение SARS-CoV-2 в клеточных линиях Vero-E6 (Schloer et al., 2020). Он также проявляет противовирусную активность в отношении подтипов вируса гриппа А (Schloer et al., 2020). Агонисты S1R, такие как эсциталопрам и флуоксетин (Hashimoto, 2015), могут предотвращать заражение клеток Vero псевдовирусными частицами вируса везикулярного стоматита, представляющими спайковый белок SARS-CoV-2 (шип pp-VSV-SARS-CoV-2) (Carpinteiro et al., 2020 ). Антидепрессанты, такие как амитриптилин, также предотвращали заражение клеток Caco-2 человека вирусом SARS-CoV-2, а лечение добровольцев низкой дозой амитриптилина предотвращало заражение свежевыделенных клеток носового эпителия шипом pp-VSV-SARS-CoV-2 (Carpinteiro et al. ., 2020). Ингибирование кислой сфингомиэлазы этими препаратами может предотвратить превращение сфингомиелина в фосфорилхолин и церамид. Поскольку высокое содержание церамида в клеточной мембране облегчает проникновение вируса, такое снижение содержания церамида может предотвратить инфекцию (Carpenteiro et al., 2020). Таким образом, функциональное ингибирование кислой сфингомиелиназы лизосомотропными препаратами является еще одним способом борьбы с вирусами с помощью антидепрессантов.

Активность рецептора сигма-1

S1R был открыт в 1976 г. (Martin et al., 1976) и клонирован в 1996 г. (Hanner et al., 1996). Он регулирует передачу сигналов ER-митохондрий Ca 2+ и выживание клеток (Hayashi and Su 2007). Воздействие FLV на S1R регулирует продукцию цитокинов в дендритных клетках, происходящих из моноцитов человека (Szabo et al., 2014). Макрофаги костного мозга с нокаутом S1R (KO) (BMDM) были провоспалительными в моделях эндотоксического шока. У них были более высокие уровни мРНК IL-6 и IL-1 β и повышенная секреция белка IL-6 по сравнению с BMDM дикого типа (WT) (Rosen et al., 2019). Напротив, экспрессия противовоспалительного цитокина IL-10 не влияла на S1R KO BMDM (Rosen et al., 2019). Сверхэкспрессия S1R в HEK, экспрессирующих mTLR4/MD2/CD14, оказывала противовоспалительное действие в модели эндотоксического шока. По сравнению с HEK с нормальным уровнем S1R, клетки с более высоким уровнем S1R имели более низкие уровни IL-8 при стимуляции LPS ( p <0,05). В других системах FLV активирует IL-10 (Kalkman and Feuerbach, 2016; Назимек и др., 2017). Следовательно, FLV через S1R может модулировать гипервоспалительное состояние, вызванное SARS-CoV-2 (рис. 1).

С другой стороны, скрининг генетических нарушений показал истощение S1R, снижает репликацию вируса SARS-CoV-2 в линиях аденокарциномы человека альвеолярного базального эпителия, экспрессирующих ангиотензин I превращающий фермент 2 (A549-ACE2) (Gordon et al. , 2020). В соответствии с этими генетическими данными агонисты S1R, такие как декстрометорфан, могут усиливать репликацию вируса (Gordon et al., 2020). Однако, напротив, исследователи, проанализировавшие данные о медицинских счетах почти 740 000 пациентов с COVID-19 в США, показали, что пациентам, принимающим антипсихотические препараты, нацеленные на S1R, в два раза реже, чем пациентам, принимающим другие типы антипсихотических препаратов, требуется искусственная вентиляция легких (Gordon et al., 2020).

Нейротропизм — одна из общих черт коронавирусов человека (Bale, 2015; Dube et al., 2018). Различные рецепторы могут быть вовлечены в нейротропизм и проникновение SARS-CoV-2 в нейроны (Armocida et al., 2020). Сигма-рецепторы широко экспрессируются в ЦНС (Yesilkaya et al., 2020). Снижение экспрессии белка S1R нарушает инициацию репликации РНК вируса гепатита С (HCV) в клетках гепатомы человека (Friesland et al., 2013). BD1047, селективный антагонист S1R, блокировал опосредованную кокаином стимуляцию экспрессии вируса иммунодефицита человека (ВИЧ-1) в нейрональных мононуклеарных фагоцитах, таких как микроглия (Gekker et al., 2006). Таким образом, S1R может быть вовлечен в нейронную передачу других РНК-вирусов, таких как SARS-CoV-2.

Инозитол-требующий фермент 1α и аутофагия

Эндотоксин-стимулированный TLR4 активирует IRE1 (Martinon et al., 2010) и регулирует выработку провоспалительных цитокинов (Qiu et al., 2013). Белок E SARS-CoV подавляет путь IRE1, а SARS-CoV, лишенный гена оболочки (E) (rSARS-CoV-ΔE), аттенуируется 90 388 in vivo 90 389 (DeDiego et al., 2011). Ингибиторы IRE1, такие как STF-083010, спасали мышей S1R KO в модели эндотоксемии (Rosen et al., 2019). IRE1 необходим для аутофагии при заражении гамма-коронавирусом — вирусом инфекционного бронхита (IBV) (Fung and Liu, 2019). Белки репликазы SARS-CoV nsp2, 3 и 8 встречаются в цитоплазматических комплексах и совместно локализуются с LC3, белком-маркером аутофагических вакуолей (Prentice et al., 2004). Белок вирусной репликазы nsp6 IBV активирует аутофагию при скрининге (Cottam et al., 2011). Другие исследования, рассмотренные здесь (Yang and Shen, 2020), предполагают, что аутофагия не имеет прямого отношения к SARS-CoV.Эти расхождения, вероятно, связаны с различными вирусами и клетками, протестированными в различных исследованиях.

Мелатонин

Вирус SARS-CoV-2 может активировать инфламмасому NLRP3 (van den Berg and Te Velde, 2020), которая наряду с активацией NF-κB может вызывать цитокиновый шторм (Ratajczak and Kucia, 2020). Мелатонин может смягчать воспаление через эти пути, а воздействие мелатонина после интубации связано с положительным исходом у пациентов с COVID-19 (и без COVID-19) (Garcia et al., 2015; Ramlall et al., 2020). FLV может повышать уровень мелатонина за счет ингибирования CYP1A2, члена надсемейства ферментов цитохрома P450 (Hartter et al., 2001) (рис. 1).

Могут ли селективные ингибиторы обратного захвата серотонина и агонисты сигма-1-рецепторов оказывать прямое противовирусное действие на другие вирусы?

Прецедент использования селективных ингибиторов обратного захвата серотонина для лечения других вирусных инфекций

Энтеровирусы представляют собой безоболочечные РНК-содержащие вирусы. Их неструктурный белок 2C является одним из их наиболее консервативных белков и содержит активность АТФазы и предполагаемую активность РНК-хеликазы (Cheng et al., 2013). Флуоксетин обладает противовирусной активностью in vitro против видов Enterovirus B и D (Zuo et al., 2012; Ulferts et al., 2013). Флуоксетин напрямую связывается с неструктурным белком 2C (Manganaro et al., 2020). Некоторые устойчивые к флуоксетину варианты энтеровирусов, такие как вирус Коксаки B3 и B4, имеют мутации в белке 2C (Ulferts et al., 2013; Alidjinou et al., 2019). Это подтверждает идею о том, что взаимодействие между флуоксетином и белком 2C необходимо для его противовирусного действия.

Реакция эндоплазматического ретикулума на стресс

Вирусная инфекция может вызвать реакцию развернутых белков (UPR). Это реакция ER на стресс из-за перегрузки ER белками, кодируемыми вирусом (Kim et al., 2008), и может также индуцировать аутофагию (Bernales et al., 2006; Ogata et al., 2006). Сигнальные белки ER, такие как IRE1, PRKR-подобная киназа ER (PERK) и активирующий фактор транскрипции 6 (ATF6), регулируют UPR. UPR участвует в репликации вируса и модулирует врожденные реакции хозяина (Xue et al., 2018). Вирус-индуцированный стресс ER необходим для активации аутофагии, репликации вируса и патогенеза денге (Lee et al., 2018). Цитомегаловирус мышей активирует путь IRE1 для снятия репрессии с помощью несплайсированной мРНК белка 1, связывающего X-box (Hinte et al., 2020). Коронавирусная инфекция вызывает стресс ER и запускает UPR (Fung et al., 2016). Белок S в β-коронавирусах модулирует UPR для облегчения репликации вируса (Chan et al., 2006; Versteeg et al., 2007). α-коронавирус, вирус трансмиссивного гастроэнтерита (TGEV), вызывает UPR-индуцированный стресс ER, прежде всего, посредством активации оси PERK-эукариотического фактора инициации 2α (Xue et al., 2018). Таким образом, стрессовая реакция ER имеет решающее значение во взаимодействиях вирус-хозяин при различных инфекциях. Выше мы обсуждали, как S1R является регулятором IRE1 и аутофагии. Таким образом, агонисты S1R, такие как FLV, могут играть роль в регуляции вирусных инфекций помимо SARS-CoV-2 посредством предполагаемой регуляции стресса ER и UPR.

Доклинические эффекты флувоксамина на воспаление

Мыши S1R KO демонстрируют повышенную смертность по сравнению с WT в сублетальных моделях сепсиса (Rosen et al., 2019).Пиковые уровни TNF и IL-6 в сыворотке были повышены у мышей S1R KO, зараженных LPS. Лиганд S1R FLV повышал выживаемость в мышиных моделях IRE1-опосредованного воспаления и фекально-индуцированного перитонита. Лечение FLV защищало мышей WT от смерти, вызванной эндотоксическим шоком, в то время как у животных с нокаутом S1R не наблюдалось значительного эффекта, что позволяет предположить, что противовоспалительные эффекты FLV, вероятно, опосредуются через S1R.

Рассеянный склероз (РС) — хроническое воспалительное демиелинизирующее нейродегенеративное заболевание. Было показано, что СИОЗС, такие как сертралин, обладают иммуномодулирующим действием при экспериментальном аутоиммунном энцефаломиелите (ЭАЭ), мышиной модели рассеянного склероза (Taler et al., 2011) и в модели ревматоидного артрита у крыс (Baharav et al., 2012). FLV снижает тяжесть ЭАЭ у крыс, даже если лечение началось через 12 дней после индукции ЭАЭ (Ghareghani et al., 2017). Крысы EAE, получавшие FLV, показали снижение уровней IFN-γ в сыворотке и увеличение IL-4, про- и противовоспалительных цитокинов, соответственно, по сравнению с крысами EAE, не получавшими лечения. Доза FLV, используемая в этих экспериментах, экстраполируется (по площади поверхности) на дозы FLV, одобренные для использования человеком.

Таким образом, FLV, по-видимому, уменьшает воспаление в различных in vivo моделях воспаления.Данные о приматах, отличных от человека, или хомячьей модели инфекции SARS-CoV-2 прольют дополнительный свет на то, может ли FLV быть полезным лекарством для пациентов с COVID-19, и на действующие механизмы.

Клинические эффекты флувоксамина при COVID-19

В двойном слепом рандомизированном предварительном исследовании взрослых амбулаторных пациентов с симптомами COVID-19 80 пациентов, получавших FLV, по сравнению с 72 пациентами, получавшими плацебо, имели более низкую вероятность клинического ухудшение в течение 15 дней (Lenze et al., 2020).Подходящие пациенты были включены в исследование в течение 7 дней после появления симптомов. Эти данные являются провокационными: ни у одного из пациентов, получавших FLV, не наблюдалось ухудшения состояния по сравнению с 8,3% пациентов в контрольной группе, у которых наблюдалось клиническое ухудшение. Участники получали 50 мг FLV QD в 1-й день, затем в течение 2 дней 100 мг FLV два раза в день, а затем 100 мг FLV три раза в день в зависимости от переносимости в течение 15-го дня, а затем прекратили. В проспективном исследовании использования FLV для раннего лечения COVID-19 частота госпитализаций составила 0% (0/65) при FLV и 12.5% (6/48) только при наблюдении. Через 14 дней у 0 % (0/65) людей, получавших лечение FLV, были стойкие остаточные симптомы по сравнению с 60% (29/48) среди людей, отказавшихся от лечения (Seftel and Boulware, 2021). Агонисты S1R, такие как эсциталопрам и флуоксетин, были связаны с более низким риском интубации или смерти ( p <0,05) из-за COVID-19 в многоцентровом обсервационном ретроспективном когортном исследовании (Hoertel et al., 2021).

Учитывая многочисленные роли S1R, рассмотренные здесь, в воспалении, агрегации тромбоцитов, противовирусной активности и т. д.и недавние поразительные данные о людях, вполне вероятно, что агонисты S1R, такие как FLV, могут оказывать серьезное влияние на прогрессирование заболевания у пациентов с COVID-19 на ранней стадии заболевания.

Обсуждение

Рандомизированное исследование с участием 880 пациентов должно дать некоторые окончательные ответы (Lenze, 2020). Пациенты на национальном уровне могут бесплатно присоединиться к этому исследованию из дома. Однако, учитывая текущий кризис , который, как ожидается, ухудшится до того, как вакцина подействует, возникает вопрос, достаточно ли убедительны доказательства FLV в COVID-19, чтобы рассмотреть возможность изменения практических рекомендаций, чтобы еще быстрее накапливать данные о результатах в Пациенты с COVID-19 (Сукхатме и Сукхатме, 2021 г.).Небольшая группа систем здравоохранения могла бы рассмотреть этот подход и одновременно настроить инструменты, например, локальный или региональный репозиторий для отслеживания результатов в режиме реального времени. Если эффективность аналогична небольшому рандомизированному исследованию (Lenze et al., 2020), это должно быть очевидно в таких данных. Из соображений осторожности практические рекомендации могут побуждать лиц, осуществляющих уход, рассматривать вопрос о введении FLV только тем пациентам с COVID-19 +, которые подвергаются наибольшему риску прогрессирования заболевания и у которых нет доступа к одному из моноклональных антител, которым было предоставлено разрешение на экстренное использование FDA (FDA, 2020a; FDA, 2020b).Кроме того, эти руководящие принципы могут быть пересмотрены в любое время.

Необходимо запланировать небольшие интенсивные исследования биомаркеров для оценки противовирусных, иммуномодулирующих, антитромботических эффектов или других эффектов у пациентов, получающих FLV. В такие исследования можно было бы включить такие инструменты, как анализ РНК отдельных клеток и белков. Пока собираются данные о людях, будут полезны дополнительные доклинические данные в системах клеточных культур, таких как совместные культуры эпителиальных и иммунных клеток человека (Grunwell et al., 2019). Данные о приматах и ​​хомяках, не являющихся людьми, могут предоставить ценную информацию об оптимальном времени приема препарата, количестве, необходимом для эффективности, и о том, какой из множества механизмов действия может быть наиболее важным.

Модуляция серотонина может иметь значение в условиях стационара. Действительно, если этот препарат действует не в первую очередь как противовирусный, а скорее через другие механизмы (например, иммуномодулирующий, антитромбоцитарный), он может быть эффективен в тех случаях, когда гипервоспалительные реакции и тромботические явления вызывают патологию заболевания. Однако необходимо проявлять бдительность в отношении возникновения гиперсеротонинергического состояния, сходного с серотониновым синдромом, как отмечалось ранее. Таким образом, может иметь смысл назначать флувоксамин у менее тяжелых госпитализированных пациентов, но назначать антагонист серотониновых рецепторов 2 A, B и C, таких как ципрогептадин или миртазапин, у более тяжелых пациентов (вместе с флувоксамином).Также заманчиво размышлять о роли FLV в дальних переносах COVID-19. Вероятно, в этой гетерогенной группе есть подмножества, которые могут иметь аномальный иммунный ответ, который сохраняется, при котором FLV может быть эффективным. Наконец, FLV может играть роль в лечении других вирусных заболеваний, при которых присутствует некоторая версия цитокинового шторма (Fajgenbaum and June, 2020).

Вклад автора

VPS, AR, SV и VVS написали и отредактировали рукопись.SV разработал фигуру. Все авторы внесли свой вклад в статью и одобрили представленную версию.

Финансирование

Центр инновационной и доступной медицины Морнингсайд при Университете Эмори.

Конфликт интересов

Автор VVS работал в компании GlobalCures, Inc. Автор AR получил исследовательскую поддержку клинических испытаний флувоксамина для лечения COVID-19 от Института инновационного психиатрического лечения семьи Тейлор в Вашингтонском университете, Fast Grants и Фонд раннего лечения COVID-19, и она является изобретателем патентной заявки, поданной Вашингтонским университетом в Сент-Луисе.Louis, что имеет отношение к методам лечения COVID-19, включая флувоксамин.

Остальные авторы заявляют, что исследование проводилось в отсутствие каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Благодарности

Мы благодарим Фарида Джалали за понимание патологии COVID-19 и периферического гиперсеротонинергического состояния, которое может возникнуть из-за чрезмерного выброса серотонина тромбоцитами.

Ссылки

Аккерманн, М., Verleden, S.E., Kuehnel, M., Haverich, A., Welte, T., Laenger, F., et al. (2020). Эндотелиит легочных сосудов, тромбоз и ангиогенез при covid-19. Н. англ. Дж. Мед. 383 (2), 120–128. doi:10.1056/nejmoa2015432

Резюме PubMed | Полный текст перекрестной ссылки | Google Scholar

Алиджину, Э. К., Бертин, А., Сане, Ф., Калун, Д., Энгельманн, И., и Хобер, Д. (2019). Появление устойчивых к флуоксетину вариантов при лечении культур клеток поджелудочной железы человека, персистентно инфицированных вирусом Коксаки В4. Вирусы 11 (6), 486. doi:10.3390/v11060486

CrossRef Полный текст | Google Scholar

Альтхаус К., Марини И., Зламал Дж., Пельцль Л., Сингх А., Хеберле Х. и др. (2020). Индуцированные антителами прокоагулянтные тромбоциты при тяжелой инфекции COVID-19. Кровь 137 (8), 1061–1071. doi:10.1182/blood.2020008762

CrossRef Полный текст | Google Scholar

Армоцида Д., Палмиери М., Фрати А., Санторо А. и Пеше А. (2020). Как SARS-Cov-2 может поражать центральную нервную систему.Систематический анализ литературы отдела нейробиологии человека Университета Сапиенца, Италия. Дж. Клин. Неврологи. 79, 231–236. doi:10.1016/j.jocn.2020.07.007

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Бахарав Э., Бар М., Талер М., Гил-Ад И., Карп Л., Вайнбергер А. и др. (2012). Иммуномодулирующий эффект сертралина на крысиной модели ревматоидного артрита. Нейроиммуномодуляция 19 (5), 309–318. doi:10.1159/000339109

Резюме PubMed | Полный текст перекрестной ссылки | Google Scholar

Бэйл, Дж.Ф. (2015). Вирусные и иммуноопосредованные энцефалиты: эпидемиология, диагностика, лечение и профилактика. Педиатр. Нейрол. 53 (1), 3–12. doi:10.1016/j.pediatrneurol.2015.03.013

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Бауэр Л., Манганаро Р., Зонсикс Б., Стратинг Дж. Р. П. М., Эль Каззи П., Лоренцо Лопес М. и др. (2019). Флуоксетин ингибирует репликацию энтеровируса, стереоспецифически воздействуя на вирусный белок 2C. Заражение ACS.Дис. 5 (9), 1609–1623. doi:10.1021/acsinfecdis.9b00179

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Берналес С., Макдональд К.Л. и Уолтер П. (2006). Аутофагия уравновешивает расширение эндоплазматического ретикулума во время ответа развернутого белка. Плос Биол. 4 (12), е423. doi:10.1371/journal.pbio.0040423

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Карнейро, А. М. Д., Кук, Э. Х., Мерфи, Д. Л., и Блейкли, Р.Д. (2008). Взаимодействия между интегрином αIIbβ3 и переносчиком серотонина регулируют транспорт серотонина и агрегацию тромбоцитов у мышей и людей. Дж. Клин. Инвестировать. 118 (4), 1544–1552. doi:10.1172/jci33374

Резюме PubMed | Полный текст перекрестной ссылки | Google Scholar

Карпинтейро А., Эдвардс М.Дж., Хоффманн М., Кохс Г., Грипп Б., Вейганг С. и др. (2020). Фармакологическое ингибирование кислой сфингомиелиназы предотвращает поглощение SARS-CoV-2 эпителиальными клетками. Cel Rep. Med. 1 (8), 100142. doi:10.1016/j.xcrm.2020.100142

CrossRef Full Text | Google Scholar

Castano-Rodriguez, C., Honrubia, J.M., Gutierrez-Alvarez, J., DeDiego, M.L., Nieto-Torres, J.L., Jimenez-Guardeno, J.M., et al. (2018). Роль виропоринов E, 3a и 8a коронавируса тяжелого острого респираторного синдрома в репликации и патогенезе. mBio 9 (3), e02325–17. doi:10.1128/mbio.02325-17

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Селада, П., Долера М., Альварес Э. и Артигас Ф. (1992). Влияние острого и хронического лечения флувоксамином на внеклеточный и тромбоцитарный серотонин в крови пациентов с большой депрессией. Связь с клиническим улучшением. J. Аффективное расстройство. 25 (4), 243–249. doi:10.1016/0165-0327(92)-h

CrossRef Full Text | Google Scholar

Чан С.-П., Сиу К.-Л., Чин К.-Т., Юэнь К.-Ю., Чжэн Б. и Джин Д.-Ю. (2006). Модуляция ответа развернутого белка шиповидным белком коронавируса тяжелого острого респираторного синдрома. Джви 80 (18), 9279–9287. doi:10.1128/jvi.00659-06

Полный текст CrossRef | Google Scholar

Чен Г., Ву Д., Го В., Цао Ю., Хуанг Д., Ван Х. и др. (2020а). Клинико-иммунологические особенности тяжелого и среднетяжелого течения коронавирусной болезни 2019. J. Clin. Инвестировать. 130 (5), 2620–2629. doi:10.1172/jci137244

Резюме PubMed | Полный текст перекрестной ссылки | Google Scholar

Чен Н., Чжоу М., Донг X., Цюй Дж., Гонг Ф., Хан Ю. и др.(2020б). Эпидемиологические и клинические характеристики 99 случаев новой коронавирусной пневмонии 2019 года в Ухане, Китай: описательное исследование. The Lancet 395 (10223), 507–513. doi:10.1016/s0140-6736(20)30211-7

Полный текст CrossRef | Google Scholar

Чен, З.-Х., Сяо, Л., Чен, Дж.-Х., Луо, Х.-С., Ван, Г.-Х., Хуанг, Ю.-Л., и др. др. (2008). Влияние флуоксетина на морфологию тучных клеток и экспрессию протеазы-1 в антральном отделе желудка в модели депрессии у крыс. Wjg 14 (45), 6993–6998.doi:10.3748/wjg.14.6993

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Ченг З., Ян Дж., Ся Х., Цю Ю., Ван З., Хан Ю. и др. (2013). Неструктурный белок 2C пикорноподобного вируса проявляет активность дестабилизации спирали нуклеиновой кислоты, которая может быть функционально отделена от его АТФазной активности. Дж. Вирол. 87 (9), 5205–5218. doi:10.1128/jvi.00245-13

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Чу, Х., Чан, К.-M., Zhang X., Wang Y., Yuan S., Zhou J. и соавт. (2018). Коронавирус ближневосточного респираторного синдрома и коронавирус летучих мышей HKU9 могут использовать GRP78 для прикрепления к клеткам-хозяевам. J. Biol. хим. 293 (30), 11709–11726. doi:10.1074/jbc.ra118.001897

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Cloutier, N., Allaeys, I., Marcoux, G., Machlus, K.R., Mailhot, B., Zufferey, et al. (2018). Тромбоциты высвобождают патогенный серотонин и возвращаются в кровоток после секвестрации, опосредованной иммунными комплексами. Проц. Натл. акад. науч. США 115 (7), E1550–E1559. doi:10.1073/pnas.1720553115

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Cottam, E.M., Maier, HJ, Manifava, M., Vaux, L.C., Chandra-Schoenfelder, P., Gerner, W., et al. (2011). Белки nsp6 коронавируса генерируют аутофагосомы из эндоплазматического ретикулума через промежуточные омегасомы. Аутофагия 7 (11), 1335–1347. doi:10.4161/auto.7.11.16642

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

ДеДиего, М.L., Nieto-Torres, J.L., Jimenez-Guardeno, J.M., Regla-Nava, J.A., Alvarez, E., Oliveros, J.C., et al. (2011). Белок оболочки коронавируса тяжелого острого респираторного синдрома регулирует реакцию клеток на стресс и апоптоз. Плос Патог. 7 (10), е1002315. doi:10.1371/journal.ppat.1002315

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Делл’Оссо, Б., Аллен, А., и Холландер, Э. (2005). Флувоксамин: селективный ингибитор обратного захвата серотонина для лечения обсессивно-компульсивного расстройства. Экспертное заключение. Фармацевт. 6 (15), 2727–2740. doi:10.1517/14656566.6.15.2727

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Дуб, М., Ле Купанек, А., Вонг, А. Х. М., Рини, Дж. М., Дефорж, М., и Талбот, П. Дж. (2018). Аксональный транспорт обеспечивает распространение коронавируса человека OC43 от нейрона к нейрону. Дж. Вирол. 92 (17), э00404–18. doi:10.1128/jvi.00404-18

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Дюршмид, Д., Suidan, G.L., Demers, M., Herr, N., Carbo, C., Brill, A., et al. (2013). Серотонин тромбоцитов способствует привлечению нейтрофилов к местам острого воспаления у мышей. Кровь 121 (6), 1008–1015. doi:10.1182/blood-2012-06-437392

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Ferjan, I., and Erjavec, F. (1996). Изменения секреции гистамина и серотонина тучными клетками брюшины крыс, вызванные антидепрессантами. Воспаление. Рез. 45 (3), 141–144.doi:10.1007/bf02265168

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Фрисланд М., Мингоранс Л., Чанг Дж., Чисари Ф.В. и Гастаминза П. (2013). Рецептор сигма-1 регулирует ранние этапы репликации вирусной РНК в начале инфицирования вирусом гепатита С. Дж. Вирол. 87 (11), 6377–6390. doi:10.1128/jvi.03557-12

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Фукуда М., Ушио Х., Кавасаки Дж., Ниёнсаба Ф., Такеучи М., Баба Т. и др. (2013). Экспрессия и функциональная характеристика индуцируемых ретиноевой кислотой ген-I-подобных рецепторов тучных клеток в ответ на вирусную инфекцию. J. Врожденный иммунитет. 5 (2), 163–173. doi:10.1159/000343895

Резюме PubMed | Полный текст перекрестной ссылки | Google Scholar

Фунг Т.С., Ляо Ю. и Лю Д.С. (2016). Регуляция стрессовых реакций и трансляционный контроль коронавирусом. Вирусы 8 (7), 184. doi:10.3390/v8070184

CrossRef Полный текст | Google Scholar

Фунг, Т.С. и Лю Д. Х. (2019). Сенсор стресса ER IRE1 и MAP-киназа ERK модулируют индукцию аутофагии в клетках, инфицированных вирусом коронавирусного инфекционного бронхита. Вирусология 533, 34–44. doi:10.1016/j.virol.2019.05.002

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Гарсия Дж. А., Вольт Х., Венегас К., Доерриер К., Эскамес Г., Акунья-Кастровьехо Л. К. и др. (2015). Нарушение связи NF-κB/NLRP3 мелатонином требует связанного с ретиноидами орфанного рецептора-α и блокирует септическую реакцию у мышей. FASEB J. 29 (9), 3863–3875. doi:10.1096/fj.15-273656

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Гейзер Ф., Конрад Р., Имберович К., Мейер К., Лидтке Р., Клингмюллер Д. и др. (2011). Активация коагуляции и нарушение фибринолиза уменьшаются у пациентов с тревогой и депрессией при лечении серотонинергическими антидепрессантами. Психиатрическая клиника. Неврологи. 65 (5), 518–525. doi:10.1111/j.1440-1819.2011.02241.x

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Геккер, Г., Hu, S., Sheng, W.S., Rock, R.B., Lokensgard, J.R., and Peterson, P.K. (2006). Вызванная кокаином экспрессия ВИЧ-1 в микроглии включает рецепторы сигма-1 и трансформирующий фактор роста-β1. Междунар. Иммунофармакология 6 (6), 1029–1033. doi:10.1016/j.intimp.2005.12.005

Полный текст CrossRef | Google Scholar

Гарегани М., Зибара К., Садеги Х., Докуохаки С., Садеги Х., Арианпур Р. и др. (2017). Флувоксамин стимулирует олигодендрогенез культивируемых нейральных стволовых клеток и ослабляет воспаление и демиелинизацию в модели рассеянного склероза у животных. науч. Rep. 7 (1), 4923. doi:10.1038/s41598-017-04968-z

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Гош С., Деллибови-Рагеб Т. А., Кервиль А., Пак Э., Цю К., Фишер М. и др. (2020). Бета-коронавирусы используют для выхода лизосомы вместо секреторного пути биосинтеза. моб. 183 (6), 15:20–15:35. е1514. doi:10.1016/j.cell.2020.10.039

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Гордон, Д. Э., Hiatt, J., Bouhaddou, M., Rezelj, V.V., Ulferts, S., Braberg, H., et al. (2020). Сравнительные сети взаимодействия белков хозяин-коронавирус выявляют механизмы панвирусных заболеваний. JScience 370 (6521), eabe9403. doi:10.1126/science.abe9403

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Грюнвелл Дж. Р., Джакалоне В. Д., Стивенсон С., Маргароли К., Добош Б. С., Браун М. Р. и др. (2019). Дисфункция нейтрофилов в дыхательных путях у детей с острой дыхательной недостаточностью на фоне вирусных и бактериальных коинфекций нижних дыхательных путей. науч. Rep. 9 (1), 2874. doi:10.1038/s41598-019-39726-w

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Гулбинс Э., Палмада М., Райхель М., Лют А., Бёмер К., Амато Д. и др. (2013). Кислая сфингомиелиназо-церамидная система опосредует действие антидепрессантов. Нац. Мед. 19 (7), 934–938. doi:10.1038/nm.3214

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Ха, Д. П., Ван Крикен, Р., Карлос, А. Дж., и Ли, А.С. (2020). Стресс-индуцируемый молекулярный шаперон GRP78 как потенциальная терапевтическая мишень для коронавирусной инфекции. Дж. Заражение. 81 (3), 452–482. doi:10.1016/j.jinf.2020.06.017

Полный текст CrossRef | Google Scholar

Халлифакс, Д., и Хьюстон, Дж. Б. (2007). Насыщаемое поглощение липофильных аминовых препаратов изолированными гепатоцитами: механизмы и последствия для прогнозирования количественного клиренса. Препарат Метаб. Dispos 35 (8), 1325–1332. дои: 10.1124/dmd.107.015131

Реферат PubMed | Полный текст перекрестной ссылки | Google Scholar

Hanner, M., Moebius, F.F., Flandorfer, A., Knaus, H.G., Striessnig, J., Kempner, E., et al. (1996). Очистка, молекулярное клонирование и экспрессия sigma1-связывающего сайта млекопитающих. Проц. Натл. акад. науч. 93 (15), 8072–8077. doi:10.1073/pnas.93.15.8072

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Харттер С., Ван Х., Вейгманн Х., Фридберг Т., Аранд М., Oesch, F., et al. (2001). Дифференциальные эффекты флувоксамина и других антидепрессантов на биотрансформацию мелатонина. Дж. Клин. Психофармак. 21 (2), 167–174. doi:10.1097/00004714-200104000-00008

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Хашимото, К. (2015). Активация шаперона рецептора сигма-1 в лечении нервно-психических заболеваний и ее клиническое значение. J. Pharmacol. науч. 127 (1), 6–9. дои: 10.1016 / j.jphs.2014.11.010

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Хашимото, К. (2021). Перепрофилирование препаратов ЦНС для лечения инфекции COVID-19: нацеливание на рецептор сигма-1. евро. Арка Психиатрия клин. Неврологи. 271 (2), 249–258. doi:10.1162/2e3983f5.c37587dd

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Хаяши Т. и Су Т.-П. (2007). Шапероны рецептора сигма-1 на границе ER-митохондрия регулируют передачу сигналов Ca(2+) и выживание клеток. моб. 131 (3), 596–610. doi:10.1016/j.cell.2007.08.036

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Хелмс Дж., Кремер С., Мерджи Х., Клер-Джель Р., Шенк М., Куммерлен С. и др. (2020а). Неврологические особенности при тяжелой инфекции SARS-CoV-2. Н. англ. Дж. Мед. 382 (23), 2268–2270. doi:10.1056/nejmc2008597

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Хелмс Дж., Кремер С., Мерджи Х., Шенк М., Северак Ф., Клер-Джель Р. и соавт. (2020б). Делирий и энцефалопатия при тяжелом течении COVID-19: когортный анализ пациентов отделения интенсивной терапии. Крит. Care 24 (1), 491. doi:10.1186/s13054-020-03200-1

CrossRef Полный текст | Google Scholar

Хинте Ф., ван Анкен Э., Тирош Б. и Брюн В. (2020). Репрессия экспрессии и репликации вирусных генов с помощью эффектора развернутого белка XBP1u. Элиф 9, e51804. doi:10.7554/elife.51804

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Хёртель, Н., Санчес-Рико, М., Вернет, Р., Бикер, Н., Янно, А.-С., Нейраз, А., и соавт. (2021). Связь между приемом антидепрессантов и снижением риска интубации или смерти у госпитализированных пациентов с COVID-19: результаты обсервационного исследования. Мол. Психиат. doi:10.1038/s41380-021-01021-4

CrossRef Full Text | Google Scholar

Хомолак, Дж., и Кодвандж, И. (2020). Широко доступные агенты, нацеленные на лизосомы, следует рассматривать в качестве потенциальной терапии COVID-19. Междунар.Дж. Антимикроб. Agents 56 (2), 106044. doi:10.1016/j.ijantimicag.2020.106044

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Хуан К., Ван Ю., Ли X., Рен Л., Чжао Дж., Ху Ю. и др. (2020). Клинические особенности пациентов, инфицированных новым коронавирусом 2019 года в Ухане, Китай. The Lancet 395 (10223), 497–506. doi:10.1016/s0140-6736(20)30183-5

Полный текст CrossRef | Google Scholar

Айронс, Дж. (2005). Флувоксамин в лечении тревожных расстройств. Нейропсихиатр. Дис. Рассматривать. 1 (4), 289–299.

Реферат PubMed | Google Scholar

Ишима Т., Фудзита Ю. и Хашимото К. (2014). Взаимодействие новых антидепрессантов с шаперонами сигма-1 рецепторов и их усиление роста нейритов в клетках PC12. евро. Дж. Фармакол. 727, 167–173. doi:10.1016/j.ejphar.2014.01.064

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Джаворс, М. А., Хьюстон, Дж. П., Текелл, Дж. Л., Браннан, С.К. и Фрейзер А. (2000). Снижение содержания серотонина в тромбоцитах у пациентов с депрессией, получающих пароксетин или дезипрамин. Междунар. Дж. Нейропсихофарм. 3 (3), 229–235. doi:10.1017/s146114570000198x

CrossRef Full Text | Google Scholar

Джозеф Д., Путтасвами Р. К. и Кроввиди Х. (2013). Нереспираторные функции легких. Непрерывное образование. Анаст. крит. Care Pain 13 (3), 98–102. doi:10.1093/bjaceaccp/mks060

Полный текст CrossRef | Google Scholar

Калкман, Х.О. и Фейербах Д. (2016). Терапия антидепрессантами ингибирует воспаление и M1-поляризацию микроглии. Фармакол. тер. 163, 82–93. doi:10.1016/j.pharmthera.2016.04.001

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Казми Ф., Хенсли Т., Поуп К., Фанк Р. С., Лоуэн Г. Дж., Бакли Д. Б. и др. (2013). Лизосомальная секвестрация (захват) липофильных аминовых (катионных амфифильных) препаратов в иммортализованных гепатоцитах человека (клетки Fa2N-4). Препарат Метаб.Dispos 41 (4), 897–905. doi:10.1124/dmd.112.050054

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Ким И., Сюй В. и Рид Дж. К. (2008). Гибель клеток и стресс эндоплазматического ретикулума: актуальность заболевания и терапевтические возможности. Нац. Преподобный Друг Дисков. 7 (12), 1013–1030. doi:10.1038/nrd2755

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Корнхубер Дж., Трипал П., Райхель М., Терфлот Л., Блайх С., Вилтфанг Дж., и другие. (2008). Идентификация новых функциональных ингибиторов кислой сфингомиелиназы с использованием модели связи структура-свойство-активность. J. Med. хим. 51 (2), 219–237. doi:10.1021/jm070524a

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Lee, Y.R., Kuo, S.H., Lin, C.Y., Fu, P.J., Lin, Y.S., Yeh, T.M., et al. (2018). Индуцированный вирусом денге стресс ER необходим для активации аутофагии, репликации вируса и патогенеза как in vitro , так и in vivo . науч. Rep. 8 (1), 489. doi:10.1038/s41598-017-18909-3

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Lenze, E.J., Mattar, C., Zorumski, C.F., Stevens, A., Schweiger, J., Nicol, G.E., et al. (2020). Флувоксамин по сравнению с плацебо и клиническое ухудшение у амбулаторных пациентов с симптомами COVID-19. JAMA 324 (22), 2292–2300. doi:10.1001/jama.2020.22760

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Лу, В., Чжэн, Б.-J., Xu, K., Schwarz, W., Du, L., Wong, C.K.L., et al. (2006). Белок коронавируса 3a, связанный с тяжелым острым респираторным синдромом, образует ионный канал и модулирует высвобождение вируса. Проц. Натл. акад. науч. 103 (33), 12540–12545. doi:10.1073/pnas.0605402103

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Манганаро Р., Зонсикс Б., Бауэр Л., Лоренцо Лопес М., Донселаар Т., Зваагстра М. и др. (2020). Синтез и противовирусное действие новых аналогов флуоксетина как ингибиторов энтеровируса 2С. Противовирусный рез. 178, 104781. doi:10.1016/j.antiviral.2020.104781

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Martin, W.R., Eades, C.G., Thompson, J.A., Huppler, R.E., and Gilbert, P.E. (1976). Эффекты морфино- и налорфиноподобных препаратов у собак с независимыми и зависимыми от морфина хроническими заболеваниями позвоночника. J. Pharmacol. Эксп. тер. 197 (3), 517–532.

Реферат PubMed | Google Scholar

Мартинон Ф., Чен Х., Ли, А.-Х., и Глимчер, Л.Х. (2010). Активация TLR фактора транскрипции XBP1 регулирует врожденные иммунные ответы в макрофагах. Нац. Иммунол. 11 (5), 411–418. doi:10.1038/ni.1857

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

McCloskey, D.J., Postolache, T.T., Vittone, B.J., Nghiem, K.L., Monsale, J.L., Wesley, R.A., et al. (2008). Селективные ингибиторы обратного захвата серотонина: измерение влияния на функцию тромбоцитов. Трансляционное рез. 151 (3), 168–172. doi:10.1016/j.trsl.2007.10.004

Полный текст CrossRef | Google Scholar

Motta Junior, J.D.S., Miggiolaro, A., Nagashima, S., de Paula, C.B.V., Baena, C.P., Scharfstein, J., et al. (2020). Тучные клетки в альвеолярных перегородках пациентов с COVID-19: патогенный путь, который может связать интерстициальный отек с иммунотромбозом. Фронт. Иммунол. 11, 574862. doi:10.3389/fimmu.2020.574862

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Наджи Эсфахани, Х., Рафи Л. и Хагджой Джаванмард С. (2019). Оценка влияния антидепрессанта флувоксамина на экспрессию белка циклооксигеназы-2 в липополисахарид-стимулированных макрофагах. Доп. Биомед. Рез. 8, 5. doi:10.4103/abr.abr_141_18

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Нараян М., Селлар Дж., Маллисон Р. Т., Прайс Л. Х., Нельсон Дж. К. и Нельсон Дж. К. (1998). Блокирующие транспортер серотонина свойства нефазодона оценивали путем измерения уровня серотонина в тромбоцитах. Дж. Клин. Психофармак. 18 (1), 67–71. doi:10.1097/00004714-199802000-00011

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Нарита Н., Хашимото К., Томитака С.-и. и Минабэ Ю. (1996). Взаимодействие селективных ингибиторов обратного захвата серотонина с подтипами σ-рецепторов головного мозга крыс. евро. Дж. Фармакол. 307 (1), 117–119. doi:10.1016/0014-2999(96)00254-3

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Назимек К., Стробель С., Бринярски П., Козловски М., Филипчак-Брынярска И. и Бринярски К. (2017). Роль макрофагов в противовоспалительной активности антидепрессантов. Иммунобиология 222 (6), 823–830. doi:10.1016/j.imbio.2016.07.001

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Nazy, I., Jevtic, S.D., Moore, JC, Huynh, A., Smith, J.W., Kelton, J.G., et al. (2021). Иммунные комплексы, активирующие тромбоциты, выявлены у пациентов с COVID-19 в критическом состоянии с подозрением на гепарин-индуцированную тромбоцитопению. Дж. Тромб. Гемост. doi:10.1111/jth.15283

CrossRef Full Text

Ni, W., and Watts, S.W. (2006). 5-гидрокситриптамин в сердечно-сосудистой системе: внимание на транспортер серотонина (SERT). клин. Эксп. Фармакол. Физиол. 33 (7), 575–583. doi:10.1111/j.1440-1681.2006.04410.x

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Нисимура Т., Ишима Т., Иё М. и Хашимото К. (2008). Потенцирование роста нейритов, вызванного фактором роста нервов, флувоксамином: роль рецепторов сигма-1, рецепторов IP3 и клеточных сигнальных путей. PLoS One 3 (7), e2558. doi:10.1371/journal.pone.0002558

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Огата М., Хино С.-и., Сайто А., Морикава К., Кондо С., Канемото С. и др. (2006). Аутофагия активируется для выживания клеток после стресса эндоплазматического ретикулума. Мкб 26 (24), 9220–9231. doi:10.1128/mcb.01453-06

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Прентис Э., Маколифф Дж., Лу Х., Суббарао К.и Денисон, М. Р. (2004). Идентификация и характеристика белков репликазы коронавируса тяжелого острого респираторного синдрома. Джви 78 (18), 9977–9986. doi:10.1128/jvi.78.18.9977-9986.2004

CrossRef Full Text | Google Scholar

Qiu, Q., Zheng, Z., Chang, L., Zhao, Y.-S., Tan, C., Dandekar, A., et al. (2013). Активация IRE1α, опосредованная Toll-подобным рецептором, как терапевтическая мишень при воспалительном артрите. EMBO J. 32 (18), 2477–2490. дои: 10.1038/emboj.2013.183

Резюме PubMed | Полный текст перекрестной ссылки | Google Scholar

Рафи Л., Хайхашеми В. и Джаванмард С. Х. (2016). Флувоксамин ингибирует экспрессию некоторых воспалительных генов в LPS/стимулированных эндотелиальных клетках человека, макрофагах U937 и индуцированном каррагинаном отеке лапы у крыс. Иран J. Basic Med. науч. 19 (9), 977–984. doi:10.22038/ijbms.2016.7598

PubMed Abstract | Google Scholar

Рамлалл В., Цукер Дж. и Татонетти Н. (2020). Мелатонин в значительной степени связан с выживаемостью интубированных пациентов с COVID-19. medRxiv . doi:10.1101/2020.10.15.20213546

Google Scholar

Ратайчак, М. З., и Куция, М. (2020). Инфекция SARS-CoV-2 и гиперактивация инфламмасомы Nlrp3 как триггер цитокинового «шторма» и фактор риска повреждения гемопоэтических стволовых клеток. Лейкемия 34 (7), 1726–1729. doi:10.1038/s41375-020-0887-9

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Розен Д. А., Секи С. М., Фернандес-Кастанеда А., Бейтер Р.M., Eccles, J.D., Woodfolk, J.A., et al. (2019). Модуляция пути сигма-1 рецептор-IRE1 полезна в доклинических моделях воспаления и сепсиса. науч. Перевод мед. 11 (478), eaau5266. doi:10.1126/scitranslmed.aau5266

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Schloer, S., Brunotte, L., Goretzko, J., Mecate-Zambrano, A., Korthals, N., Gerke, V., et al. (2020). Нацеливание на эндолизосомальный интерфейс хозяин-SARS-CoV-2 с помощью клинически лицензированных функциональных ингибиторов кислой сфингомиелиназы (FIASMA), включая антидепрессант флуоксетин. Emerging Microbes & Infections 9 (1), 2245–2255. doi:10.1080/22221751.2020.1829082

CrossRef Full Text | Google Scholar

Сандстром Дж. Б., Литтл Д. М., Виллинджер Ф., Эллис Дж. Э. и Ансари А. А. (2004). Передача сигналов через Toll-подобные рецепторы запускает репликацию ВИЧ-1 в латентно инфицированных тучных клетках. Дж. Иммунол. 172 (7), 4391–4401. doi:10.4049/jimmunol.172.7.4391

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Сабо, А., Ковач, А., Фречка, Э., и Райнаволджи, Э. (2014). Психоделические N,N-диметилтриптамин и 5-метокси-N,N-диметилтриптамин модулируют врожденные и адаптивные воспалительные реакции через сигма-1-рецептор дендритных клеток, происходящих из моноцитов человека. PLoS One 9 (8), e106533. doi:10.1371/journal.pone.0106533

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Талер М., Гил-Ад И., Короб И. и Вейцман А. (2011). Иммуномодулирующий эффект антидепрессанта сертралина в экспериментальной мышиной модели аутоиммунного энцефаломиелита рассеянного склероза. Нейроиммуномодуляция 18 (2), 117–122. doi:10.1159/000321634

Резюме PubMed | Полный текст перекрестной ссылки | Google Scholar

Талер М., Гиль-Ад И., Ломницкий Л., Коров И., Бахарав Э., Бар М. и др. (2007). Иммуномодулирующий эффект селективных ингибиторов обратного захвата серотонина (СИОЗС) на функцию Т-лимфоцитов человека и экспрессию генов. евро. Нейропсихофармакол. 17 (12), 774–780. doi:10.1016/j.euroneuro.2007.03.010

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Тай, М.З., Пох, К.М., Рения, Л., МакАри, П.А., и Нг, Л.Ф.П. (2020). Триединство COVID-19: иммунитет, воспаление и вмешательство. Нац. Преподобный Иммунол. 20 (6), 363–374. doi:10.1038/s41577-020-0311-8

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Tynan, R.J., Weidenhofer, J., Hinwood, M., Cairns, M.J., Day, T.A., and Walker, F.R. (2012). Сравнительное исследование противовоспалительного действия антидепрессантов SSRI и SNRI на микроглию, стимулированную LPS. Поведение мозга. Иммун. 26 (3), 469–479. doi:10.1016/j.bbi.2011.12.011

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Ulferts, R., van der Linden, L., Thibaut, H.J., Lanke, K.H.W., Leyssen, P., Coutard, B., et al. (2013). Селективный ингибитор обратного захвата серотонина флуоксетин ингибирует репликацию энтеровирусов B и D человека путем нацеливания на вирусный белок 2C. Антимикроб. Агенты Чемотер. 57 (4), 1952–1956. doi:10.1128/aac.02084-12

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Vanhoutte, P.М. (1991). Серотонин тромбоцитарного происхождения, эндотелий и сердечно-сосудистые заболевания. Дж. Кардиовасц. Фармакол. 17 (Прил. 5), С13–С12. doi:10.1097/00005344-19

75-00003

Полный текст CrossRef | Google Scholar

Versteeg, G.A., van de Nes, P.S., Bredenbeek, PJ, and Spaan, WJM (2007). Спайковый белок коронавируса вызывает стресс эндоплазматического ретикулума и повышение концентрации внутриклеточных мРНК хемокинов. Дж. Вирол. 81 (20), 10981–10990.doi:10.1128/jvi.01033-07

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Wang, Z., Lai, Y., Bernard, J.J., Macleod, D.T., Cogen, A.L., Moss, B., et al. (2012). Тучные клетки кожи защищают мышей от вируса коровьей оспы, активируя рецептор тучных клеток S1PR2 и высвобождая противомикробные пептиды. Дж.И. 188 (1), 345–357. doi:10.4049/jimmunol.1101703

Полный текст CrossRef | Google Scholar

Уишарт Д. С., Фынан Ю. Д., Го А. С., Ло Э.Дж., Марку А., Грант Дж. Р. и соавт. (2018). DrugBank 5.0: крупное обновление базы данных DrugBank за 2018 год. Nucleic Acids Res. 46 (Д1), Д1074–Д1082. doi:10.1093/nar/gkx1037

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Xue, M., Fu, F., Ma, Y., Zhang, X., Li, L., Feng, L., et al. (2018). Ответвление развернутого белка PERK негативно регулирует репликацию вируса трансмиссивного гастроэнтерита, подавляя трансляцию белка и способствуя продукции интерферона I типа. Дж. Вирол. 92 (15), e00431–18. doi:10.1128/jvi.00431-18

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Ян Н. и Шен Х.-М. (2020). Ориентация на эндоцитарный путь и процесс аутофагии как новая терапевтическая стратегия при COVID-19. Междунар. Дж. Биол. науч. 16 (10), 1724–1731. doi:10.7150/ijbs.45498

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Юэ Ю., Набар Н. Р., Ши К. С., Каменева О., Сяо С., Хван И.Ю. и др. (2018). Открытая рамка считывания SARS-Coronavirus-3a вызывает мультимодальную некротическую гибель клеток. Cell Death Dis 9 (9), 904. doi:10.1038/s41419-018-0917-y

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Zaid, Y., Guessous, F., Puhm, F., Elhamdani, W., Chentoufi, L., Morris, A.C., et al. (2021). Реакция тромбоцитов на тромбин различается у пациентов с COVID-19 и пациентов с ОРДС, не связанным с COVID-19. Кровь Adv. 5 (3), 635–639. дои: 10.1182/bloodadvances.2020003513

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Зуо Дж., Куинн К.К., Кай С., Купер П., Дамуазо Р. и Крогстад ​​П. (2012). Флуоксетин является мощным ингибитором репликации вируса Коксаки. Антимикроб. Агенты Чемотер. 56 (9), 4838–4844. doi:10.1128/aac.00983-12

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

IFN-α/β, полученный из лейкоцитов, и эпителиальный IFN-λ составляют компартментализованную систему защиты слизистой оболочки, которая ограничивает кишечные вирусные инфекции

Abstract

Эпителиальные клетки являются основным портом входа для многих вирусов, но молекулярные сети, которые защищают барьерные поверхности от вирусных инфекций, изучены не полностью.Вирусные инфекции индуцируют одновременную продукцию интерферонов типа I (IFN-α/β) и типа III (IFN-λ). Считается, что все ядерные клетки реагируют на IFN-α/β, тогда как ответы IFN-λ в основном ограничены эпителиальными клетками. Мы наблюдали, что эпителиальные клетки кишечника, в отличие от гемопоэтических клеток этого органа, экспрессируют только очень низкие уровни функциональных рецепторов IFN-α/β. Соответственно, после перорального инфицирования мышей с дефицитом рецептора IFN-α/β человеческий реовирус типа 3 специфически инфицировал клетки в собственной пластинке, но, что поразительно, не реплицировался продуктивно в эпителиальных клетках кишечника.Напротив, реовирус реплицировался почти исключительно в эпителиальных клетках кишечника мышей с дефицитом рецептора IFN-λ, что свидетельствует о том, что слизистая оболочка кишечника оснащена компартментализованной системой IFN, в которой эпителиальные клетки в основном реагируют на IFN-λ, который они продуцируют после вирусной инфекции, тогда как другие клетки кишечника в основном полагаются на IFN-α/β для противовирусной защиты. У мышей-сосунков с дефицитом рецептора IFN-λ реовирус реплицировался в эпителии кишечника и дополнительно инфицировал эпителиальные клетки, выстилающие желчные протоки, что указывает на то, что младенцы могут использовать IFN-λ для контроля вирусных инфекций в различных тканях, богатых эпителием.Таким образом, IFN-λ следует рассматривать как автономную систему защиты от вирусов слизистой оболочки кишечника и других эпителиальных барьеров, которая могла возникнуть в результате эволюции, чтобы избежать излишне частого срабатывания системы IFN-α/β, которое могло бы вызвать обострение воспаления.

Резюме автора

Вирус-индуцированный интерферон состоит из двух различных семейств молекул, IFN-α/β и IFN-λ. Члены семейства IFN-α/β являются ключевыми противовирусными молекулами, обеспечивающими защиту от большого числа вирусов, поражающих самые разные типы клеток.Напротив, ответы IFN-λ в значительной степени ограничены эпителиальными клетками из-за сильно ограниченной экспрессии родственного рецептора. Интересно, что устойчивость кишечного эпителия к вирусам не зависит от IFN-α/β, а скорее зависит от IFN-λ, что ставит под сомнение преобладающее мнение, что рецепторы для IFN-α/β экспрессируются повсеместно. Здесь мы демонстрируем, что система IFN-α/β не способна компенсировать дефицит IFN-λ при инфекциях эпителиотропными вирусами, поскольку эпителиальные клетки кишечника не экспрессируют функциональных рецепторов для IFN-α/β.Мы также демонстрируем, что инфицированные вирусом кишечные эпителиальные клетки являются мощными продуцентами IFN-λ, что указывает на то, что слизистая оболочка кишечника обладает компартментализованной системой IFN, в которой эпителиальные клетки преимущественно реагируют на IFN-λ, тогда как другие клетки кишечника в основном полагаются на IFN-λ. α/β для противовирусной защиты. Мы предполагаем, что IFN-λ мог развиться как автономная система защиты слизистой оболочки кишечника от вирусов, чтобы избежать излишне частого срабатывания системы IFN-α/β, которая из-за своей мощной активности в отношении иммунных клеток может вызвать обострение воспаления.

Образец цитирования: Mahlakõiv T, Hernandez P, Gronke K, Diefenbach A, Staeheli P (2015) IFN-α/β, полученный из лейкоцитов, и эпителиальный IFN-λ составляют компартментализованную систему защиты слизистой оболочки, которая ограничивает кишечные вирусные инфекции. PLoS Патог 11(4): е1004782. https://doi.org/10.1371/journal.ppat.1004782

Редактор: Гарри Б. Гринберг, Стэнфордский университет, США

Поступила в редакцию: 13 августа 2014 г.; Принято: 3 марта 2015 г.; Опубликовано: 7 апреля 2015 г.

Copyright: © 2015 Mahlakõiv et al.Это статья в открытом доступе, распространяемая в соответствии с лицензией Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника

Доступность данных: Все соответствующие данные находятся в пределах документ и его вспомогательные информационные файлы.

Финансирование: Это исследование было частично поддержано Инициативой передового опыта федерального правительства и правительств земель Германии (GSC-4, Высшая школа Шпемана) и Deutsche Forschungsgemeinschaft (SFB 620).(http://www.dfg.de). Спонсоры не участвовали в разработке исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Введение

Кишечник должен сохранять толерантность к симбиотической микрофлоре желудочно-кишечного тракта, обеспечивая при этом эффективный иммунный ответ при заражении условно-патогенными бактериями или энтеровирусами. Таким образом, слизистая оболочка кишечника, состоящая из выстилающего эпителия и нижележащих клеток собственной пластинки, образует первую линию защиты от патогенных микроорганизмов, попадающих в организм через рот.

Семейство интерферонов I типа (IFN-α/β) представляет собой ключевой элемент врожденной противовирусной защиты [1–5]. У людей семейство IFN типа I включает 13 IFN-α, один IFN-β и несколько второстепенных подтипов IFN (IFN-κ/ε/ω), которые все связываются с одним гетеродимерным комплексом клеточной поверхности, известным как IFN-α/β. рецептор [6]. Взаимодействие с рецептором IFN-α/β активирует сигнальный путь Jak-STAT и индуцирует экспрессию нескольких сотен IFN-стимулируемых генов (ISG), многие из которых проявляют прямую противовирусную активность [7–10].В 2003 г. было открыто семейство ИФН III типа (ИФН-λ), включающее 3 аналогичные молекулы ИФН-λ [11,12]. Вскоре стало ясно, что индукция и механизм действия IFN-λ и IFN I типа очень похожи [13–16], хотя IFN-λ использует для передачи сигналов разные рецепторы. Эти наблюдения подняли вопрос, почему могли возникнуть две, казалось бы, дублирующие антивирусные системы.

Основное различие между системами IFN-α/β и IFN-λ заключается в том, что экспрессия рецептора IFN-λ ограничивается в основном эпителием слизистой оболочки, тогда как рецептор IFN-α/β экспрессируется повсеместно [13].Соответственно, мыши с дефицитом рецептора IFN-α/β проявляют повышенную восприимчивость к большому количеству различных вирусов [2,4]. Напротив, мыши, у которых отсутствуют функциональные рецепторы IFN-λ, довольно хорошо контролируют системные вирусные инфекции и лишь немного более восприимчивы к респираторным вирусам, чем мыши дикого типа [14,16]. Интересно, что мыши с дефицитом как IFN-α/β, так и IFN-λ чрезвычайно восприимчивы к различным респираторным вирусам, демонстрируя дублирование двух систем IFN в легком, богатом эпителиальными клетками [14].

Важность системы IFN типа I для борьбы с кишечными вирусными инфекциями сильно различается в зависимости от контрольного вируса. Например, IFN-α/β играет важную роль в ограничении вирус-индуцированного заболевания после оральной инокуляции мышей полиовирусом или реовирусом человека, но имеет умеренное значение в ограничении ротавируса, проявляющего высокий тропизм к эпителиальным клеткам кишечника [17–17]. 23]. Недавно мы продемонстрировали, что система IFN-λ необходима для эффективного контроля репликации ротавируса в эпителиальных клетках кишечника [23].Это открытие было неожиданным, учитывая тот факт, что рецепторы для IFN-α/β, как полагают, экспрессируются на всех ядерных клетках, и поднял вопрос, почему система IFN-α/β не смогла компенсировать дефицит IFN-λ в этом случае. .

Здесь мы демонстрируем, что эпителиальные клетки кишечника экспрессируют только низкие уровни двух цепей рецепторного комплекса IFN-α/β, имеют низкую плотность рецепторов IFN-α/β на поверхности и, соответственно, очень плохо реагируют на стимуляцию. с ИФН I типа.Интересно, что эпителиальные клетки кишечника не только сильно реагируют на IFN-λ, но также легко продуцируют IFN-λ, но не IFN-α или IFN-β в ответ на вирусные триггеры, что позволяет предположить, что IFN-λ функционирует как автономный противовирусный защитный механизм в эпителии кишечника. что не требует помощи IFN типа I. Эксперименты с вирусным заражением мышей, у которых отсутствуют функциональные рецепторы либо для IFN-α/β, либо для IFN-λ, подтвердили концепцию компартментализованной системы IFN в слизистой оболочке кишечника и подчеркнули исключительно доминирующую роль IFN-λ в противовирусной защите эпителиальных клеток кишечника и желчных протоков.

Результаты

Эпителиальные клетки кишечника демонстрируют низкий уровень экспрессии рецептора IFN-α/β и не реагируют на IFN I типа

Чтобы ответить на вопрос, почему кишечный эпителий плохо защищен интерфероном I типа от инфекции ротавирусом [23], мы измерили экспрессию гена рецептора интерферона в изолированных фракциях кишечных эпителиальных клеток (IEC) и lamina propria лимфоцитов (LPL) взрослых диких животных. типа мышей с помощью количественной ПЦР с обратной транскрипцией (RT-qPCR). Чистоту выделенных клеточных фракций анализировали путем измерения экспрессии маркерных генов эпителиальных клеток ( Cdh2, , кодирующих Е-кадгерин) и лейкоцитов ( Ptprc, , кодирующих CD45) (рис. S1A и S2), а также методом проточной цитометрии с использованием антитела против CD45 и эпителиальный маркер EpCAM (S1B Fig).Как и ожидалось, Ifnlr1 и Il10r2 , кодирующие две цепи рецепторного комплекса IFN-λ, были высоко экспрессированы в IEC, но не в LPL (рис. 1A и S2). Оба компонента рецепторного комплекса IFN I типа, Ifnar1 и Ifnar2 , были высоко экспрессированы в LPL, которые, как хорошо известно, легко реагируют на IFN I типа. Напротив, в IEC мы наблюдали только низкую экспрессию Ifnar1 и Ifnar2 (рис. 1A и S2). Проточный цитометрический анализ показал, что фракции IEC содержали около 5% клеток CD45 + (фиг. S1B).Таким образом, мы использовали сортировку клеток с активированной флуоресценцией для очистки эпителиальных (EpCAM + CD45 ) клеток от сырых фракций IEC и LPL (S1B Fig). Анализ RT-qPCR выявил сильно сниженную экспрессию Ifnar1 и Ifnar2 в очищенных эпителиальных клетках по сравнению с лейкоцитами (EpCAM CD45 + ) (рис. S1C).

Рис. 1. Эпителиальные клетки кишечника минимально экспрессируют рецептор IFN-α/β и не реагируют на IFN I типа.

(A) RT-qPCR анализ цепей рецепторов IFN-α/β ( Ifnar1 и Ifnar2 ) и цепей рецепторов IFN-λ ( Ifnlr1 и Il10r2 ) в эпителиальных клетках кишечника (IEC) лимфоциты собственной пластинки (LPL), выделенные из цельной ткани кишечника взрослых мышей дикого типа (n = 4–8). (B) Экспрессия IFNAR1, проанализированная с помощью проточной цитометрии на фракциях IEC или LPL, полученных от мышей дикого типа или Ifnar1 -/- мышей. (C) Анализ RT-qPCR двух репрезентативных ISG в равновесном состоянии в IEC и LPL, выделенных из мышей дикого типа, Ifnar1 -/- и Ifnlr1 -/- (n = 3 ). (D) Взрослым мышам Ifnar1 -/- и Ifnlr1 -/- дважды подкожно вводили 1 мкг мышиного IFN-λ2 или человеческого IFN-αB/D4 соответственно при ч и 12 ч до умерщвления, как указано.IFN-индуцированный Mx1 в срезах тканей желудочно-кишечного тракта визуализировали с помощью иммунофлуоресценции. IFN-чувствительные клетки содержат ядерный Mx1 (точечные структуры зеленого цвета). Эпителиальные клетки экспрессируют Е-кадгерин (красный). DAPI (синий) окрашивает ядра. Данные репрезентативны для двух-трех независимых экспериментов. Среднее значение ± стандартная ошибка среднего. Бар = 100 мкм. ns = недостоверно, * p<0,05, ** p<0,01, *** p<0,001.

https://doi.org/10.1371/journal.ppat.1004782.g001

Чтобы определить, приведет ли низкая экспрессия Ifnar1 и Ifnar2 в IEC к низким уровням рецептора IFN-α на поверхности клетки, мы использовали IFNAR1-специфическое антитело для экспериментов по иммуноокрашиванию.Анализ FACS подтвердил наличие легко определяемых уровней IFNAR1 в LPL мышей дикого типа, но не Ifnar1 -/- мышей (рис. 1B). Важно отметить, что в этих экспериментальных условиях окрашивание ИЭК от мышей дикого типа было не более интенсивным, чем окрашивание ИЭК от мышей Ifnar1 -/- (рис. 1В), демонстрируя, что экспрессия клеточной поверхности типа Рецептор I IFN на IEC изначально низкий. Эти данные предлагают простое объяснение того, почему IFN типа I противовирусно неэффективен в эпителиальных клетках кишечника.

Мононуклеарные фагоциты безмикробных мышей с трудом вызывают ответ IFN типа I после запуска TLR или опосредованной вирусом иммунной стимуляции [24–26], что позволяет предположить, что сигналы, полученные от комменсальных бактерий, индуцируют исходную передачу сигналов IFN, которая калибрует порог активации различных клеток. типов и определяет, может ли хозяин вызвать своевременную воспалительную реакцию при встрече с патогеном. Мы предположили, что если IEC преимущественно реагируют на IFN-λ, IEC Ifnar1 -/- , но не Ifnlr1 -/- , мыши должны демонстрировать низкий устойчивый ответ IFN.Чтобы оценить эту гипотезу, мы измерили экспрессию двух репрезентативных ISG, Isg15 и Oasl2 , во фракциях IEC и LPL, выделенных из кишечной ткани дикого типа, Ifnar1 -/- и Ifnlr91 . -/- мышей (рис. 1С). Действительно, исходная экспрессия ISG была низкой в ​​IEC мышей Ifnlr1 -/- , но не Ifnar1 -/- мышей. Как и ожидалось, в ЛПЛ наблюдалась обратная картина экспрессии ИСГ, хотя эффект был менее выражен.

Для сравнительного анализа роли IFN I типа и IFN-λ в индукции экспрессии ISG в слизистой оболочке кишечника мышей подкожно обрабатывали высокой дозой рекомбинантного IFN и окрашивали ткани на IFN-индуцированный белок Mx1, который накапливается в ядрах IFN. -ответные клетки. Мышей с нокаутом рецептора IFN использовали для исключения фонового окрашивания Mx1, индуцированного эндогенным IFN. Инъекция IFN-λ мышам Ifnar1 -/- приводила к сильному накоплению Mx1 в ядрах Е-кадгерин-позитивных ИЭК желудочно-кишечного тракта на всем его протяжении (рис. 1D и S1D).Напротив, инъекция IFN-α мышам Ifnlr1 -/- приводила к сильному накоплению Mx1 в ядрах клеток собственной пластинки, но не в IEC (рис. 1D и S1D). Комбинированное лечение IFN-α и IFN-λ Ifnar1 -/- Ifnlr1 -/- контрольных мышей с двойным нокаутом не приводило к обнаруживаемым уровням Mx1 ни в ядрах IECs, ни в клетки области собственной пластинки (S1E Fig).

IFN типа I и IFN-λ играют дублирующую роль в защите легких и эпителия верхних дыхательных путей от эпителиотропных респираторных вирусов [14,27]. В качестве положительного контроля для лечения in vivo IFN мы извлекали ткани дыхательных путей. Интересно, что при анализе образцов тканей из дыхательных путей и кишечника тех же животных на присутствие Mx1 наблюдалась другая картина. Подобно слизистой оболочке кишечника, IFN-λ индуцировал Mx1 исключительно в эпителиальных клетках респираторных тканей (рис. S1F).Однако у животных, получавших IFN-α, широкий спектр типов клеток из легких и трахеи, включая E-кадгерин-положительные эпителиальные клетки, демонстрировал заметное ядерное окрашивание Mx1 (рис. S1F), что указывает на поразительные различия в чувствительности I типа к IFN. в клетках кишечника и дыхательных путей. Окрашивания Mx1 не наблюдалось в тканях дыхательных путей после комбинированного лечения IFN-α и IFN-λ у Ifnar1 -/- Ifnlr1 -/- контрольных мышей с двойным нокаутом (S1G Рис. ).Эти результаты позволяют предположить, что в отличие от эпителиальных клеток легких и трахеи, эпителиальные клетки кишечника полагаются почти исключительно на IFN-λ для противовирусной защиты.

МЭК являются мощными производителями IFN-λ

Лимфоциты являются ключевыми продуцентами IFN I типа в слизистой оболочке кишечника [17,28]. Однако типы клеток, продуцирующих IFN-λ, в кишечнике не идентифицированы. Данные, показанные на рис. 1C, свидетельствуют о конститутивной выработке исходных уровней IFN в кишечнике. Чтобы идентифицировать IFN-продуцирующие клетки в стационарном состоянии, мы отслеживали экспрессию генов IFN I типа и IFN-λ с помощью RT-qPCR в выделенных фракциях IEC и LPL от наивных взрослых мышей дикого типа.Значительная исходная экспрессия генов IFN типа I наблюдалась только в LPL, но не во фракции IEC (рис. 2А). Напротив, базовая экспрессия генов IFN-λ наблюдалась только во фракции IEC (рис. 2А). Анализ очищенных клеток показал, что клетки, продуцирующие IFN-λ, в эпителиальной фракции экспрессируют маркер CD45 (фиг. S3). Следовательно, клетки, продуцирующие IFN-λ, в слизистой оболочке кишечника в стационарном состоянии имеют гемопоэтическое происхождение.

Рис. 2. МЭК являются мощными продуцентами IFN-λ, но не IFN I типа.

(A) Базовая линия экспрессии генов Ifna5 , Ifnb и Ifnl2/3 в IEC и LPL, выделенных из взрослых мышей дикого типа (n = 3), оцененная с помощью RT-qPCR. (B) Взрослым мышам дикого типа (n = 3) внутрибрюшинно вводили 100 мкг поли-I:C, а ткани кишечника собирали через 2 и 6 часов после обработки. Экспрессию Ifna5 , Ifnb и Ifnl2/3 анализировали с помощью RT-qPCR во фракциях IEC и LPL. (C) Стационарный анализ экспрессии гена IFN-λ с помощью RT-qPCR в FACS-отсортированных клетках EpCAM + CD45 и EpCAM CD45 + из эпителиальной фракции.Данные репрезентативны для двух-трех независимых экспериментов. Среднее значение ± стандартная ошибка среднего. * р<0,05, ** р<0,01. Разные буквы над столбцами обозначают значимые различия (p<0,05).

https://doi.org/10.1371/journal.ppat.1004782.g002

Дендритные клетки являются основными продуцентами IFN после вирусной инфекции или стимуляции синтетическим аналогом двухцепочечной РНК poly I:C [29,30]. Действительно, внутрибрюшинная инъекция поли I:C мышам дикого типа вызывала быструю экспрессию генов IFN I и III типов в клетках фракции LPL.Напротив, в этих условиях в клетках фракции IEC индуцировались гены Ifn12/3 , но не гены IFN I типа (фиг. 2B). Интересно, что клетки, сильно экспрессирующие IFN-λ в ответ на поли I:C в эпителиальной фракции, были не лейкоцитами, а в основном эпителиальными клетками EpCAM + (рис. 2C). В совокупности эти эксперименты идентифицировали IEC и фракцию слизистых CD45 + иммунных клеток как важные источники IFN-λ.

IFN-λ ограничивает рост реовируса в эпителии кишечника и ограничивает выделение вируса с фекалиями

В более ранних исследованиях мы использовали ротавирус для оценки роли IFN-λ в желудочно-кишечном тракте [23].Из-за высокой тропности ротавирусов к IECs противовирусные эффекты, опосредованные IFN, в других типах клеток не могут быть оценены с помощью ротавируса. Чтобы определить, почему система IFN разделена на слизистую оболочку кишечника, мы использовали реовирус в качестве модели [17,31–33]. Реовирусы млекопитающих имеют широкий клеточный тропизм и обладают низкой степенью видовой специфичности. После заражения пероральным путем передача сигналов IFN типа I имеет решающее значение для ограничения системной диссеминации реовируса. Напротив, у IFN-компетентных хозяев заболевание, вызванное реовирусом, в основном протекает легко [17,34,35].Действительно, внутрижелудочная инокуляция взрослых мышей Ifnar1 -/- штаммом диринга реовируса человека типа 3 привела к тяжелым неврологическим симптомам, таким как паралич задних конечностей, и у всех Ifnar1 -/- животные должны были быть умерщвлены на 4-й день после заражения. Напротив, никаких симптомов не наблюдалось после заражения взрослых мышей Ifnlr1 -/- и мышей дикого типа (фиг. S4A). Соответственно, репликация реовируса в терминальной ткани тонкого кишечника на 4-й день после заражения была значительно выше у мышей Ifnar1 -/- по сравнению с Ifnlr1 -/- или животными дикого типа (рис. 3А и S4В).

Рис. 3. IFN-λ ограничивает репликацию реовируса в эпителии и определяет выделение вируса с фекалиями, тогда как IFN типа I блокирует репликацию в собственной пластинке и ингибирует системную диссеминацию.

(A-D) Взрослые особи дикого типа (n = 25), Ifnar1 -/- (n = 18) и Ifnlr1 -/- были привиты внутрижелудочно мышам (n = 27) с 10 8 БОЕ реовируса T3D. Данные объединены из нескольких независимых экспериментов.(A) На 4-й день после заражения репликацию реовируса в ткани тонкого кишечника анализировали путем титрования вируса. (B) Титры реовируса в образцах фекалий, собранных у мышей дикого типа и мутантных мышей на 4-й день после заражения. (C, D) Иммуноокрашивание антигена реовируса (зеленый), E-кадгерина (красный) и DAPI (синий) в (C) ткани тонкого кишечника или (D) пейеровых бляшках. Изображения являются репрезентативными для трех независимых экспериментов. Бар = 100 мкм. ns = недостоверно, ** p<0,01, *** p<0,001.

https://дои.org/10.1371/journal.ppat.1004782.g003

Для эффективного распространения фекально-оральным путем энтеровирусы должны высвобождаться из инфицированных тканей в просвет кишечника и выделяться с фекалиями. На рис. 1 мы продемонстрировали, что IFN-λ, но не IFN типа I, индуцирует сильный противовирусный ответ в эпителиальном барьере, который отделяет просвет кишечника от стерильных тканей хозяина. Чтобы изучить роль IFN типа I и типа III в экскреции вируса, мы количественно определили выделение реовируса с фекалиями на 4-й день после заражения.Мы наблюдали высокие титры инфекционного вируса в фекалиях взрослых Ifnar1 -/- и Ifnlr1 -/- , но не мышей дикого типа (рис. 3B). Учитывая сильно различающиеся титры вируса в ткани кишечника (рис. 3А), мыши Ifnar1 -/- выделяли относительно небольшое количество вируса по сравнению с мышами Ifnlr1 -/- . У животных, не хватающих обоих рецепторов IFN ( IFNAR1 8 IFNLR1 ) имели сопоставимые титры вирусов в ткани до IFNAR1 MICE, тогда как вирус в фекалиях было даже выше, чем у мышей Ifnlr1 -/- (рис. S4C).В совокупности эти результаты свидетельствуют о том, что выделяемый вирус может происходить из разных типов клеток у мышей Ifnar1 -/- и Ifnlr1 -/- . Иммуногистохимическое окрашивание образцов ткани тонкой кишки подтвердило эту точку зрения. Антиген реовируса был почти исключительно обнаружен в IEC мышей Ifnlr1 -/- на 4-й день после заражения (рис. 3C, правая панель), тогда как реовирус был ограничен клетками lamina propria в Ifnar1 -/ – мышей (фиг. 3C, средняя панель).Реовирус специфически прилипает к М-клеткам и первоначально реплицируется в клетках слизистой пейеровой бляшки (ПП) [36]. Соответственно, мы обнаружили реовирусный антиген в клетках ПП всех трех линий мышей (рис. 3D). У инфицированных мышей Ifnar1 -/- ПП были увеличены, и наблюдались массивные изменения в структуре фолликул-ассоциированного эпителия (рис. 3D, средняя панель), как описано ранее для реовируса типа 1 [17]. У инфицированных мышей Ifnlr1 -/- подобных изменений структуры ПП не отмечено.Интересно, что реовирусный антиген в Ifnlr1 -/- был обнаружен в эпителии, ассоциированном с фолликулами, а также в подлежащей ткани (рис. 3D, правая панель). Напротив, окрашивание реовируса у животных дикого типа было ограничено несколькими клетками PP, расположенными под эпителием (рис. 3D, левая панель). Эти данные показывают, что реовирус, продуцируемый IEC мышей Ifnlr1 -/- , может легче достигать фекалий, чем вирус, продуцируемый клетками в нижележащих тканях. -/- мышей.

Реовирус реплицируется в эпителиальных клетках кишечника и желчевыводящих путей и вызывает фатальное заболевание печени у мышей-сосунков, лишенных функциональных рецепторов IFN-λ

Тяжелый вирусный гастроэнтерит является серьезной проблемой новорожденных и детей раннего возраста. Точно так же мышата-сосунки гораздо более восприимчивы к заболеваниям, вызванным рота- и реовирусами, чем взрослые животные [37-40]. Поэтому мы задались вопросом, может ли компартментализованная модель ответа IFN, уникальная для слизистой оболочки кишечника, иметь более выраженные последствия для молодых животных.Двухдневные животные дикого типа, Ifnlr1 -/- и Ifnar1 -/- , были перорально инфицированы реовирусом, а титры вируса в тонком и толстом кишечнике были проанализированы на 4-й день. постинфекционный. В отличие от ситуации у взрослых мышей, реовирус чрезвычайно хорошо рос в тканях кишечника мышей-сосунков Ifnlr1 -/- , а титры вируса – в тонкой кишке (рис. 4А) и толстой кишке (рис. S5A) таких животных. были значительно выше, чем у мышей Ifnar1 -/- .Иммуногистохимия выявила тяжелую инфекцию IECs в терминальном отделе тонкой кишки (рис. 4B) и толстой кишке (рис. S5B) у мышей Ifnlr1 -/- , тогда как вирус был в основном локализован в области lamina propria тонкой кишки (рис. 4B). Рис. 4B) у мышей Ifnar1 -/- . Количественное определение инфицированных вирусом клеток продемонстрировало поразительный дифференциальный клеточный тропизм реовируса к эпителиальным и неэпителиальным клеткам тонкой кишки в зависимости от того, были ли дефектными рецепторы для IFN-α или IFN-λ (S5C Fig).Низкие уровни инфекционного реовируса были измерены в ткани кишечника мышей дикого типа (рис. 4А), но вирусный антиген не был обнаружен при иммуноокрашивании (рис. 4В).

Рис. 4. Реовирус интенсивно реплицируется в эпителиальных клетках кишечника и желчевыводящих путей и вызывает фатальное заболевание печени у мышей-сосунков, у которых отсутствуют функциональные рецепторы IFN-λ.

Молочные животные дикого типа (n = 7), Ifnar1 -/- (n = 8) и Ifnlr1 -/- (n = 11) были инфицированы 5 мышами x или ally 10 6 БОЕ реовируса T3D.Данные двух независимых экспериментов были объединены. (A) Титры реовируса в тонком кишечнике на 4-й день после заражения. (B) Иммуноокрашивание ткани тонкого кишечника на 4-й день после заражения на антиген реовируса (зеленый), E-кадгерин (красный) и DAPI (синий). (C) Кинетика выживания мышей дикого типа (n = 11), Ifnar1 -/- (n = 13) и Ifnlr1 -/- (n = 15). (D) Иммуноокрашивание ткани печени, собранной на 4-й день после заражения. Антиген реовируса (зеленый), цитокератин (красный) и DAPI (синий).Стрелки указывают на внутрипеченочные желчные протоки. (E) Иммуноокрашивание внепеченочных желчных протоков на антиген реовируса (зеленый), цитокератин (красный) и DAPI (синий) на 4-й день после заражения. (F) Иммуноокрашивание реовирусного антигена внепеченочных желчных протоков больных мышей Ifnlr1 -/- на 8-й день после заражения. Обратите внимание, что проток заполнен материалом, который, по-видимому, происходит из инфицированных вирусом клеток. Бар = 100 мкм. ** р<0,01, *** р<0,001.

https://дои.org/10.1371/journal.ppat.1004782.g004

В этих экспериментальных условиях у мышей Ifnar1 -/- развились неврологические симптомы, и они умерли от реовирусной инфекции в течение 5–7 дней (рис. 4C). Ifnlr1 -/- мышей не проявляли ранних неврологических симптомов. Однако уже на 9-й день после заражения у них начали развиваться симптомы, характерные для синдрома жирных волос [40], сопровождающиеся остановкой прибавки массы тела. К 13 дню все инфицированные реовирусом Ifnlr1 -/- животные погибли или были умерщвлены из-за тяжелого заболевания (рис. 4С).У большинства инфицированных реовирусом детенышей дикого типа наблюдалось нормальное увеличение веса до 11-го дня, когда у некоторых животных начали развиваться неврологические симптомы, за которыми последовала внезапная потеря веса и смерть в течение следующих нескольких дней (рис. 4C).

После перорального заражения мышей-сосунков реовирус типа 3 может распространяться на внутрипеченочный желчный эпителий (холангиоциты) и в головной мозг, вызывая либо заболевание печени, либо летальный энцефалит [40–43]. Чтобы определить, был ли синдром жирных волос, наблюдаемый у инфицированных мышей Ifnlr1 -/- , обусловлен предпочтительной репликацией реовируса в клетках билиарного эпителия, мы окрашивали печень и внепеченочные желчные канальцы на вирусный антиген на 4-й день после заражения. -инфекция.У этих животных большое количество антигена реовируса действительно было обнаружено во вне- и внутрипеченочных цитокератин-положительных эпителиальных клетках желчных путей, но, по-видимому, не в клетках любого другого типа (рис. 4D и 4E). Напротив, реовирус-положительные клетки присутствовали по всей печени и обнаруживались рядом с эпителиальными клетками внепеченочных желчных протоков мышей Ifnar1 -/- , тогда как эпителий был в значительной степени свободен от вирусов (рис. 4D и 4E). Ни в печени, ни в желчных протоках мышей дикого типа не было вирусных антиген-позитивных клеток (рис. 4D и 4E).Анализ тканей мышей Ifnlr1 -/- , умерших от заболевания, выявил деструкцию билиарного эпителия, накопление вирусного антигена и блокаду желчных протоков (рис. 4F). Окрашивание гематоксилин-эозином ткани печени на 4-й день после заражения выявило клетки воспаления у всех инфицированных реовирусом животных с инфильтратами, локализованными преимущественно вокруг внутрипеченочных желчных протоков у мышей Ifnlr1 -/- (рис. S5D). В совокупности эти исследования инфекций продемонстрировали четкое функциональное разделение IFN I типа и системы IFN-λ в противовирусной защите слизистой оболочки желудочно-кишечного тракта.Кроме того, они показали, что реовирус может специфически нацеливаться на холангиоциты мышей Ifnlr1 -/- , которые заметно экспрессируют функциональные рецепторы IFN-λ [44].

Своевременная продукция IFN-λ эпителиальными клетками способствует быстрому исчезновению кишечной реовирусной инфекции

Чтобы более подробно охарактеризовать систему ИФН слизистой оболочки, мы проанализировали репликацию реовируса в ткани кишечника мышей-сосунков на 1-й и 4-й день после заражения. На 1-й день высокий уровень реовируса был обнаружен как у мышей дикого типа, так и у мутантных мышей с помощью титрования и RT-qPCR.Вирус в значительной степени исчез у мышей дикого типа к 4-му дню, но все еще присутствовал в кишечнике мышей Ifnar1 -/- и Ifnlr1 -/- (рис. 5A и S6A). RT-qPCR анализ РНК, выделенной из цельной ткани кишечника, выявил сильную экспрессию регулируемых IFN генов Isg15 и Oasl2 у мышей дикого типа и Ifnar1 -/- в день 1 (рис. 5B). ). В отличие от этого, у мышей Ifnlr1 -/- не было надлежащего ответа на IFN в 1-й день и наблюдался сильно ослабленный ответ на 4-й день после заражения (фиг. 5B).Аналогичная картина возникла, когда были проанализированы изолированные фракции IEC, а не целые ткани (S6B Fig), что указывает на то, что защитный ответ в кишечнике преимущественно опосредуется IFN-λ, который вырабатывается быстро после вирусной инфекции.

Рис. 5. Своевременная продукция IFN-λ эпителиальными клетками способствует быстрому исчезновению кишечной реовирусной инфекции.

Сощущая дикий тип, IFNAR1 – / – и IFNLR1 и IFNLR1 MICE (N = 3-4) были устно заражены 5 х 10 6 PFU reovirus t3d , и ткань собирали либо на 1-й, либо на 4-й день после заражения.(A) Кинетика репликации реовируса титрованием. (B) Экспрессия IFN-чувствительных генов Isg15 и Oasl2 в цельной ткани кишечника, проанализированная с помощью RT-qPCR. (C) Экспрессия генов Ifna5 , Ifnb и Ifnl2/3 во фракции IEC мышей дикого типа и Ifnlr1 -/- , оцененная с помощью RT-qPCR в день 1 после заражения . (D) Иммуноокрашивание ткани тонкого кишечника на антиген реовируса (красный), Mx1 (зеленый) и DAPI (синий).Пунктиром отмечена граница ворсинок. Бар = 50 мкм. д.и.и. = дни после заражения. Представлены репрезентативные данные для двух отдельных экспериментов. Среднее значение ± стандартная ошибка среднего. Разные буквы над столбцами обозначают значимые различия (p<0,05). * р<0,05.

https://doi.org/10.1371/journal.ppat.1004782.g005

Чтобы визуализировать индуцированный вирусом ответ IFN в слизистой оболочке кишечника во времени и пространстве, мы иммуноокрашивали срезы тканей инфицированных мышей-сосунков на антиген реовируса и Mx1 в 1 и 4 сутки после заражения.В 1-й день в терминальном отделе тонкой кишки мышей дикого типа, Ifnar1 -/- и Ifnlr1 -/- мышей ( Рис 5D). Высокие уровни ядерного Mx1 обнаруживались в большинстве IEC в образцах тканей животных дикого типа и животных уже на 1-й день после заражения. Напротив, сигналы Mx1 не были обнаружены в тканях мышей Ifnlr1 -/- в этот момент времени (рис. 5D, правые панели), что подтверждает, что ранние ответы обусловлены IFN-λ в эпителии.В ранние сроки после заражения клетки собственной пластинки пластинки, которые легко реагируют на экзогенный интерферон типа I (см. рис. 1), не содержали определяемых уровней Mx1 в клетках дикого типа или Ifnlr1 -/- , что позволяет предположить, что тип Продукция I IFN была низкой. К 4-му дню после инфицирования животные дикого типа в значительной степени избавились от вируса, тогда как кишечная ткань мышей Ifnar1 -/- и Ifnlr1 -/- по-прежнему была сильно положительной на реовирус. антиген.Интересно, что на 4-й день после заражения подавляющее большинство инфицированных клеток у мышей Ifnar1 -/- располагалось в области собственной пластинки, а не в эпителии, как на 1-й день, тогда как вирусный антиген оставался ассоциированным с ИЭК у мышей Ifnlr1 -/- мышей (рис. 5D, правые панели). Удаление вируса из IEC мышей дикого типа и Ifnar1 -/- мышей к 4-му дню коррелировало с сильным противовирусным состоянием, индуцированным IFN-λ, визуализируемым сильным окрашиванием эпителия Mx1.Однако у мышей Ifnlr1 -/- только небольшая часть ворсинок была положительной на Mx1 в этот поздний момент времени, что указывает на то, что IFN-λ-независимые противовирусные ответы индуцировались только в небольшой части IECs под действием день 4 (рис. 5D). Эти данные вместе с RT-qPCR-анализом экспрессии ISG (фиг. 5B) демонстрируют, что во время кишечной вирусной инфекции IFN типа I не может компенсировать потерю IFN-λ, что приводит к длительной репликации вируса в эпителиальных клетках.

Минимальная экспрессия Mx1 обнаружена в клетках области lamina propria. Тем не менее, эти клетки оставались защищенными от реовируса у мышей дикого типа и у мышей Ifnlr1 -/- , что позволяет предположить, что продукция IFN типа I во время инфицирования реовирусом была низкой, но защитной (рис. 5D). IFN типа I, который ограничивает системное распространение реовируса и защищает мышей от летальной инфекции, продуцируется дендритными клетками [17]. Продукция IFN-λ в инфицированном вирусом кишечнике до настоящего времени не анализировалась.Более ранние наблюдения показали, что клетки, полученные из эпителия кишечника, являются мощными продуцентами IFN-λ (см. рис. 2). Поэтому мы напрямую измерили экспрессию генов IFN с помощью RT-qPCR во фракциях IEC, выделенных от ложно- и реовирус-инфицированных мышей. Ifnl2/3 , но не гены IFN I типа, значительно индуцировались в клетках мышей дикого типа на 1-й день после инфицирования (фиг. 5C). В препаратах IEC от мышей Ifnlr1 -/- , высокочувствительных к реовирусной инфекции, индукция генов Ifnl2/3 была почти в 100 раз выше, чем у инфицированных мышей дикого типа, тогда как IFN I типа гены не экспрессировались с повышенной скоростью в этот ранний момент времени (фиг. 5C).Наши данные показывают, что IFN-λ, продуцируемый клетками эпителия кишечника, стимулирует ранний противовирусный ответ, который в значительной степени очищает эпителиальные клетки от вируса к 4-му дню. IFN типа I, по-видимому, не играет важной роли на этой ранней стадии реовирусной инфекции. Это скорее предотвращает системное распространение вируса.

Обсуждение

Основной вывод из описанных здесь экспериментов заключается в том, что слизистая оболочка кишечника обладает высококомпартментализованной системой IFN, которая совместно действует для ограничения репликации кишечных вирусов, и что эпителий кишечника представляет собой уникальный клеточный компартмент в организме, который не сильно полагаться на IFN-α/β для противовирусной защиты, а использовать IFN-λ.Мы обнаружили, что IFN-α/β не может индуцировать экспрессию противовирусных генов в кишечном эпителии и не защищает эти клетки от инфицирования кишечным вирусом из-за низкой экспрессии рецепторного комплекса IFN-α/β. Напротив, IFN-λ индуцировал надежную противовирусную защиту в IEC. Гены IFN-λ, но не IFN-α/β экспрессировались на низких, но обнаруживаемых уровнях в слизистой оболочке кишечника неинфицированных животных, а эпителий кишечника продуцировал большое количество IFN-λ, но не IFN-α/β в ответ на лечение мышей. с химическим веществом, индуцирующим интерферон, или после инфицирования реовирусом.Таким образом, кишечный эпителий и собственная пластинка кишечника представляют собой два отдела кишечника, которые не только преимущественно продуцируют, но и предпочтительно реагируют на различные типы IFN.

Мыши, у которых отсутствует функциональный рецептор IFN-α/β, проявляют высокую восприимчивость к большому количеству вирусов, включая некоторые аттенуированные штаммы вирусов, которые не вызывают заболевания у животных дикого типа [2,4,14]. Интересно, однако, что ротавирусы, которые преимущественно инфицируют кишечный эпителий, лишь умеренно ограничиваются передачей сигналов через рецептор IFN типа I [18, 21, 23]. Рецептор IFN-α/β только на очень низком уровне.Точно так же репликация норовируса в кишечнике ограничивается IFN-λ, тогда как IFN типа I контролирует репликацию норовируса во внекишечных участках [45].

Недавние экспериментальные данные указывают на роль IFN-λ в борьбе с вирусами на различных эпителиальных поверхностях, кроме кишечника [15,44]. Однако создается впечатление, что вклад IFN-λ в эти другие участки, включая легкие, в основном уступает вкладу IFN I типа. Представленные здесь данные о реовирусах объясняют наши более ранние наблюдения с ротавирусом мышей, которые указывали на неповторяющуюся роль IFN-λ в эпителиальных клетках кишечного тракта [23].Поскольку реовирус может энергично реплицироваться в эпителии мышей с дефицитом рецептора IFN-λ, он легко проникает в просвет кишечника и выделяется с фекалиями в больших количествах. Сравнительно низкое выделение реовируса с фекалиями, наблюдаемое у мышей с дефицитом рецепторов IFN-α/β, может быть объяснено барьерной функцией почти свободного от вирусов эпителиального слоя, который физически отделяет вируспродуцирующие клетки lamina propria от просвета кишечника.

Ранее мы сообщали о значительной роли IFN-λ в фекальном выделении ротавируса взрослыми мышами [23].Далее мы сообщили, что респираторный SARS-CoV может быть обнаружен в фекалиях мышей, у которых отсутствуют обе системы рецепторов IFN, но не у мышей, у которых отсутствуют только рецепторы IFN-α/β [14]. Соответственно, недавно было показано, что гены Stat1 и Ifnlr1 , но не Ifnar1 ограничивают выделение фекального норовируса у мышей [45]. В совокупности эти результаты указывают на существенную роль IFN-λ в ограничении выделения вируса. Мы предполагаем, что другие цитокины, такие как IFN-γ, также могут вносить свой вклад, но здесь это не исследовалось.Поскольку фекально-оральный путь является основным путем передачи кишечных вирусов человека, таких как полиовирус, норовирус, ротавирус, вирусы гепатита Е и А, возникает соблазн предположить, что IFN-λ помогает ограничить выделение этих важных патогенов человека.

Плазмацитоидные дендритные клетки являются очень мощными продуцентами биологически активных IFN-α/β и IFN-λ [17,46,47], но большинство других типов клеток также способны экспрессировать гены IFN при вирусной инфекции. Несколько недавних исследований показали, что клетки эпителиального происхождения, такие как респираторный эпителий, кератиноциты и гепатоциты, являются потенциальными продуцентами IFN-λ у инфицированных вирусом хозяев [48–55].Мы обнаружили, что как IECs, так и гемопоэтические клетки в эпителии сильно экспрессировали IFN-λ, но не гены IFN-α/β, быстро после стимуляции поли (I:C) и в ответ на реовирусную инфекцию. Таким образом, эпителий слизистой развил механизмы для специфической продукции IFN-λ. Поскольку считается, что сходные сигнальные пути контролируют экспрессию генов IFN-α/β и IFN-λ [56], это наблюдение является неожиданным и позволяет предположить, что индукция генов, кодирующих IFN-α и IFN-β, специфически блокируется в IEC с помощью неизвестный механизм.В поляризованных кишечных эпителиальных клетках MAVS, связанные с пероксисомами, могут предпочтительно запускать экспрессию генов IFN-λ [57], предлагая потенциальное объяснение нашим наблюдениям.

Реовирус, вводимый перорально, имеет широкий тканевой тропизм у мышей с дефицитом рецепторов IFN-α/β, заражая гепатоциты, миокардиоциты и многие другие клетки, в конечном итоге вызывая фатальное заболевание [17,34]. Мы обнаружили, что у мышей-сосунков, у которых отсутствуют функциональные рецепторы для IFN-λ, заболевание протекает мягче, чем у мышей с дефицитом рецепторов IFN-α/β, хотя титры вируса в желудочно-кишечном тракте животных с дефицитом рецепторов IFN-λ были значительно выше.Вероятно, это можно объяснить тем, что тяжелые повреждения кишечного эпителия не имеют непосредственных летальных последствий. Интересно, что у инфицированных реовирусом мышей-сосунков с дефицитом функциональных рецепторов для IFN-λ проявлялись симптомы, напоминающие атрезию желчевыводящих путей [58], которые включали синдром жирного меха и воспаление печени. Билиарная атрезия — редкое заболевание, поражающее одного из 10 000 новорожденных, этиология и патология которого в значительной степени неизвестны. Было высказано предположение, что заражение различными вирусами, включая реовирус типа 3, связано с заболеванием у детей [59,60].Заражение мышей некоторыми штаммами рота- и реовирусов может воспроизводить большинство признаков болезни человека [61,62]. Мы обнаружили вирусный антиген в холангиоцитах наших мышей с дефицитом рецептора IFN-λ, но не мышей дикого типа или дефицита IFN-α/β, которые были инфицированы реовирусом в раннем возрасте, что убедительно свидетельствует о том, что IFN-λ играет решающую роль в защите желчных путей против вирусов. Этот вывод согласуется с нашим недавним открытием, что холангиоциты мышей легко реагируют на экзогенный IFN-λ [44].Основываясь на результатах нашей модельной системы на мышах, можно предположить, что у детей с атрезией желчевыводящих путей может быть генетический дефект в их системе IFN-λ.

Принимая во внимание тот факт, что большинство типов клеток в организме защищены IFN-α/β, наше открытие, что IFN типа I играет незначительную роль в эпителии кишечника, интригует. В этом контексте важно отметить, что IFN-α/β — палка о двух концах. Помимо индукции и регуляции врожденного и приобретенного иммунитета против патогенов и опухолей, IFN-α/β также может вызывать чрезмерное воспаление (обзор в [63]) [64].Хронические вирусные инфекции, такие как ВИЧ или LCMV, могут привести к дисфункции лимфоцитов из-за длительной передачи сигналов IFN [20,65] или рефрактерности к стимуляции IFN в гепатоцитах в случае HCV [66]. Поэтому заманчиво предположить, что кишечный эпителий, находящийся в постоянном контакте с комменсальными бактериями, утратил способность продуцировать и реагировать на IFN-α/β из-за его потенциальных негативных эффектов.

Материалы и методы

Заявление об этике

Все мыши, использованные в исследовании, были выведены в нашем учреждении, и с ними обращались в соответствии с рекомендациями Федерации лабораторных ассоциаций животных (www.felasa.eu/recommendations) и национальным органом по защите животных (Gesellschaft für Versuchstierkunde; www.gv-solas.de/index.html). Эксперименты на животных проводились в соответствии с немецким законом о защите животных (TierSchG) и одобрены местным комитетом по защите животных Фрайбургского университета (разрешение G-12/93).

Мыши

Используемые линии мышей описаны ранее [16]. Вкратце, мыши дикого типа B6.A2G- Mx1 несут интактные аллели Mx1 (дикий тип), B6.A2G- MX1-IFNAR1 – / – Мыши отсутствие функциональных рецепторов IFN-α / β ( IFNAR1 – / –9 ), B6.A2G- MX1-IFNLR1 – / – мышей отсутствие функциональных рецепторов IFN-λ ( IFNLR1 – / – ), и B6.A2G- MX1-IFNAR1

8 – / –

IFNLR1 Double -нокаутные мыши ( Ifnar1 -/- Ifnlr1 -/- ) лишены функциональных рецепторов как для IFN-α/β, так и для IFN-λ.Для экспериментов использовали новорожденных мышей массой 1,5–2 г или молодых взрослых мышей (возраст 6–8 недель).

Клетки и вирус

Штамм Диринга реовируса типа 3 размножали на клеточной линии мышиных фибробластов L929, поддерживаемой в среде DMEM с добавлением 10% FCS. Новорожденным мышам перорально инокулировали 5 мкл супернатанта клеточной культуры, содержащего 5×10 6 БОЕ вируса. Взрослым мышам внутрижелудочно вводили 100 мкл вируса (что соответствует 10 8 БОЕ) с помощью иглы для желудочного зонда 22G.Титры вирусов из фекалий и гомогенатов тканей определяли анализом бляшек на клетках L929. Вкратце, ткань гомогенизировали в 800 мкл PBS, а фекалии в 500 мкл PBS с использованием аппарата FastPrep (MP Biomedicals). Гомогенаты обрабатывали хлороформом (конечная концентрация 10%), кратковременно центрифугировали и серийные разведения водных супернатантов инкубировали на клетках L929 при комнатной температуре. Через 1 ч инокулят удаляли и клетки покрывали 1,5% AVICEL в среде 1x DMEM, содержащей 0.1% БСА. Через четыре дня среду удаляли, клетки фиксировали 4% параформальдегидом и бляшки визуализировали 0,5% кристаллическим фиолетовым.

Лечение in vivo

Один мкг гибридного человеческого IFN-αB/D [67] или мышиного IFN-λ2 (IL-28A; PeproTech) вводили подкожно в 100 мкл PBS. 100 мкг поли I:C вводили внутрибрюшинно в 200 мкл PBS.

Иммуногистохимия

Ткань фиксировали в 4% параформальдегиде при 4°С в течение 24 ч и заливали в парафин.Выделение антигена на депарафинированных срезах ткани толщиной 5 мкм на предметных стеклах проводили в 0,01 М буфере цитрата натрия при 121°С в течение 10 мин. Ткань пермеабилизировали в 0,05% Triton-X100 и блокировали 10% нормальной ослиной сывороткой (Jackson ImmunoResearch) на 1 ч при комнатной температуре. Срезы инкубировали в течение ночи при 4°C с кроличьей антиреовирусной антисывороткой T3D (щедрый подарок Т. Дермоди, Университет Вандербильта), мышиным моноклональным антителом M149 против Mx1 [68], кроличьей поликлональной антисывороткой против Mx1 (AP5) [40] или мышиное моноклональное антипан-цитокератин (Sigma), а затем соответствующее вторичное антитело, конъюгированное с AF555, AF488, Cy3 или Cy5 (Molecular Probes, Jackson ImmunoResearch).E-кадгерин окрашивали конъюгированным с AF647 моноклональным мышиным антителом против E-кадгерина (BD Bioscience Pharmingen). Слайды помещали в DAPI-содержащий Vectashield (Vector Laboratories).

Количественное определение реовирус-позитивных клеток в инфицированных тканях

Срезы тканей окрашивали на антиген реовируса и одновременно на Е-кадгерин для идентификации эпителиальных клеток. Количество реовирус-позитивных клеток, экспрессирующих или не экспрессирующих Е-кадгерин, оценивали путем оценки антиген-реактивных клеток вируса в 3 полях зрения срезов кишечника, полученных как минимум от 3 индивидуумов -/- мышей.

Выделение лейкоцитов IEC и LP

Выделение эпителиальных клеток кишечника и лейкоцитов lamina propria проводили, как описано ранее [69]. Вкратце, всю тонкую кишку собирали, разрезали в продольном направлении и быстро промывали в PBS. Диссоциацию эпителиальных клеток проводили путем инкубации при 37°С в ССРД, содержащем 5 мМ ЭДТА и 10 мМ Hepes, на шейкере в течение 20 мин. Оставшуюся ткань разрезали на кусочки примерно 1 мм 2 перед ферментативным расщеплением диспазой 5 ЕД/мл (BD), 0.5 мг/мл коллагеназы D (Roche) и 0,5 мг/мл ДНКазы A (Sigma-Aldrich). Обогащение лимфоцитов проводили центрифугированием в градиенте Percoll (Sigma-Aldrich). Чистоту выделенных фракций МЭК и ЛПЛ подтверждали анализом экспрессии эпителиальных ( Cdh2 -кодирующих Е-кадгерин) и лейкоцитарных ( Ptprc -кодирующих CD45) маркерных генов.

Проточная цитометрия и сортировка клеток

Суспензии отдельных клеток лимфоцитов собственной пластинки проанализировали с использованием проточного цитометра FACS Canto II и программного обеспечения FACS Diva (BD Biosciences).Для анализа данных использовалось программное обеспечение FlowJo V9.2 (TreeStar). Для анализа экспрессии цепи 1 рецептора IFN α/β на клеточной поверхности использовали меченое PE моноклональное антитело MAR1-5A3 (eBioscience).

Для сортировки клеток кишечного эпителия и лимфоцитов тонкий кишечник разрезали на кусочки размером 1 мм 2 и подвергали ферментативному расщеплению, как описано выше. После блокирования Fc-рецепторов антителами к CD16/CD32 суспензии одиночных клеток инкубировали с флуоресцентными конъюгированными антителами против CD45 и EpCAM.После промывки клетки инкубировали с 4′,6-диамидино-2-фенилиндолом (DAPI) для исключения мертвых клеток и сортировали с использованием сортировщика клеток BD FACSAria III (BD Biosciences).

Экстракция РНК и RT-qPCR

РНК

выделяли с помощью реагента Trizol (Invitrogen) в соответствии с инструкциями производителя. Один мкг РНК подвергали обратной транскрипции с использованием набора для обратной транскрипции QuantiTect (Qiagen). ПЦР в реальном времени проводили с использованием набора QuantiTect SYBR Green PCR Kit (Qiagen) или TaqMan Universal Master Mix с геноспецифическими зондами (Applied Biosystems) и запускали на детекторе последовательностей ABIPrism 7900 (Applied Biosystems).Образцы нормализовали по экспрессии Hprt. Использовали следующие специфичные для мыши анализы TaqMan: Hprt: Mm00446968_m1, Ifnl2/3: Mm04204156_gH, Ifna5: Mm00833976_s1 (Life Technologies). Для анализов на основе SYBR Green использовали следующие праймеры: Ifnb: прямой, 5′-TCAGAATGAGTGGTGGTTGC-3′, обратный, 5′-GACCTTTCAAATGCAGTAGATTC-3′, Isg15: прямой, 5′-GAGCTAGAGCCTGCAGCAAT-3′, обратный, 5′- TTCTGGGCAATCTGCTTCTT -3; Oasl2: вперед, 5’-GGATGCCTGGGAGAGAATCG-3’, назад, 5’-TCGCCTGCTCTTCGAAACTG-3’; Ifnlr1: прямой 5’-GGAACTGAAGTACCAGGTGGA-3’, обратный 5’- GCCATAGGGAGTGTCAGGAA-3’; Il10rb: вперед, 5’-TCTCTTCCACAGCACCTGAA-3’, назад, 5’-GAACACCTCGCCCTCCTC-3’; Ifnar1: вперед, 5’-CATGTGTGCTTCCCACCACT-3’, назад, 5’-TGGAATAGTTGCCCGAGTCC-3’; Ifnar2: вперед, 5’-GACCTTCGGATAGCTGGTGG-3’, назад, 5’-CTCATGATGTAGCCGTCCCC-3’; Ptprc: прямой, 5’-GAACTAAAACACATCTGGGAAAAAATTA-3’, обратный, 5’-GCTTTCATGGTTGTTTTCACC-3’; Cdh2: прямой, 5’-CAGGTCTCCTCATGGCTTTGC-3’, обратный, 5’-CTTCCGAAAAGAAGGCTGTCC-3’.

Статистический анализ

Проверка статистической значимости была проведена на логарифмически преобразованных титрах вируса с помощью непарного t-критерия Стьюдента или однофакторного дисперсионного анализа и теста множественных сравнений Бонферрони с использованием программного обеспечения Prism 4 (программное обеспечение GraphPad).

Дополнительная информация

S1 Рис. Эпителиальные клетки желудочно-кишечного тракта не реагируют на IFN I типа.

(A) RT-qPCR анализ эпителиального маркерного гена Cdh2 (E-кадгерин) и маркерного лейкоцитарного гена Ptprc (CD45) во фракциях IEC и LPL.Данные являются репрезентативными для всех экспериментов по выделению клеток, описанных в тексте. (B) Стратегия Gating для эпителиальных клеток EpCAM + и лимфоидных клеток CD45 + , используемых во всех экспериментах FACS. (C) Гены рецептора IFN анализировали с помощью RT-qPCR в очищенных с помощью FACS лимфоидных клетках CD45 + и эпителиальных клетках EpCAM + либо из фракций IEC, либо из LPL, как указано. (D-G) Взрослый IFNAR1 – / – , IFNLR1

9

и

и IFNAR1 8 IFNLR1

– / –

мышей были обработаны дважды подкожно с 1 мкг мышиного IFN-λ2 и/или человеческого IFN-αB/D за 24 часа и 12 часов до умерщвления, как указано (n = 2).IFN-индуцированный Mx1 в срезах тканей визуализировали с помощью иммунофлуоресценции. IFN-чувствительные клетки содержат ядерный Mx1 (точечные структуры зеленого цвета). (E) Отсутствие IFN-индуцированной экспрессии Mx1 в срезах тканей желудочно-кишечного тракта или (G) дыхательных путей Ifnar1 -/- Ifnlr1 -/- мышей с двойным нокаутом одновременно лечили IFN-λ2 и человеческим IFN-αB/D. (F) Срезы респираторной ткани животных, показанные на (D и рис. 1D), были проанализированы на экспрессию Mx1.Данные являются репрезентативными для нескольких независимых экспериментов. Бар = 100 мкм. Среднее значение ± стандартная ошибка среднего. * р<0,05, ** р<0,01, *** р<0,001.

https://doi.org/10.1371/journal.ppat.1004782.s001

(TIFF)

S2 Рис. Анализ рецепторов ИФН в различных фракциях ткани тонкого кишечника.

Экспрессия гена рецептора IFN, проанализированная с помощью RT-qPCR в цельной ткани кишечника или выделенной фракции IEC, фракции LPL или остатке (строме) (n = 3–5). Буквы над столбиками отмечают значимость значимости (p<0.05). Среднее значение ± стандартная ошибка среднего.

https://doi.org/10.1371/journal.ppat.1004782.s002

(TIFF)

S3 Рис. Гемопоэтические клетки фракции IEC продуцируют IFN-λ в стационарном состоянии.

CD45 + лимфоидные клетки и эпителиальные клетки EpCAM + очищали от фракций IEC и LPL перед анализом экспрессии гена IFN с помощью RT-qPCR (n = 3–5). Среднее значение ± стандартная ошибка среднего. * р<0,05, ** р<0,01, *** р<0,001.

https://doi.org/10.1371/journal.ppat.1004782.s003

(TIFF)

S4 Рис. Заболевание и репликация реовируса в кишечнике в основном контролируются интерфероном I типа у взрослых мышей.

Взрослые мыши дикого типа, Ifnar1 -/- и Ifnlr1 -/- мышей инфицировали внутрижелудочно 10 pfu ТФУ 2 8 900 (A) Кинетика выживания взрослых мышей дикого типа (n = 6), Ifnar1 -/- (n = 5) и Ifnlr1 -/- (n = 13).Данные были объединены из двух независимых экспериментов. д.и.и. = дни после заражения. (B) На 4-й день после заражения репликацию реовируса в терминальной ткани тонкого кишечника анализировали с помощью RT-qPCR (n = 7–9). (C) Взрослым мышам дикого типа или мышам, лишенным функциональных рецепторов IFN, внутрижелудочно вводили 10 8 pfu реовируса T3D. На 4-й день после заражения репликацию реовируса в ткани тонкого кишечника и выделение с калом анализировали путем титрования вируса. Показаны данные, собранные из нескольких независимых экспериментов.ns = недостоверно, ** p<0,01, *** p<0,001

https://doi.org/10.1371/journal.ppat.1004782.s004

(TIFF)

S5 Рис. IFN-λ ограничивает репликацию реовируса и защищает от воспаления печени у мышей-сосунков.

Молочный дикий тип (n = 7), Ifnar1 -/- (n = 8) и Ifnlr1 -/- (n = 11) 5 мышей были или инфицированы 10 6 БОЕ реовируса T3D. Данные объединены из нескольких независимых экспериментов.(A) Титры реовируса в толстой кишке на 4-й день после заражения. (B) Иммуноокрашивание ткани толстой кишки на 4-й день после заражения на антиген реовируса (зеленый), E-кадгерин (красный) и DAPI (синий). (C) Количественное определение инфицированных реовирусом клеток в E-кадгерин-положительных (E-cad + ) и отрицательных (E-cad ) клетках из Ifnlr1 -/- и Ifnar91 -/- мышей. (D) Окрашивание ткани печени гематоксилин-эозином. Изображения являются репрезентативными для нескольких независимых экспериментов.Бар = 100 мкм. Среднее значение ± стандартная ошибка среднего. * р<0,05, *** р<0,001.

https://doi.org/10.1371/journal.ppat.1004782.s005

(TIFF)

S6 Рис. Реакции эпителиальных клеток на реовирусную инфекцию зависят от передачи сигналов рецептора IFN-λ.

Сощущая дикий тип, IFNAR1 – / –

9

и IFNLR1 MICE (N = 3-4) были устно заражены 5 х 10 6 PFU reovirus T3D , а эпителиальные клетки выделяли либо на 1-й, либо на 4-й день после заражения.(A) Кинетика репликации реовируса с помощью RT-qPCR. (B) Экспрессия IFN-чувствительных генов Isg15 и Oasl2 , проанализированная с помощью RT-qPCR. Буквы над столбцами обозначают значимость (p<0,05). Среднее значение ± стандартная ошибка среднего. д.и.и. = дни после заражения.

https://doi.org/10.1371/journal.ppat.1004782.s006

(TIFF)

Благодарности

Мы благодарим Теренса Дермоди (Университет Вандербильта, Нэшвилл, Теннесси) за предоставление антисыворотки против реовируса, а также Томаса Михилса и Отто Халлера за полезные обсуждения.

Авторские взносы

Задумал и спроектировал эксперименты: TM PH AD PS. Выполняли опыты: ТМ PH KG. Проанализированы данные: TM PH AD PS. Предоставленные реагенты/материалы/инструменты для анализа: TM PH AD PS. Написал статью: TM PH PS.

Каталожные номера

  1. 1. Randall RE, Goodbourn S (2008)Интерфероны и вирусы: взаимодействие между индукцией, передачей сигналов, противовирусными реакциями и мерами противодействия вирусам. Дж. Ген Вирол 89: 1–47. пмид:18089727
  2. 2.Haller O, Kochs G, Weber F (2006)Схема реакции интерферона: индукция и подавление патогенными вирусами. Вирусология 344: 119–130. пмид:16364743
  3. 3. van den Broek MF, Muller U, Huang S, Zinkernagel RM, Aguet M (1995)Иммунная защита у мышей, лишенных рецепторов интерферона типа I и/или типа II. Иммунол Ред. 148: 5–18. пмид:8825279
  4. 4. Muller U, Steinhoff U, Reis LF, Hemmi S, Pavlovic J, et al. (1994) Функциональная роль интерферонов типа I и типа II в противовирусной защите.Наука 264: 1918–1921. пмид:8009221
  5. 5. Krause CD, Pestka S (2005)Эволюция цитокинов и рецепторов класса 2 и открытие новых друзей и родственников. Pharmacol Ther 106: 299–346. пмид:156
  6. 6. Теофилопулос А.Н., Баккала Р., Бейтлер Б., Коно Д.Х. (2005)Интерфероны типа I (альфа/бета) в иммунитете и аутоиммунитете. Annu Rev Immunol 23: 307–336. пмид:15771573
  7. 7. Schindler C, Levy DE, Decker T (2007)Передача сигналов JAK-STAT: от интерферонов до цитокинов.J Biol Chem 282: 20059–20063. пмид:17502367
  8. 8. Старк Г.Р., Дарнелл Дж. Э. Младший (2012) Путь JAK-STAT в двадцать лет. Иммунитет 36: 503–514. пмид:22520844
  9. 9. Clarke CJ, Trapani JA, Johnstone RW (2001)Механизмы устойчивости к противовирусным препаратам, опосредованной интерфероном. Curr Drug Targets Immune Endocr Metabol Disord 1: 117–130. пмид:12476793
  10. 10. Schoggins JW, Wilson SJ, Panis M, Murphy MY, Jones CT, et al. (2011) Разнообразный спектр генных продуктов является эффекторами противовирусного ответа интерферона I типа.Природа 472: 481–485. пмид:21478870
  11. 11. Котенко С.В., Галлахер Г., Баурин В.В., Льюис-Антес А., Шен М. и др. (2003) IFN-лямбда опосредует противовирусную защиту через отдельный комплекс рецепторов цитокинов класса II. Нат Иммунол 4: 69–77. пмид:12483210
  12. 12. Шеппард П., Киндсвогель В., Сюй В., Хендерсон К., Шлутсмейер С. и др. (2003) IL-28, IL-29 и их цитокиновый рецептор класса II IL-28R. Нат Иммунол 4: 63–68. пмид:12469119
  13. 13. Sommereyns C, Paul S, Staeheli P, Michiels T (2008) IFN-лямбда (IFN-лямбда) экспрессируется тканезависимым образом и в первую очередь действует на эпителиальные клетки in vivo.PLoS Pathog 4: e1000017. пмид:18369468
  14. 14. Мордштейн М., Нойгебауэр Э., Дитт В., Джессен Б., Ригер Т. и др. (2010) Лямбда-интерферон придает клеткам эпителия дыхательных путей и желудочно-кишечного тракта устойчивость к вирусным инфекциям. Дж. Вирол 84: 5670–5677. пмид:20335250
  15. 15. Mordstein M, Michiels T, Staeheli P (2010) Что мы узнали от мыши с нокаутом рецептора IL28? J Interferon Cytokine Res 30: 579–584. пмид:20649452
  16. 16.Мордштейн М., Кохс Г., Дюмутье Л., Рено Дж. К., Палудан С. Р. и соавт. (2008) Интерферон-лямбда способствует врожденному иммунитету мышей против вируса гриппа А, но не против гепатотропных вирусов. PLoS Pathog 4: e1000151. пмид:18787692
  17. 17. Йоханссон С., Ветцель Дж. Д., Хе Дж., Микасеник С., Дермоди Т. С. и соавт. (2007) Интерфероны типа I, продуцируемые гемопоэтическими клетками, защищают мышей от смертельной инфекции реовирусом млекопитающих. J Exp Med 204: 1349–1358. пмид:17502662
  18. 18.Ангел Дж., Франко М.А., Гринберг Х.Б., Басс Д. (1999)Отсутствие роли интерферонов типа I и типа II в разрешении ротавирусной диареи и инфекции у мышей. J Interferon Cytokine Res 19: 655–659. пмид:10433367
  19. 19. Holloway G, Coulson BS (2013)Врожденные клеточные реакции на ротавирусную инфекцию. Дж. Ген Вирол 94: 1151–1160. пмид:23486667
  20. 20. Тейджаро Дж.Р., Нг С., Ли А.М., Салливан Б.М., Шихан К.С. и др. (2013) Стойкая инфекция LCMV контролируется блокадой передачи сигналов интерферона I типа.Наука 340: 207–211. пмид:23580529
  21. 21. Фэн Н., Ким Б., Фено М., Нгуен Х., Во П. и др. (2008)Роль интерферона при гомологичной и гетерологичной ротавирусной инфекции в кишечнике и внекишечных органах мышей-сосунков. Дж. Вирол 82: 7578–7590. пмид:18495762
  22. 22. Ока С., Игараси Х., Нагата Н., Сакаи М., Койке С. и др. (2007) Создание системы пероральной инфекции полиовируса у трансгенных мышей, экспрессирующих рецептор полиовируса человека, у которых дефицит альфа/бета рецептора интерферона.Дж. Вирол 81: 7902–7912. пмид:17507470
  23. 23. Pott J, Mahlakoiv T, Mordstein M, Durr CU, Michiels T, et al. (2011) IFN-лямбда определяет противовирусную защиту эпителия кишечника. Proc Natl Acad Sci USA 108: 7944–7949. пмид:21518880
  24. 24. Танигути Т., Такаока А. (2001)Слабый сигнал для сильных реакций: пересмотр интерферона-альфа/бета. Nat Rev Mol Cell Biol 2: 378–386. пмид:11331912
  25. 25. Ганал С.К., Санос С.Л., Каллфасс С., Оберле К., Джонер С. и др.(2012)Примирование естественных клеток-киллеров неслизистыми мононуклеарными фагоцитами требует инструктивных сигналов от комменсальной микробиоты. Иммунитет 37: 171–186. пмид:22749822
  26. 26. Abt MC, Osborne LC, Monticelli LA, Doering TA, Alenghat T, et al. (2012)Комменсальные бактерии калибруют порог активации врожденного противовирусного иммунитета. Иммунитет 37: 158–170. пмид:22705104
  27. 27. Crotta S, Davidson S, Mahlakoiv T, Desmet CJ, Buckwalter MR, et al. (2013) Интерфероны типа I и типа III управляют избыточными петлями амплификации, чтобы индуцировать транскрипционную сигнатуру в инфицированном гриппом эпителии дыхательных путей.PLoS Pathog 9: e1003773. пмид:24278020
  28. 28. Сен А., Ротенберг М.Е., Мукерджи Г., Фенг Н., Калиски Т. и соавт. (2012)Врожденный иммунный ответ на гомологичную ротавирусную инфекцию в эпителии ворсинок тонкого кишечника при разрешении одной клетки. Proc Natl Acad Sci USA 109: 20667–20672. пмид:23188796
  29. 29. Каваи Т., Акира С. (2006)Распознавание вирусной инфекции врожденным иммунитетом. Нат Иммунол 7: 131–137. пмид:16424890
  30. 30. Колонна М., Круг А., Целла М. (2002) Клетки, продуцирующие интерферон: на переднем крае иммунного ответа против патогенов.Curr Opin Immunol 14: 373–379. пмид:11973137
  31. 31. Fulton JR, Cuff CF (2004)Слизистый и системный иммунитет к кишечной реовирусной инфекции у старых мышей. Опыт Геронтол 39: 1285–1294. пмид:15489051
  32. 32. Чен Д., Рубин Д.Х. (2001)Т-клеточный ответ слизистой оболочки на реовирус. Иммунол Рез. 23: 229–234. пмид:11444387
  33. 33. Major AS, Rubin DH, Cuff CF (1998) Иммунитет слизистых оболочек к реовирусной инфекции. Curr Top Microbiol Immunol 233: 163–177. пмид:9599937
  34. 34.Dionne KR, Galvin JM, Schittone SA, Clarke P, Tyler KL (2011)Передача сигналов интерферона типа I ограничивает реовирусный тропизм в головном мозге и предотвращает смертельную системную инфекцию. Дж. Нейровирол 17: 314–326. пмид:21671121
  35. 35. Рубин Д.Х., Итон М.А., Андерсон А.О. (1986) Реовирусная инфекция у взрослых мышей: гемагглютинин вируса определяет место кишечного заболевания. Микроб Патог 1: 79–87. пмид:2854595
  36. 36. Amerongen HM, Wilson GA, Fields BN, Neutra MR (1994)Протеолитический процессинг реовируса необходим для прикрепления к кишечным М-клеткам.Дж. Вирол 68: 8428–8432. пмид:7525989
  37. 37. Pott J, Stockinger S, Torow N, Smoczek A, Lindner C, et al. (2012) Зависимая от возраста экспрессия TLR3 кишечного эпителия способствует восприимчивости к ротавирусу. PLoS Патог 8: e1002670. пмид:22570612
  38. 38. Арнольд М.М., Сен А., Гринберг Х.Б., Паттон Дж.Т. (2013)Битва между ротавирусом и его хозяином за контроль над сигнальным путем интерферона. PLoS Pathog 9: e1003064. пмид:23359266
  39. 39.Манн М.А., Книпе Д.М., Фишбах Г.Д., Филдс Б.Н. (2002)Нейроинвазия реовируса 3 типа после внутримышечной инокуляции: прямое вторжение в нервные окончания и возрастной патогенез. Вирусология 303: 222–231. пмид:124

  40. 40. Бартон Э.С., Юри Б.Е., Эберт Д.Х., Форрест Дж.К., Коннолли Дж.Л. и др. (2003) Использование сиаловой кислоты в качестве корецептора необходимо для индуцированного реовирусом заболевания желчевыводящих путей. Дж. Клин Инвест 111: 1823–1833. пмид:12813018
  41. 41. Дерриен М., Хупер Дж.В., Филдс Б.Н. (2003) Сегмент гена М2 участвует в способности реовируса типа 3Abney вызывать синдром жирного меха у новорожденных мышей, фенотип, связанный с сегментом гена S1.Вирусология 305: 25–30. пмид:12504537
  42. 42. Уилсон Г.А., Моррисон Л.А., Филдс Б.Н. (1994)Ассоциация гена реовируса S1 с атрезией желчевыводящих путей, индуцированной серотипом 3, у мышей. Дж. Вирол 68: 6458–6465. пмид:8083983
  43. 43. Тайлер К.Л., Лезер Дж.С., Фанг Т.Л., Кларк П. (2010)Экспрессия генов в головном мозге при реовирусном энцефалите. Дж. Нейровирол 16: 56–71. пмид:20158406
  44. 44. Hermant P, Michiels T (2014)Интерферон-лямбда в контексте вирусных инфекций: производство, реакция и терапевтические последствия.J Врожденный иммунитет 6: 563–574. пмид:24751921
  45. 45. Nice TJ, Baldridge MT, McCune BT, Norman JM, Lazear HM и др. (2014)Лямбда-интерферон излечивает стойкую мышиную норовирусную инфекцию при отсутствии адаптивного иммунитета. Наука.
  46. 46. Coccia EM, Severa M, Giacomini E, Monneron D, Remoli ME и соавт. (2004) Вирусная инфекция и агонисты Toll-подобных рецепторов индуцируют дифференциальную экспрессию интерферонов типа I и лямбда в человеческих плазмацитоидных и дендритных клетках, происходящих из моноцитов.Eur J Immunol 34: 796–805. пмид:149
  47. 47. Анк Н., Иверсен М.Б., Бартольди С., Стахели П., Хартманн Р. и соавт. (2008)Важная роль интерферона III типа (IFN-лямбда/IL-28) в TLR-индуцированной противовирусной активности. Дж. Иммунол 180: 2474–2485. пмид:18250457
  48. 48. Ioannidis I, Ye F, McNally B, Willette M, Flano E (2013)Экспрессия Toll-подобных рецепторов и индукция интерферонов типа I и типа III в первичных эпителиальных клетках дыхательных путей. Дж. Вирол 87: 3261–3270.пмид:23302870
  49. 49. Ван Дж., Оберли-Диган Р., Ван С., Никрад М., Фанк С.Дж. и др. (2009) Дифференцированные клетки альвеолярного типа II человека секретируют противовирусный IL-29 (IFN-лямбда 1) в ответ на инфекцию гриппа А. Дж. Иммунол 182: 1296–1304. пмид:1

    75

  50. 50. Джуэлл Н.А., Клайн Т., Мерц С.Е., Смирнов С.В., Флано Э. и соавт. (2010)Лямбда-интерферон является преобладающим интерфероном, индуцируемым инфекцией вируса гриппа А in vivo. Дж. Вирол 84: 11515–11522. пмид:20739515
  51. 51.Хаитов М.Р., Лаза-Станка В., Эдвардс М.Р., Уолтон Р.П., Роде Г. и др. (2009) Респираторная вирусная индукция альфа-, бета- и лямбда-интерферонов в бронхиальных эпителиальных клетках и мононуклеарных клетках периферической крови. Аллергия 64: 375–386. пмид:1

    99
  52. 52. Окабаяси Т., Кодзима Т., Масаки Т., Ёкота С., Имаидзуми Т. и др. (2011) Интерферон типа III, а не типа I, является преобладающим интерфероном, индуцируемым респираторными вирусами в клетках носового эпителия. Вирус Res 160: 360–366.пмид:21816185
  53. 53. Зан С., Рекампер С., Куммерер Б.М., Ферринг-Шмидт С., Бибер Т. и другие. (2011)Доказательства патофизиологической роли интерферона типа III, полученного из кератиноцитов (IFNlambda), при кожной красной волчанке. J Invest Dermatol 131: 133–140. пмид:20720564
  54. 54. Марукян С., Андрус Л., Шихан Т.П., Джонс К.Т., Чарльз Э.Д. и др. (2011)Вирус гепатита С индуцирует интерферон-лямбда и интерферон-стимулированные гены в первичных культурах печени.Гепатология 54: 1913–1923. пмид: 21800339
  55. 55. Томас Э., Гонсалес В.Д., Ли К., Моди А.А., Чен В. и др. (2012) ВГС-инфекция вызывает уникальный врожденный иммунный ответ печени, связанный с сильным производством интерферонов типа III. Гастроэнтерология 142: 978–988. пмид:22248663
  56. 56. Оногучи К., Ёнеяма М., Такемура А., Акира С., Танигучи Т. и др. (2007) Вирусные инфекции активируют гены интерферона типов I и III посредством общего механизма. J Biol Chem 282: 7576–7581.пмид:17204473
  57. 57. Одендалл С., Диксит Э., Ставру Ф., Бирн Х., Франц К.М. и др. (2014)Различные внутриклеточные патогены активируют экспрессию интерферона типа III из пероксисом. Нат Иммунол 15: 717–726. пмид: 24952503
  58. 58. de Carvalho E, Ivantes CA, Bezerra JA (2007)Внепеченочная билиарная атрезия: современные концепции и направления на будущее. J Pediatr (Рио J) 83: 105–120. пмид:17426869
  59. 59. Morecki R, Glaser JH, Cho S, Balistreri WF, Horwitz MS (1982)Билиарная атрезия и реовирусная инфекция типа 3.N Engl J Med 307: 481–484. пмид:6285193
  60. 60. Тайлер К.Л., Сокол Р.Дж., Оберхаус С.М., Ле М., Каррер Ф.М. и др. (1998)Обнаружение РНК реовируса в гепатобилиарных тканях у пациентов с внепеченочной атрезией желчевыводящих путей и кистами холедоха. Гепатология 27: 1475–1482. пмид:9620316
  61. 61. Филлипс П.А., Кист Д., Пападимитриу Дж.М., Уолтерс М.Н., Стэнли Н.Ф. (1969)Хроническая обструктивная желтуха, вызванная реовирусом типа 3 у мышей-отъемышей. Патология 1: 193–203. пмид:4330558
  62. 62.Рипенхофф-Талти М., Шекель К., Кларк Х.Ф., Мюллер В., Уноо И. и др. (1993) Ротавирусы группы А вызывают обструкцию внепеченочных желчевыводящих путей у новорожденных мышей, которым вводили перорально. Педиатр Рез. 33: 394–399. пмид:8386833
  63. 63. Trinchieri G (2010) Интерферон типа I: друг или враг? J Exp Med 207: 2053–2063. пмид:20837696
  64. 64. Дэвидсон С., Кротта С., МакКейб Т.М., Вак А. (2014) Патогенный потенциал альфа-интерферона при острой гриппозной инфекции. Нац. коммуна 5: 3864.пмид:24844667
  65. 65. Boasso A, Hardy AW, Anderson SA, Dolan MJ, Shearer GM (2008)ВИЧ-индуцированный катаболизм интерферона I типа и триптофана вызывает дисфункцию Т-клеток, несмотря на фенотипическую активацию. PLoS One 3: e2961. пмид:18698365
  66. 66. Makowska Z, Duong FH, Trincucci G, Tough DF, Heim MH (2011)Передача сигналов интерферона-бета и интерферона-лямбда не зависит от индуцированной интерфероном рефрактерности к интерферону-альфа in vivo. Гепатология 53: 1154–1163. пмид:21480323
  67. 67.Horisberger MA, de Staritzky K (1987) Рекомбинантный человеческий интерферон-альфа-гибрид B/D с широким кругом хозяев. J Gen Virol 68 (часть 3): 945–948.
  68. 68. Flohr F, Schneider-Schaulies S, Haller O, Kochs G (1999) Центральная интерактивная область MxA GTPase человека участвует в активации GTPase и взаимодействии с вирусными структурами-мишенями. FEBS Lett 463: 24–28. пмид:10601631
  69. 69. Санос С.Л., Дифенбах А. (2010)Выделение NK-клеток и NK-подобных клеток из собственной пластинки кишечника.Методы Мол Биол 612: 505–517. пмид: 20033661

Нью-Йорк публикует шокирующее исследование эффективности вакцины против COVID

Штат Нью-Йорк опубликовал отчет с данными о новых случаях COVID-19, госпитализациях и подробные данные за определенный период времени.

Чтобы быть в курсе всех новостей, которыми делится Hudson Valley Post, обязательно следите за Hudson Valley Post на Facebook, загрузите мобильное приложение Hudson Valley Post и подпишитесь на информационный бюллетень Hudson Valley Post.

В четверг губернатор Кэти Хоукул запустила два новых веб-сайта для предоставления расширенных данных о COVID-19.

Первый фокусируется на вариантах COVID-19. Вторая веб-страница включает в себя Отчет о прорывных данных о COVID-19, в котором отображаются прорывные случаи COVID-19, госпитализации и подробные данные за определенный период времени.

Случаи прорыва вакцины определяются как случаи, когда человек дал положительный результат на COVID-19 после полной вакцинации.

Прорывные данные показывают, что по состоянию на сент.20 декабря Департаменту здравоохранения штата Нью-Йорк известно о 78 416 лабораторно подтвержденных случаях прорыва COVID-19 среди полностью вакцинированных людей в штате Нью-Йорк, что соответствует 0,7% полностью вакцинированных людей в возрасте 12 лет и старше.

Кроме того, в штате Нью-Йорк зарегистрировано 5555 госпитализаций по поводу COVID среди полностью вакцинированных людей, что соответствует 0,05% населения полностью вакцинированных людей в возрасте 12 лет и старше.

«Эти результаты показывают, что лабораторно подтвержденные инфекции SARS-CoV-2 и госпитализации с COVID-19 были необычными случаями среди полностью вакцинированных людей», — говорится на веб-сайте.

Оценка эффективности вакцины за неделю с 3 мая 2021 г. показывает, что у полностью вакцинированных жителей Нью-Йорка вероятность заболеть COVID-19 была на 91,8% ниже, чем у непривитых жителей Нью-Йорка.

В середине июля эффективность снизилась, появились новые варианты. Однако чиновники говорят, что падение замедлилось. К неделе 23 августа 2021 года у полностью вакцинированных жителей Нью-Йорка вероятность заболеть COVID-19 была на 77,3% ниже, чем у непривитых жителей Нью-Йорка.

В течение нескольких недель с 3 мая по 23 августа у полностью вакцинированных жителей Нью-Йорка было от 89.5% и на 95,2% меньше шансов быть госпитализированными с COVID-19 по сравнению с непривитыми жителями Нью-Йорка.

Текущая эффективность 89% против госпитализации согласуется с результатами клинических испытаний оригинальной вакцины, которые показали защиту от тяжелого заболевания COVID-19 на этих уровнях, говорят официальные лица.

Будьте в курсе: Веб-сайт CDC о коронавирусе

40 детей пропали без вести из долины Гудзона

Города Гудзонской долины отмечены наградами

Рыба, дышащая воздухом и питающаяся животными, найдена в долине Гудзона, штат Нью-Йорк

9000 Инвазивная рыба из Азия, которая может жить на суше в течение нескольких дней и использует свои острые зубы, чтобы поедать животных, была замечена в долине Гудзона и других частях штата Нью-Йорк.

Заглянуть внутрь: Aston Martin проектирует первый дом в долине Гудзона

Производитель роскошных автомобилей Aston Martin спроектировал безумный дом в долине Гудзона, который теперь выставлен на продажу. Дом называют одним из «самых захватывающих и сложных, построенных в долине Гудзона». Ида удивительная яхта стоимостью 60 миллионов долларов, принадлежащая владельцу НФЛ, которая несколько недель стояла в доке в долине Гудзона.

Гудзонская долина прощается с более чем 70 предприятиями

Удостоенный наград актер продает «шедевр на вершине горы» в Напаноче, графство Ольстер. Посмотрите все фотографии этого впечатляющего “шедевра на вершине горы” ниже: 

Знаете ли вы? Более 100 забавных фактов о долине Гудзона

Знаете ли вы, что Люсиль Болл дебютировала на сцене в долине Гудзона? Как насчет сливочного сыра Филадельфия, который изобрели не в Филадельфии, а в округе Ориндж? Или что особняк в округе Датчесс вдохновил выражение «не отставать от Джонсов»? Узнайте об этих и более чем 100 других интересных фактах о долине Гудзона.

Взгляните на самый дорогой дом на рынке в долине реки Гудзон

Самый дорогой дом, выставленный на продажу во всем штате Нью-Йорк, находится в долине реки Гудзон.

ВЗГЛЯД: Вот 25 лучших мест для жизни в штате Нью-Йорк

Стакер составил список лучших мест для жизни в Нью-Йорке, используя данные Niche. Ниша ранжирует места для жизни на основе множества факторов, включая стоимость жизни, школы, здравоохранение, отдых и погоду. Были включены города, пригороды и поселки.Списки и изображения взяты с сайта realtor.com.

В этом списке представлен широкий выбор предложений: от отличных школ и ночных клубов до пешеходных зон и общественных парков. В некоторых районах наблюдается быстрый рост благодаря появлению новых предприятий, в то время как в других можно заглянуть в историю района благодаря хорошо сохранившейся архитектуре и музеям. Продолжайте читать, чтобы узнать, попал ли ваш родной город в список.

Почти 30 сексуальных преступников из Нью-Йорка с высоким уровнем риска недавно переехали в Гудзонскую долину

Власти Нью-Йорка предупреждают общественность о 30 нью-йоркских сексуальных преступниках, которые недавно переехали в Гудзонскую долину.

Фотографии: Исторический «Hudson Mansion» со сценой со скидкой

Спрятанное сокровище стоимостью в тысячи долларов найдено в Нью-Йорке. ФБР назвало этих людей «самыми разыскиваемыми беглецами». Чиновники просят помощи в их поиске, но предупреждают, что их следует считать «вооруженными и опасными».

Airbnb с самым высоким рейтингом в Нью-Йорке находится в долине Гудзона

Вам не придется покидать Гудзонскую долину, если вы хотите воспользоваться услугами Airbnb в Нью-Йорке с самым высоким рейтингом.

40 детей пропали без вести в долине реки Гудзон

В Нью-Йорке объявлено чрезвычайное положение с применением огнестрельного оружия, откликаются законодатели

Губернатор Куомо объявил первое в стране чрезвычайное положение в связи с насилием с применением огнестрельного оружия в Нью-Йорке.

Всемирно известные знаменитости были замечены на многих предприятиях в долине Гудзона

Фотографии: Многих спасли из затопленных автомобилей в долине Гудзона

Некоторых водителей в долине Гудзона пришлось спасать с крыш их автомобилей.

ПРОДОЛЖАЙТЕ ПОСМОТРЕТЬ: посмотрите, как 50 логотипов компаний выглядели тогда и сейчас вернулся и вызывает «кошмары» в Нью-Йорке.

Полицейские ликвидировали местную преступную организацию в гастрономе Гудзон-Вэлли

Шесть человек были арестованы по подозрению в продаже наркотиков и других товаров в гастрономе Гудзон-Вэлли.

Историческое здание в долине реки Гудзон возродилось как новый бизнес

Историческое здание в долине реки Гудзон получило вторую жизнь как новый бизнес, демонстрирующий красоту региона.

Тогда и сейчас: как изменились рестораны быстрого питания в долине Гудзона

Хотя многие из ваших любимых ресторанов быстрого питания в долине Гудзона десятилетиями оставались на одном и том же месте, их здания почти неузнаваемы по сравнению с тем, как они выглядели раньше .

Fast Food Change

«Мустанг» застрял под тягачом возле I-84 в долине Гудзона

«Мустанг» врезался в тягач с прицепом возле I-84 в долине Гудзона.

Фотографии: Грузовик въезжает в здание в округе Датчесс

Грузовик врезался в здание в округе Датчесс, причинив значительный ущерб.

20 самых удивительных вещей, найденных в LEGOLAND New York в Гошене

LEGOLAND New York в Гошене официально открывается этим летом. Прямо сейчас проходят специальные предварительные просмотры, чтобы гости могли взглянуть на то, что будет в магазине, когда парк откроет свои ворота. Хотя мы не будем рассказывать обо всех сюрпризах, вот лишь некоторые из невероятных мелочей, которые ждут вас во время вашего первого визита в этот невероятный тематический парк.

Legoland

25 закусок, которые стоит попробовать в долине Гудзона

Мы составили список из 25 замечательных закусок, которые стоит попробовать в долине Гудзона!

25 пиццерий, обязательных к посещению в долине Гудзона

Вот несколько мест, которые обязательно стоит попробовать в долине Гудзон:

Выдающиеся профессиональные спортсмены из региона долины Гудзон

Мы составили список 25 профессиональных спортсменов-мужчин из долины Гудзона.

25 виноделен и пивоварен в долине Гудзона, которые стоит посетить

Долина Гудзона известна своими удивительными винодельнями и пивоварнями. Вот список из 25 мест, на которые стоит обратить внимание!

25 лучших походов в долине Гудзона

Мы составили список из 25 лучших походов в долине Гудзона. Все походы имеют разную сложность и продолжительность, поэтому независимо от вашего уровня навыков или количества времени, которое у вас есть, здесь найдется поход для вас.

Топ 25 мест и события, которые делают Rhinebeck, Rhinebeck

8

8

Должен посмотреть фотографии: аварии на самолете возле воды в HUDSON Valley

Многие лучшие перспективы нью-йорка позвонит HUDSON Valley Home

и #39;Потрясающий оазис' С частным озером на продажу в долине Гудзон

Риэлторы говорят, что эта «редкая находка» в «сердце долины Гудзон» является «абсолютным раем».

Куомо делится «отличными новостями» выпускает новые правила COVID для Нью-Йорка «сердце долины Гудзона» — это «абсолютный рай». за помощь в их поиске, но предупреждаю, что их следует считать «вооруженными и опасными».”

Гудзонская долина, штат Нью-Йорк Реакция лидеров на приговор об убийстве Джорджа Флойда

Легальные продажи марихуаны в Нью-Йорке, вероятно, займут годы говорят, что до начала продаж пройдет много времени. Вот почему. 

Куомо, Законодатели штата согласовали многие новые правила для штата Нью-Йорк

Законодатели штата Нью-Йорк приняли бюджет в размере 212 миллиардов долларов, который включает около 4 миллиардов долларов в виде новых налогов, юридических ставки на спорт, школьная помощь и многое другое.

25 красивых живописных мест для пикника в долине Гудзона

Вот список из 25 удивительных мест для пикника, расположенных в долине Гудзона!

23 фотографии, демонстрирующие красоту Минневаски

Если вы любите походы в долину Гудзона, вам обязательно нужно посмотреть на эти потрясающие фотографии

25 самых лучших походов в долине Гудзона

лучшие походы в долине Гудзона. Все походы имеют разную сложность и продолжительность, поэтому независимо от вашего уровня навыков или количества времени, которое у вас есть, здесь найдется поход для вас.

2015 Университетские ученые | Программа университетских стипендий

Омар Аллам
Специальность: Химия
Название проекта: Самовосстанавливающиеся гидрогели с двойной сетью
Комитет: Томас Сири, Химия/IMS (председатель), Дуглас Адамсон, Химия/IMS и /ИМС

Краткое описание проекта: Гидрогели представляют собой трехмерные полимерные сети, в которых сети являются гидрофильными и поэтому легко поглощают воду.Теоретически, поскольку гидрогели содержат такой большой процент воды, они имеют широкий спектр применений; однако они чрезвычайно хрупкие, что ограничивает их использование. Их низкая механическая прочность связана с физическими и химическими свойствами гидрогелей. Эти хрупкие гидрогели состоят из сетей, сшитых ковалентными связями. Это исследование направлено на синтез гидрогелей в виде двойной сетки, в которой полимерные сетки сшиты гидрофобными фрагментами. Теоретически, когда физические сшивки разрушаются, они могут восстанавливаться за счет гидрофобных взаимодействий, что приводит к свойствам самовосстановления.Этот новый дизайн предоставит возможность для новых применений, таких как искусственный хрящ, контактные линзы и каркасы для доставки лекарств.

Омар Аллам – специалист по химии из Мэнсфилда, штат Коннектикут. Выпускник средней школы Гластонбери, он любит приносить пользу своему сообществу, работая волонтером в качестве врача скорой помощи. Омар также подрабатывает помощником шеф-повара в ресторане средиземноморской кухни, где он специализируется на пахлаве. Омар планирует поступить в медицинскую школу после ее окончания.

Prakhar Bansal
Специальность: Молекулярная и клеточная биология
Название проекта: In-Silico AFM Nanoindentation капсидов дикого типа и мутантного вируса Норуолк
Комитет: Эрик Мэй, молекулярно-биологический Кэролин Тешке, молекулярная и клеточная биология, и Виктория Робинсон, молекулярная и клеточная биология

Резюме проекта : Норовирус является основной причиной острого эпидемического гастроэнтерита.Мне интересно посмотреть на динамику белков капсида норовируса. Капсид имеет два основных домена: оболочечный и выступающие домены. Домен оболочки образует основную часть сферической оболочки, а выступающий домен образует аркообразные структуры поверх сферы. Используя молекулярную динамику, я надеюсь лучше охарактеризовать роль выступающих доменов в силе и динамике капсида норовируса путем анализа моделирования наноиндентирования капсида норовируса с выступающими доменами и без них.

Пракхар Бансал преследует B.S. по молекулярной и клеточной биологии со специализацией по математике и степенью магистра. в структурной биологии, биохимии и биофизике. Он любит музыку и участвует в концертной группе Университета Коннектикута, а также в баскетбольных и хоккейных группах. Пракхар надеется поступить в медицинскую школу после ее окончания.

Майкл Бонд
Специальность: Молекулярная и клеточная биология; Индивидуализированный: Химическая биология
Название проекта: Характеристика AK301, нового агента, разрушающего микротрубочки, и идентификация новой контрольной точки рака
Комитет: Чарльз Джардина, молекулярная и клеточная биология (председатель), Деннис Райт, фармацевтические науки, и Уильям Бейли, Химия

Резюме проекта:   Проект My University Scholar исследует влияние разрушения микротрубочек на чувствительность клеток рака толстой кишки к цитокин-индуцированному апоптозу.Наша лаборатория идентифицировала новый агент, разрушающий микротрубочки, известный как AK301, который повышает чувствительность клеток рака толстой кишки к апоптозу. Другие агенты, разрушающие микротрубочки, такие как колхицин, не обладают сенсибилизирующей способностью AK301. Мой проект направлен на то, чтобы понять уникальные свойства митотической остановки, вызванной AK301, с использованием таких методов, как иммунофлуоресцентное окрашивание и визуализация живых клеток. Кроме того, я буду синтезировать новые производные AK301, чтобы повысить эффективность и идентифицировать клеточные мишени, отличные от тубулина.

Майкл Бонд очень увлечен наукой. Всякий раз, когда его нет в классе, вы обычно можете найти его в лаборатории. Его цель — за один день разработать низкомолекулярные ингибиторы для лечения солидных опухолей у детей. Когда он не в лаборатории, ему нравится играть в софтбол и кататься на коньках.

Michael Cantara
Специальность: Engineering
Название проекта: Образование ультрахолодного тримера и создание оптической дипольной ловушки
Комитет: William Stwalley, Physics (председатель), Phillip Gould, Physics, and Edward Eyler, Физика

Резюме проекта: В нашем нынешнем устройстве магнитооптическая ловушка (МОЛ) используется для улавливания атомов рубидия и охлаждения их до ультрахолода (T < 0.001 К) режим. Отсюда теперь можно получать молекулы с помощью фотоассоциации и выполнять точную лазерную спектроскопию высокого разрешения. Мой проект будет включать в себя добавление оптической дипольной ловушки, метода, который не только позволяет улавливать ультрахолодные атомы, но и одновременно увеличивает атомную плотность и снижает атомную температуру. Такое дополнение улучшит будущие эксперименты и приблизит группу к наблюдению многоатомного иона, ультрахолодного Rb 3 + , который, как мы полагаем, никогда не наблюдался при сверхнизких температурах.

Майкл Кантара, родом из Баррингтона, Род-Айленд, получает степень бакалавра и магистра физики. Он планирует продолжить свои исследования в области ультрахолодной атомной и молекулярной физики в кандидатской диссертации. программа после выпуска.
Наверх

Ashley Dumaine
Специальность: Информатика и инженерия
Название проекта: Общий протокол и интерфейс прикладного программирования для беспроводных электроэнцефалографических систем связи
Комитет: Jeffrey Meunier, CSE (председатель), Laurent Michel, CSE, и Роберт Маккартни, CSE

Краткое описание проекта: Электроэнцефалографы (ЭЭГ) — это устройства ввода, доступные в виде коммерческих беспроводных гарнитур, которые способны улавливать сигналы, связанные с выражением лица, эмоциями или даже сосредоточенными мыслями.Они могут использоваться людьми с ограниченными физическими возможностями (например, страдающими параличом нижних конечностей или жертвами БАС) для управления протезами или инвалидными колясками, восстановления подвижности и повышения независимости. Тем не менее, высокоуровневых и многоразовых протоколов для программирования и управления этими ЭЭГ серьезно не хватает, что препятствует разработке сложных модульных приложений управления. Цель этого проекта — заполнить этот пробел и продемонстрировать гибкость таких протоколов и API-интерфейсов с помощью проекта беспилотного летательного аппарата, управляемого разумом.

Эшли Дюмен специализируется на компьютерных науках и инженерии, а также на математике.В настоящее время она работает научным сотрудником в лаборатории UConn VoTeR. После окончания школы планирует поступать в магистратуру.

Shaina Forte
Специальность: Сестринское дело
Название проекта : Новый инструмент, шкала накопленной боли/стресса, измеряющая влияние стресса в раннем возрасте на кишечный микробиом недоношенных детей
Комитет: Xiaomei председатель), Йорг Граф, молекулярная и клеточная биология, и Дебора Макдональд, медсестра

Резюме проекта: Недоношенные дети подвергаются многочисленным стрессовым факторам, в том числе повторным болезненным инвазивным процедурам, во время пребывания в отделении интенсивной терапии новорожденных (ОИТН).Кроме того, текущие исследования подтверждают, что микробиом кишечника недоношенных детей отличается от микробиома здоровых доношенных детей, так что недоношенные дети демонстрируют сниженное разнообразие микробиоты. Мой проект будет измерять накопленные стрессовые факторы, которым недоношенные дети подвергаются в отделении интенсивной терапии новорожденных, исследовать образцы кишечного микробиома этих новорожденных с помощью анализа кала и изучать взаимосвязь кумулятивного стресса в раннем возрасте и образцов микробиома. Я буду использовать и тестировать новый метод измерения накопленного стресса в отделении интенсивной терапии, который, если он окажется более эффективным, поможет будущим исследованиям стресса в раннем возрасте.

Шайна Форте – студентка медсестры из Кантона, штат Массачусетс. После окончания школы планирует стать медсестрой. Однажды она хотела бы поехать медсестрой в развивающуюся испаноязычную страну. В кампусе она посвящает свое время нескольким организациям, которыми она увлечена, включая боксерский клуб UConn, смешанные боевые искусства и клуб бразильского джиу-джитсу.
Наверх

Sonya Haupt
Специальность: Структурная биология и биофизика
Название проекта: Характеристика генов экзополисахарида у археи Haloferax volcanii
Комитет: R.Тейн Папке, молекулярная и клеточная биология (председатель), Виктория Робинсон, молекулярная и клеточная биология, и Дэниел Гейдж, молекулярная и клеточная биология

Резюме проекта: Биопленки представляют собой динамичные, скоординированные образования микроорганизмов внутри самопродуцируемых матриц, состоящих из экзополисахаридов, амилоидных белков и внеклеточной ДНК. Исследования были сосредоточены на видах бактериальных биопленок, но исследования, проведенные Соней, касались вида археонов, Haloferax volcanii . Археи предоставляют новые идеи наряду с аналогичными функциями для сравнения биопленок в разных доменах. H. volcanii также демонстрируют некоторые из самых интересных многоклеточных моделей поведения, когда-либо наблюдавшихся у археи. Используя целевые делеции генов и фенотипический анализ, Соня надеется идентифицировать гены, необходимые для производства экзополисахаридов матрикса, таким образом создавая штамм с дефицитом биопленки для дальнейшего изучения.

Соня Хаупт учится на младшем курсе структурной биологии и биофизики. Она является членом лаборатории Папке в отделе молекулярной и клеточной биологии.Она секретарь и игрок женской команды Ultimate Frisbee Club, а также наездник в программе конного спорта.
Наверх

Asahi Hoque
Специальность: Молекулярная и клеточная биология
Название проекта: Почему женское здоровье — это просто материнское здоровье? Взгляд НПО и государства в Бангладеш
Комитет: Маниша Десаи, Женские гендерные и сексуальные исследования и социология (председатель), Шарин Хертель, Политические науки и права человека, и Виктория Робинсон, Молекулярная и клеточная биология

Резюме проекта: Я изучу НПО, занимающиеся женским здоровьем, и государственную политику в области здравоохранения в Дакке, Бангладеш, чтобы предоставить доказательства того, что в международном масштабе внимание к женщинам как репродуктивным женщинам кажется неравномерным.Я также возьму интервью у ряда лиц, занимающихся учреждением и оказанием медицинской помощи женщинам в Дакке, чтобы определить, как этот международный акцент на репродуктивной способности женщин влияет на эти группы и ограничивает ли это право женщин на здоровье. Выполняя этот проект, я стремлюсь создать диалог о праве женщин на здоровье, чтобы обеспечить более целостный подход к охране здоровья женщин.

Асахи Хок из Чешира, штат Коннектикут, специализируется на молекулярной и клеточной биологии и правах человека, а несовершеннолетние — на WGSS и политологии.Она заядлый правозащитник, киноманка и координатор программы Международной организации детей и младенцев в бедственном положении. Она также занимается исследованиями в лаборатории доктора Робинсона.

Leanne jankelunas
Майор: Наук на животных
Наук на животных
Название на животных
Название проекта: Исследование эффективности антимикробных на антимикробных на
. Комитет:
Кумар Венкитанараянан, зоотехника (председатель), Мэри Энн Амалараджу, зоотехника, и Сандра Бушмич, патобиология

Резюме проекта: Метициллин-резистентный золотистый стафилококк (MRSA) и ванкомицин-резистентный золотистый стафилококк (VRSA) являются патогенными бактериями, у которых развилась устойчивость ко многим антибиотикам.Это значительно сократило возможности лечения пациентов, инфицированных этими микроорганизмами. В моем проекте будет предпринята попытка использовать три противомикробных препарата растительного происхождения (PDA) для повышения чувствительности MRSA и VRSA к метициллину и ванкомицину соответственно. Последствия этого исследования заключаются в возможности открытия нового метода лечения, который будет контролировать развитие дальнейшей лекарственной устойчивости этих бактериальных патогенов.

Линн Янкелунас – это двойная специализация в области зоотехники и патобиологии, она живет в Честере, штат Нью-Йорк.Она мечтает стать ветеринаром Центра по контролю и профилактике заболеваний. После окончания Линн планирует получить степень D.V.M. а также докторскую степень, вероятно, в области микробиологии или смежной области.

Kewa Jiang
Специальность: Молекулярная и клеточная биология
Название проекта: Новый метод эффективного создания рекомбинантных вирусов коровьей оспы
Комитет: Пауло Верарди, PVS (председатель), Mole and Graf и Антонио Гармендиа, PVS

Резюме проекта: Вирус коровьей оспы (VACV) обладает способностью инфицировать широкий спектр клеток млекопитающих и использовался для рекомбинантных вакцин, иммунотерапии и онколитической терапии.Целью этого проекта является разработка более простой и эффективной системы для создания рекомбинантных вирусов коровьей оспы (rVACV). Эта система будет использовать РНК-интерференцию (РНКи) и избирательно подавлять гены, необходимые для репликации вируса. В этом проекте только родительский VACV будет быстро элиминирован путем индуцированного молчания основного гена VACV из родительского/рекомбинантного пула. Такая система значительно ускорит будущие исследования VACV.

Кева Цзян специализируется на молекулярной и клеточной биологии и несовершеннолетнем цифровых искусств.Ее конечная карьерная цель – стать врачом-ученым и сосредоточиться на исследовании инфекционных заболеваний. Она также увлекается цифровыми иллюстрациями на полставки.

Наверх

Рофина Джонкеннеди
Майор: Молекулярная и клетка Биология
Название проекта
Название проекта: Новое открытие антимикробного соединения в Symbiosis

Комитет: Джонатан Классен, Молекулярная и клеточная биология (Стул), Марси Балунас, Фармацевтические науки , и Томас Динс, английский

Резюме проекта:  Эволюция устойчивых к антибиотикам патогенов вызвала острую потребность в открытии новых противомикробных соединений для лекарств.Натуральные продукты остаются лучшим источником молекулярных каркасов, поскольку они обладают структурным и химическим разнообразием, которое можно использовать для разработки лекарств. Вторичные метаболиты, выделяемые микробами, проявляют фармакологически значимую активность и могут служить кандидатами на открытие лекарств. Сосредоточение внимания на минимально исследованных средах, таких как мутуализм насекомых и бактерий, увеличивает вероятность обнаружения новых соединений. Мой проект будет исследовать производство антибиотиков, биосурфактантов и сидерофоров микроорганизмами в симбиозе Trachymyrmex septentrionalis . T.septentrionalis — это вид муравьев, выращивающих грибы, которые вступают в симбиотические отношения с культиваром грибов.

Рофина Джонкеннеди из Фэрфилда, штат Коннектикут, имеет двойную специализацию в области молекулярной и клеточной биологии и английского языка. Она является научным сотрудником в лаборатории доктора Классена (MCB) и планирует получить степень доктора медицины и доктора наук в области микробного патогенеза по окончании учебы. Рофина — преподаватель Центра письма и содиректор ЮНЭЙДС в рамках программы «Модель ООН» Университета Коннектикута.

Шаан Камаль
Специальность: Молекулярная и клеточная биология
Название проекта: Вычислительные исследования молекулярных основ зрительных сигнальных путей
Комитет: Эрик Мэй, Молекулярная и клеточная биология и клеточная биология, и Виктория Робинсон, молекулярная и клеточная биология

Резюме проекта: ФДЭ6 является ключевым ферментом в сигнальном пути зрения, и его чрезвычайно трудно экспрессировать в бактериях.В результате он так и не был выделен, и его атомная структура не была решена, что помешало обширным экспериментальным исследованиям фермента. Чтобы решить проблему экспериментального изучения белка, я буду использовать вычислительный подход к изучению ФДЭ6. Благодаря интенсивному моделированию и использованию таких методов, как управляемая молекулярная динамика, зонтичная выборка и анализ основных компонентов, я надеюсь выяснить, как ФДЭ6 функционирует на молекулярном уровне.

Шаан Камаль – специалист по молекулярной и клеточной биологии из Салема, штат Коннектикут.После окончания школы он планирует поступить в медицинский институт и выучиться на офтальмолога.
Наверх

Элисон Кунц
Специальность: Экология и эволюционная биология
Название проекта: Через роды и поколения: исследование систематики, филогенетики и коэволюции пластиножаберных ленточных червей, филогенетики и коэволюции паразитов и хозяев
Комитет по экологии и биоэволюции Janine Caira: (председатель), Элизабет Джокуш, экология и эволюционная биология, и Эндрю Буш, экология и эволюционная биология

Резюме проекта:  Изучение паразитизма как жизненной стратегии предоставляет уникальную возможность исследовать эволюционные отношения внутри таксонов паразитов, а также между паразитами и связанными с ними хозяевами.Проект университетских ученых Элисон преследует три основные цели: (i) описать новый зоологический род ленточных червей, обнаруженных у скатов, с созданием описаний двух новых видов, (ii) изучить филогенетические отношения между этим новым родом и родственными таксонами ленточных червей, и (iii) оценить степень коэволюции между этими паразитами и их хозяевами. Этот проект способствует современному пониманию разнообразия видов и дает представление об эволюции на уровне видов и совместной эволюции между паразитами и их хозяевами.

Элисон Кунц — специалист по экологии и эволюционной биологии, дополнительный специалист по молекулярной и клеточной биологии, в настоящее время работает научным сотрудником в лаборатории Caira Lab. С юных лет у нее была страсть к паразитам, и она планирует поступить в аспирантуру, чтобы продолжить свои исследования скрытого мира паразитов.

Jessica Laprise
Специальность: Сестринское дело
Название проекта: Выявление знаний и отношения педиатрических медицинских работников к боли
Комитет: Jacqueline and Byls McGrath, Nure Manwor, Nurse (председатель) Сестринское дело

Резюме проекта:  Цель моего проекта – сравнить текущее отношение, знания и пробелы в знаниях/отношениях медицинских работников в Детском медицинском центре Коннектикута и студентов-медсестер в Школе медсестер Университета Коннектикута.Данные будут собираться в рамках опроса педиатрических поставщиков медицинских услуг (PHPKAS), разработанного доктором наук Рене Манворрен, APRN, FAAN. Я преобразовал PHPKAS в устойчивый электронный формат; повышение удобства использования онлайн. Результаты исследования предоставят исходную информацию и будут использоваться для оценки образовательных потребностей и облегчения планирования вмешательств для повышения чувствительности и компетентности в уходе за педиатрическими пациентами с болью.

Джессика Лаприз — студентка бакалавриата по сестринскому делу из Бристоля, Коннектикут; исследовательские интересы включают педиатрическую боль и паллиативную медицину.Она планирует продолжить обучение в аспирантуре и стать опытной медсестрой и педиатрической медсестрой. В свободное время она любит работать волонтером в Детском медицинском центре Коннектикута и ходить на пляж.
Наверх

Диана (Кристина) Маклем
Специальность: Экология и эволюционная биология
Название проекта: Использование местообитаний, распределение популяций и численность Eurycea bislineata и Desmognathus fuscus в пригородном ландшафте
Tracytenhouse Committee: и окружающая среда (председатель), Эрик Шульц, экология и эволюционная биология, и Эшли Хелтон, природные ресурсы и окружающая среда

Резюме проекта:  В этом проекте изучается численность, распространение, состав популяции и использование местообитаний Eurycea bislineata и Desmognathus fuscus в загородных ландшафтах с использованием многогранного подхода, включающего методы экологии дикой природы, генетики и биогеохимия.Саламандры будут собираться в 15 ручьях в Ковентри и Мэнсфилде, штат Коннектикут, и маркироваться с помощью меток для проведения анализа повторной поимки меток. Также будут взяты образцы тканей, а микросателлитный анализ даст представление о системах спаривания, отношениях между братьями и сестрами и эффективном размере популяции. Водная среда обитания будет оцениваться путем измерения распределения отложений и мутности, концентрации хлоридов, а также характеристик бассейна и участка.

Кристина Маклем – специалист по экологии и эволюционной биологии, увлекающийся герпетологией.В Университете Коннектикута Кристина принимала участие в Обществе дикой природы, в клубе UConn Outing Club и даже училась за границей в Коста-Рике. Она проводила исследования в лаборатории доктора Трейси Риттенхаус с первого года обучения.

Эмма Мануэль
Специальность: Биология
Название проекта: Влияние кетогенной диеты на повреждение белков во время осмотического стресса и старения у C.elegans
Комитет: Элейн Ли, кинезиология (председатель, Молекулярная и клеточная биология и Дэвид Даггетт, Молекулярная и клеточная биология

Резюме проекта: Снижение скорости синтеза белка у C. elegans моделей нейродегенеративных заболеваний, акклиматизация к осмотическому стрессу, голодание, изменение диеты и фармакологическое лечение приводят к уменьшению повреждения белков во время стресса и старения. Целью этого проекта является проверка гипотезы о том, что добавление кетона в качестве модели низкоуглеводной кетогенной диеты у C. elegans приводит к уменьшению повреждения белка во время осмотического стресса и естественного старения в моделях нейродегенеративных заболеваний. В рамках проекта Эммы также будет протестирована панель из 10-12 маркеров, идентифицированных в данных транскриптома человека, на предмет необходимости реакции на осмотический стресс во время приема кетона в C.Элеганс . Проект определит консервативные механизмы, с помощью которых низкоуглеводные кетогенные диеты могут быть защитными.

Эмма Мануэль – специалист по биологическим наукам из Южного Виндзора, штат Коннектикут, и она хочет поступить в медицинскую школу. В своих медицинских исследованиях она стремится специализироваться на акушерстве и гинекологии. Вне академических кругов Эмме нравится наставлять детей начальной школы через Big Brothers Big Sisters. Она опытная теннисистка и сестра женского общества Alpha Chi Omega.

Наверх

Эдвард Новиков
Специальность: Электротехника
Название проекта: На пути к автоматическому обнаружению приступов у пациентов с эпилепсией: системный подход и Сабато Сантаньелло, биомедицинская инженерия

Резюме проекта: Эпилепсия поражает более 60 миллионов человек во всем мире с хронически повторяющимися, внезапными и тяжелыми припадками.Судороги представляют собой кратковременные эпизоды нарушения функции головного мозга, вызванные аномальными, синхронными и чрезмерными электрическими разрядами больших групп корковых нейронов. Происхождение неврологического расстройства остается в значительной степени загадочным. Нейростимуляция является альтернативой хирургической резекции у пациентов с эпилепсией и дает многообещающие результаты. Однако его эффективность в решающей степени зависит от времени начала приступа. Таким образом, предлагаемое исследование направлено на разработку новых вычислительных инструментов для обнаружения начала эпилептических припадков, которые помогут клиницистам в более раннем вмешательстве и, в конечном итоге, в лечении в реальном времени с помощью нейростимуляции.

Эдвард Новиков изучает электротехнику и математику со специализацией в области компьютерных наук. В свободное время занимается бальными и латиноамериканскими танцами, фотографией и отдыхом на природе. Эдвард любит проводить время с семьей и стремится получить ученую степень в области естественных наук по окончании учебы.

Giorgina Paiella
Специальность: English
Название проекта: Woman a Machine: The History and Gendered Semiotics of Female Automata
Комитет: Dwight Codr, English (председатель), Margaret Breen, English and Women’s Gender Исследования сексуальности, Митчелл Грин, философия и Аленда Чанг, английский язык

Краткое изложение проекта:  Автоматы, или самодействующие машины, веками занимали литературное и научное воображение.Женский автомат, созданный в форме животных, инструментов и людей обоих полов, пожалуй, наиболее настойчиво переосмысливается из этих сущностей. Этот проект направлен на изучение того, как женские автоматы функционируют в различных литературных произведениях и фильмах, утверждая, что эти гендерно-гендерные, созданные машины являются наиболее актуальными и стойкими метафорами, которые у нас есть для изучения рамок гендера и гендерной перформативности в их взаимодействии с отношениями между человек и машина, творец и сотворенный, аниматор и одушевленный.

Джорджина Пайелла – английская крупная двойная минорка в области философии и женских исследований. Она является президентом Национальной организации женщин UConn (СЕЙЧАС). После выпуска она надеется получить докторскую степень по английскому языку и преподавать в университете.

Шринат-Редди Пингл
Специальность: Биология
Название проекта: Влияние K63-связанного полиубиквитина на активное комплексообразование RIG-I и MDA5
Комитет: Джеймс Коул, молекулярно-биологический ), Элизабет Джокуш, экология и эволюционная биология, и Виктория Робинсон, молекулярная и клеточная биология

Shanicka Reynolds
Специальность: Психология
Название проекта: Медикаментозное лечение депрессии: влияние депренила на мотивацию, усилия и поведение Хробак (Психология)

Описание проекта: Депрессия — это больше, чем чувство грусти.Он может прогрессировать в инвалидизирующее заболевание, которое ухудшает психическое, физическое и социальное здоровье. Одним из самых изнурительных симптомов депрессии является снижение мотивационного поведения. Мотивационные симптомы, такие как усталость и анергия, трудно поддаются лечению, и многие из существующих антидепрессантов неэффективно лечат мотивационные симптомы. Этот проект будет сосредоточен на препарате ингибитора МАО-В, депрениле. Цель состоит в том, чтобы предоставить более подробную характеристику мотивационных эффектов депренила посредством экспериментов.Успешное повышение мотивационного поведения с помощью депренила не только принесет пользу пациентам, страдающим депрессией, но и поможет пациентам с различными расстройствами, такими как болезнь Паркинсона, когда депрессия может быть побочным эффектом их болезни.

Шаника Рейнольдс из Блумфилда, Коннектикут. В настоящее время она является членом исполнительного совета Вест-Индийской студенческой организации, Японской студенческой ассоциации и стипендиатов Роу. После выпуска она надеется отправиться в путешествие, а затем поступить в медицинскую школу, где будет специализироваться на неврологии.
Наверх

Александра Рудольф
Специальность: Науки о животных
Название проекта: Влияние фактора, стимулирующего колонии бычьих гранулоцитов-макрофагов, на апоптоз нейтрофилов молока , зоотехника и Стивен Щепанек, патобиология и ветеринария

Резюме проекта: Мастит, одно из самых серьезных заболеваний, поражающих U.С. молочной промышленности, характеризуется притоком полиморфноядерных нейтрофилов в инфицированную молочную железу. Предыдущие исследования показали, что уровни циркулирующего гранулоцитарно-макрофагального колониестимулирующего фактора (GMCSF) выше у животных, пораженных маститом, по сравнению со здоровыми животными, что позволяет предположить, что GMCSF способствует замедлению апоптоза нейтрофилов во время инфекции мастита. Этот проект исследует регуляцию апоптоза GMCSF путем анализа: (1) кинетики апоптоза в молочных нейтрофилах, обработанных GMCSF, выделенных от здорового и субклинически пораженного маститом молочного скота; и (2) профили экспрессии генов апоптоза в обработанных GMCSF нейтрофилах молока, выделенных из этих групп образцов.

Александра Рудольф намерена получить двойную степень в области зоотехники и молекулярной и клеточной биологии. После окончания учебы она надеется получить степень доктора философии. в генетике.

Сагуне Сакья
Специальность: Фармация
Название проекта : Механизм действия малых соединений на транскрипцию PDGFR
Комитет: Акико Нишияма, физиология и нейробиология (председатель), Даниэль Шварц, физиология и нейробиология

Резюме проекта:   Глиомы — распространенный тип опухоли головного мозга.Глиомы высокой степени злокачественности плохо поддаются лечению и имеют низкую выживаемость. Одним из путей, который приводит к образованию глиомы, является чрезмерная передача сигналов тромбоцитарными факторами роста (PDGF) через рецепторы PDGF α и β (PDGFRα и PDGFRβ). Понижение уровня PDGFR может снижать передачу сигналов PDGF и, следовательно, может снижать пролиферацию опухолевых клеток. В рамках этого проекта будет изучен механизм действия малых молекул, которые, как было обнаружено, подавляют PDGFRα. Цель состоит в том, чтобы углубить понимание формирования глиомы и определить новые лекарственные мишени, которые могут улучшить лечение глиомы.

Сагуне Сакья из Восточного Лайма, Коннектикут. Она занимается фармацевтикой и планирует получить степень доктора философии в Фармацевтической школе Университета Коннектикута. После окончания университета она надеется работать клиническим фармацевтом в больнице.
Наверх

Brendan Smalec
Специальность: Молекулярная и клеточная биология
Название проекта: Взгляд за пределы генетического кода: картирование эпигеномного ландшафта опухолевого генеза и метастазов у ​​белоногих мышей
Комитет: Rachel O’Neill, O’Neill, Молекулярная и клеточная биология (кафедра), Джудит Браун, союзные медицинские науки, и Джин Гивенс, искусство и история искусств

Резюме проекта:   Я буду изучать генетические и геномные аномалии, связанные с естественным раком, проявляющим предсказуемый метастатический характер у Peromyscus leucopus, белоногих мышей.В частности, я буду изучать, как метилирование ДНК, эпигенетический маркер, который связывается с двойной спиралью ДНК, различается между различными геномными элементами у раковых и нераковых людей и типов тканей. Результаты позволят лучше понять, как эпигенетические маркеры играют роль в предрасположенности к раку и прогрессировании заболевания.

Брендан Смалек — студент программы с отличием из Чешира, штат Коннектикут, по специальности молекулярная и клеточная биология и история искусств. Он надеется получить степень доктора философии.D. в области генетики и геномики и проводить исследования, посвященные тому, как динамика генома может управлять как эволюцией, так и болезнями.

Evrett Thompson
Специальность: Молекулярная и клеточная биология
Название проекта : Идентификация клеточных мишеней, которые регулируют ингибирование передачи сигналов hedgehog каркасом витамина D ), Ашис Басу, химия, и Чарльз Джардина, молекулярная и клеточная биология

Резюме проекта:   Сигнальный путь Hedgehog является ключевым регулятором контроля эмбриональной пролиферации и формирования паттернов тканей во время эмбрионального развития.Аберрации в передаче сигналов hedgehog связаны с развитием базально-клеточной карциномы и медуллобластомы. Было показано, что молекулы на основе витаминов D3 и VD3 ингибируют передачу сигналов hedgehog и являются потенциальными противораковыми препаратами. Проект направлен на выявление генов-мишеней, затронутых кальцитриолом, VD3 и селективным ингибитором передачи сигналов hedgehog на основе VD3. Проект также будет работать как подход de novo для выявления потенциальных клеточных мишеней лигандов витамина D.

Эвретт Томпсон из Нью-Милфорда, штат Коннектикут, работает над двойной специализацией в области молекулярной и клеточной биологии и химии.После окончания университета он намерен работать в фармацевтической промышленности, чтобы проводить исследования и разработки новых фармацевтических препаратов. Перейти к началу

Stephanie Vu
Специальность: Физиология и нейробиология
Название проекта: Понимание того, как дорсальная и вентральная субобласти гиппокампа обрабатывают пространственные воспоминания с использованием единичной записи
Комитет: Etan Markchair, Psychology Джексон, физиология и нейробиология, и Роберт Галло, физиология и нейробиология

.

Резюме проекта:   Пирамидальные клетки гиппокампа, или «клетки места», демонстрируют пространственную настройку.Эти клетки активируются в пространственно ограниченных полях, которые вместе создают представление об окружающей среде. При воздействии знакомой среды паттерны возбуждения клеток места остаются относительно постоянными. Напротив, клетки места могут изменять свои паттерны возбуждения или «переназначать» в ответ на изменения контекста окружающей среды или поведения. Этот проект направлен на дальнейшее исследование явления переназначения в гиппокампе с использованием единичной записи у свободно движущегося животного. Мы надеемся функционально отделить дорсальную и вентральную субобласти гиппокампа и получить более глубокое представление о системе пространственной навигации мозга.

Стефани Ву изучает физиологию и нейробиологию. Она впервые познакомилась с исследованиями в области поведенческой неврологии через UConn Mentor Connection и с тех пор была очарована функциями и возможностями мозга. По окончании учебы она надеется поступить в медицинскую школу и продолжить исследования в качестве невролога.

Victoria Wickenheisser
Специальность: Физиология и нейробиология
Название проекта: Циркадный цикл и его значение для обучения, памяти и здоровья
Комитет: Этан Маркус, психология (председатель, физиология и нейробиология), Джозеф Кривелло и Ричард Стивенс, Медицинский центр Калифорнийского университета в Коннектикуте,

.

Резюме проекта:   Мой университетский исследовательский проект включает в себя наблюдение за активностью крыс во время суточного цикла (свет/темнота) как у молодых, так и у пожилых популяций.Часто подразумевается, что сон связан с когнитивной функцией и способностью к обучению, и что с возрастом они ухудшаются. Этот проект направлен на наблюдение за этой взаимосвязью активности / бездействия и когнитивных способностей при выполнении пространственной задачи на протяжении всей жизни. Кроме того, растет поддержка использования светотерапии как формы дополнительной альтернативной медицины. Вторая часть этого проекта будет включать в себя дальнейшие исследования возможностей светотерапии при болезненных состояниях, приводящих к ухудшению памяти, таких как болезнь Альцгеймера.

Виктория Викенхайзер учится на младших курсах физиологии и нейробиологии с дополнительным испанским языком из Чешира, Коннектикут. Она является членом исполнительного совета Студенческого лидерского совета CLAS, сестрой Каппы Альфа Тета, а также заядлым бегуном, танцором и энтузиастом йоги. После окончания школы она планирует поступить в медицинский институт.
Наверх

Алисса Забин
Специальность: Психология
Название проекта: Профессиональные стрессы и последствия для здоровья медсестер исправительных учреждений
Комитет: Блэр Джонсон, психология (председатель), Линн Гудштейн, социология и социология

Резюме проекта:   Более 1.5 миллионов взрослых американцев находятся в заключении по состоянию на 2013 год, потребности исправительных учреждений в медицинской помощи огромны. Медсестры исправительных учреждений обеспечивают большую часть этой помощи, и, несмотря на важность их роли, лишь немногие исследования посвящены их профессиональному стрессу и последствиям для здоровья. Недавнее исследование SHARE показало, что конфликт между работой и семьей остается основной областью профессионального стресса для медсестер исправительных учреждений. Таким образом, текущий проект сравнивает профессиональные стрессоры и последствия для здоровья медсестер, работающих в исправительных и неисправительных учреждениях.В рамках проекта также изучается, как стресс и последствия для здоровья на уровне сообщества соотносятся с индивидуальными уровнями стресса и состояния здоровья медсестер.

Алисса Забин имеет двойную специализацию в области психологии и социологии из Трамбалла, Коннектикут. Она работает в лаборатории SHARP в качестве студента-исследователя. После выпуска Алисса планирует поступить в аспирантуру по промышленной организационной психологии.

Наверх

Произошла ошибка при настройке пользовательского файла cookie

Этот сайт использует файлы cookie для повышения производительности.Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


Настройка браузера на прием файлов cookie

Существует множество причин, по которым файл cookie не может быть установлен правильно. Ниже приведены наиболее распространенные причины:

  • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки браузера, чтобы принять файлы cookie, или спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает, хотите ли вы принимать файлы cookie, и вы отказались.Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файл cookie.
  • Ваш браузер не поддерживает файлы cookie. Попробуйте другой браузер, если вы подозреваете это.
  • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы это исправить, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie.Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Предоставить доступ без файлов cookie потребует от сайта создания нового сеанса для каждой посещаемой вами страницы, что замедляет работу системы до неприемлемого уровня.


Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в файле cookie; никакая другая информация не фиксируется.

Добавить комментарий

Ваш адрес email не будет опубликован.