Таблетки при ротавирусной инфекции: Портал муниципальных образований РТ

Содержание

У нас что-то сломалось. Мы уже занимаемся решением проблемы.

Решение?

1. Перейдите на главную страницу.

2. Подождите несколько минут, и обновите страницу.

3. Вы можете обратиться по телефону горячей линии для оформления заказа или получения консультации.

4. Воспользоваться нашими мобильными приложениями.

Телефоны горячей линии

Свердловская область (343) 216-16-16
Пермский край (342) 215-01-01
Кемеровская область (3842) 45-74-57
Курганская область (3522) 22-30-00
Тюменская область (3452) 67-00-67
Челябинская область (351) 247-90-90
Новосибирская область (383) 284-88-88
Омская область (381) 233-25-25
Республика Татарстан
(843) 204-30-30

Умивир

Внутрь, до приема пищи. Разовая доза: детям с 6 до 12 лет – 100 мг (1 таблетка по 100 мг или 2 таблетки по 50 мг), старше 12 лет и взрослым–200 мг (2 таблетки по 100 мг или 4 таблетки по 50 мг).

Для неспецифической профилактики
При непосредственном контакте с больными гриппом и другими ОРВИ: детям с 6 до 12 лет – по 100 мг, старше 12 лет и взрослым – по 200 мг один раз в день в течение 10-14 дней.
Для предупреждения обострений хронического бронхита, рецидива герпетической инфекции в период эпидемии гриппа и других острых респираторных вирусных инфекций: детям с 6 до 12 лет – по 100 мг, старше 12 лет и взрослым – по 200 мг два раза в день в течение 3 недель.
Для профилактики тяжелого острого респираторного синдрома (при контакте с больными): детям с 6 до 12 лет по – 100 мг, старше 12 лет и взрослым по – 200 мг один раз в день в течение 12-14 дней.

Профилактика послеоперационных осложнений: детям с 6 до 12 лет – по 100 мг, старше 12 лет и взрослым – по 200 мг один раз в день за 2 суток до операции, затем на 2 и 5 сутки после операции.
Для лечения
Грипп, другие острые респираторные вирусные инфекции без осложнений: детям с 6 до 12 лет – по 100 мг, старше 12 лет и взрослым – по 200 мг 4 раза в сутки (каждые 6 часов) в течение 5 суток.
Грипп, другие острые респираторные вирусные инфекции с развитием осложнений (бронхит, пневмония и др.): детям с 6 до 12 лет – по 100 мг, старше 12 лет и взрослым – по 200 мг 4 раза в сутки (каждые 6 часов) в течение 5 суток, затем разовую дозу 1 раз в неделю в течение 4 недель.
Тяжелый острый респираторный синдром: детям старше 12 лет и взрослым – по 200 мг 2 раза в день в течение 8-10 суток.
В комплексном лечении хронического бронхита, герпетической инфекции:
детям с 6 до 12 лет – по 100 мг, старше 12 лет и взрослым – по 200 мг 4 раза в сутки (каждые 6 часов) в течение 5-7 суток, затем разовую дозу 2 раза в неделю в течение 4 недель.
Комплексная терапия острых кишечных инфекций ротавирусной этиологии у детей старше 6 лет: детям с 6 до 12 лет – по 100 мг, старше 12 лет – по 200 мг 4 раза в сутки (каждые 6 часов) в течение 5 суток.

Ротавирусная инфекция. Симптоматика, профилактика, лечение, вакцинация.

Это новый материал, но когда-то Тигренок уже писал на эту тему – “Ротавирусная инфекция. (Учитывайте, что информация содержащаяся  в более ранней статье может быть не совсем актуальной.)

Сейчас мы предлагаем Вам ознакомиться с современным взглядом на данную проблему.

Статью подготовил коллектив педиатров детской клиники Тигренок

Что такое ротавирус и каковы его симптомы? Чем опасна ротавирусная инфекция и как помочь заболевшему ребенку, насколько эффективна вакцинация от данного вируса?

О болезни.

Ротавирусная инфекция — одна из разновидностей острой кишечной инфекции. Она вызывается особым видом вируса – ротавирусом, в народе эту болезнь часто называют «кишечным гриппом».

С первых строк несём ясность – к вирусу гриппа и каким-то его определенным штаммам ротавирус никакого отношения не имеет. Любой грипп способен размножаться и существовать только на слизистых оболочках дыхательных путей. С ротавирусом все иначе, он «обитает» в тонком кишечнике, а потому называть его гриппом в целом не очень правильно.

Впервые ротавирус (под микроскопом напоминающий колесо, а потому и названный так «rota» – колесо (лат.) был обнаружен почти полвека назад австралийскими исследователями. По существующей медицинской статистике 98% детей в возрасте до 3 лет уже хоть раз переболели этим недугом. Передаётся вирус контактным путем — фекально-оральным, это в народе называют «болезнью грязных рук».

Заразиться малыш может от больного человека через игрушки, дверные ручки, посуду, предметы обихода. Вирус чрезвычайно заразен. Специфический иммунитет к ротавирусу хоть и вырабатывается, но почти не имеет значения, поскольку этот вирус имеет массу штаммов и разновидностей – науке их известно уже как минимум 9, а мутации все еще продолжаются.

Все разновидности этого вируса довольно устойчивы к низким температурам, воздействию солнечных лучей и воздуха. Довольно долгое время ротавирус выживает в родниковой и морской воде.

Инкубационный период — это время, которое проходит после того, как вирус попадает в организм, до момента, когда начинается острая стадия заболевания. У разных детей этот промежуток времени различается.

Вирус накапливается, реплицируется, как правило, в течение 3-7 дней. Само заболевание длится около 2-3 дней, еще минимум 5 суток организм восстанавливается после выздоровления.

Заразен ребенок все время с момента инфицирования до окончания восстановительного периода. Даже если малыш уже чувствует себя хорошо, с каловыми массами все равно продолжают выделяться вполне жизнеспособные микрочастицы вируса. Именно по этой причине мы настоятельно не рекомендуем сразу после того, как ребенку стало лучше, отправлять его в детский сад или в школу. Это с очень высокой вероятностью приведет к массовому заражению в детском коллективе.

Вероятность заражения ротавирусом ни в коей степени не зависит от чистоплотности семьи. Даже если мама по нескольку раз в сутки моет и пылесосит весь дом, если заставляет чадо каждый час мыть ручки с мылом, внимательно следит за качеством каждого продукта, который попадает на стол, не дает пить воду сомнительного происхождения – все это почти не снижает риск заболеть ротавирусом.

Наиболее часто вирус атакует детей в возрасте от 6 месяцев до 2 лет. В целом в группе риска находятся дети от рождения до 5 лет. У новорожденного этот недуг случается несколько реже, так как на ребенка первые полгода после его появления на свет оказывает благоприятное влияние материнский «врожденный» иммунитет, которого хватает обычно как раз максимум на полгода. Потом кроха становится более уязвимым.

Всемирная Организация Здравоохранения приводит такие цифры: каждый год на нашей планете ротавирусом заражается около 25 миллионов детей. Большинство выздоравливает довольно быстро и самостоятельно. 2 миллиона малышей попадают в больницы, что приводит к смерти около 500 тысяч детей ежегодно, но не от самой ротавирусной инфекции, а от тяжелых осложнений, которые наступают при ее протекании.

Симптомы.

Можно выделить следующие основные симптомы:
   • Диарея.
   • Рвота
   • Боли в животе.
   • Повышенный метеоризм.
   • Повышение температуры тела.
   • Вялость, бледность кожи.
   • Отсутствие аппетита.

По нашей статистике, абсолютное большинство случаев необъяснимой диареи у малышей до трех лет — проявление ротавирусной инфекции. Иными словами, если ребенок ел все, что обычно, и у него нет признаков пищевого отравления, то расстройство стула в 99% случаев свидетельствует об атаке именно этим видом вирусов.

Ротавирус тропен (имеет особую тягу) к клеткам поджелудочной железы. В разгар заболевания нарушается ее функция. Сперва стул становится маслянистым (плохо смывается), имеет гладкую блестящую поверхность и глинистую консистенцию. Затем развивается транзиторная непереносимость лактазы (это поражаются ворсинки кишечника), стул приобретает все более водянистый характер. Характерны императивные позывы к дефекации.

Создаётся впечатление, что всё, что «входит» в ребёнка, тут же «выходит», не задерживаясь. По этой причине отличить ротавирусную инфекцию от отравления (расстройства, вызванного бактериями) довольно просто — основной подсказкой для родителей должна стать именно консистенция каловых масс. Кашицеобразный понос чаще бывает при отравлении пищей. Понос « с водичкой» – это вирусная диарея, и других вариантов, как правило, нет.

При вирусном поносе каловые массы имеют сероватый окрас и очень резкий неприятный запах. На 2-3 сутки содержимое горшка приобретает глинистую консистенцию и желтовато-серый цвет. Кислый запах сохраняется.

Ротавирусной инфекции свойственно внезапное острое начало – с повышением температуры, рвотой. Иногда рвотные массы могут иметь специфический запах ацетона, аналогично может пахнуть изо рта у ребенка. На следующем этапе развивается энтерит и гастроэнтерит, диарея (до 10-12 походов в туалет в сутки). Могут появиться незначительные респираторные проявления — насморк, першение в горле, боль при глотании, кашель.

О лечении.

Диарея при ротавирусной инфекции обычно проходит за 2-3 дня, но таит в себе довольно серьезную опасность обезвоживания. Практически все летальные случаи, наступившие при этом недуге, стали возможны именно по причине критической потери жидкости, сильной дегидратации. Чем младше ребенок, тем быстрее у него развивается обезвоживание, тем опаснее для него ротавирус. Наиболее тяжело инфекция протекает у грудничков.

Тяжелое осложнение, которое дает ротавирус при сильном обезвоживании — пневмония. Многие случаи дегидратации осложняются серьезными нарушениями нервной системы. Особенно опасны ротавирус и состояние обезвоживания для детей с недостаточным весом.

Главное, что должны научиться делать родители — даже не определять, какого происхождения понос у малыша, а уметь быстро оценить, есть ли у чада признаки обезвоживания. Мы настоятельно рекомендуем  во всех случаях появления диареи у маленького ребенка обращаться к врачу. Но и самим сидеть на месте без дела нельзя — надо внимательно наблюдать.

Если у малыша становится сухим язык, он начинает плакать без слез, более 6 часов не писает и практически не потеет – это веский повод для срочного звонка в «Скорую помощь». Если малыш начал терять сознание, его глаза «запали», а черты лица «заострились», у него поднялась высокая температура — это симптомы чрезвычайно опасные, они свидетельствуют о сильном обезвоживании. Помощь врачей требуется незамедлительно.

В случае начала обезвоживания ребенок, который не может пить достаточное количество жидкости для восстановления баланса в организме, нуждается в введении воды внутривенно. На этом и будет основано лечение в стационаре.

Если признаков обезвоживания нет, родители вполне могут справиться с ротавирусной кишечной инфекцией самостоятельно. И тут главной терапией будет недопущение наступления дегидратации. Для этого ребенка нужно поить. Чем чаще, тем лучше. Питье должно быть не холодным и не горячим, а исключительно комнатной температуры, поскольку именно такая жидкость максимально быстро всасывается в тонком кишечнике. Если малыш отказывается пить глотками, его нужно поить чайной ложкой и почаще, но пить он должен обязательно.

При ротавирусной инфекции мы рекомендуем принимать специальные лекарства, которые должны быть в аптечке каждой семьи, в которой есть малыши — средства для пероральной регидратации (например, «Регидрон», «Хумана Электролит»).

Если такого лекарства нет, купить его нет возможности, то мы рекомендуем воспользоваться рецептом, одобренным Всемирной Организацией Здравоохранения: на литр воды берут 2 ложки сахара, ложку соли и ложку соды. Задача родителей — напоить чадо этим солевым раствором любой ценой. Если не получается, лучше сразу вызвать «Скорую помощь».

Первая помощь.

В целом, алгоритм разумных родительских действий при детском поносе должен выглядеть всегда так:
   • Обильное теплое питье. Частое и дробное. Обычной водой и солевым раствором. Если ребенок каждые 3 часа писает, значит, он потребляет достаточное для недопущения обезвоживания количество жидкости. Если напоить не получается даже с помощью одноразового шприца без иглы — вызвать скорую помощь.
   • Маленького ребенка положить на бок, чтобы в случае приступа рвоты он не захлебнулся рвотными массами.
   • Жаропонижающие средства – только если температура выше 38,5.
   • Следить за состоянием ребенка, не допускать обезвоживания. При первых симптомах дегидратации — вызвать скорую.
   • Не кормить. Если очень просит — давать жидкую кашу или пюре в небольших количествах.

До приезда врача оставить подгузник с каловыми массами или сохранить образец содержимого горшка, чтобы продемонстрировать это врачу. Так доктор сможет быстрее диагностировать заболевание, и вероятность ошибки будет снижена (ротавирус, например, очень похож в начальной стадии на холеру).

Большая ошибка — давать ребенку антибиотики. Недуг имеет вирусное происхождение, а против вирусов антибактериальные препараты совершенно бессильны. Лечить ими ребенка с вирусной диареей — настоящее родительское преступление, поскольку это не только не приносит пользы, но и увеличивает вероятность наступления осложнений.

Еще одна ошибка, которая может дорого стоить родителям — самовольное назначение противодиарейных препаратов (например, «Энтерофурила»). При ротавирусе с каловыми массами выходят вирусные частицы (точнее, их микрочастицы). А потому прекратить понос — значит продлить заболевание, оставить частицы вирусов в тонком кишечнике, где они продолжат еще некоторое время разрушать полезные клетки. С поносом бороться не надо, это защитный механизм организма.

Еще одно заблуждение — эффективность противовирусных средств при кишечной инфекции. Несмотря на то, что некоторые врачи продолжают выписывать противовирусные средства при ротавирусной инфекции, мы настоятельно не рекомендуем принимать их при кишечной инфекции. Конечно, принимать или нет вышеназванные таблетки или сиропы — решать вам. Но вы должны знать, что не существует пока в природе противовирусных препаратов с клинически доказанной эффективностью. Тем более не доказана эффективность этих препаратов в отношении конкретного возбудителя – ротавируса.

Также стоит отказаться от гомеопатических средств («Анаферон», «Оциллокоцинум»). У них с эффективностью и доказанным действием все обстоит еще плачевнее (да, и такое возможно), и покупка таких препаратов станет всего лишь лишней обузой для семейного бюджета и может послужить причиной дополнительного стресса для малыша.

Вакцинация.

Многие страны уже включили вакцинацию от ротавирусной кишечной инфекции в обязательные Национальные календари прививок. В России такой обязательной практики пока нет. Вакцинация от ротавируса, по отчетам западных специалистов, помогает на 80% снизить заболеваемость и на 45% уменьшает риск летального исхода. То есть заражение остается возможным, но протекание болезни будет более легким.

В детской клинике «ТИГРЁНОК» для профилактики ротавирусной инфекции применяется вакцина РотаТек. Вакцины принимается перорально (в виде капель в рот). РотаТек содержит в своем составе искусственно ослабленный в лабораторных условиях живой ротавирус в малых количествах.В большинстве случаев вакцина не вызывает аллергических реакций и побочных действий, она довольно легко переносится даже самыми маленькими пациентами.

Рекомендуемые сроки вакцинации — от 1,5 месяцев до полугода. Детям старше делать прививку нецелесообразно. Всего вводятся 3 дозы вакцины. Стандартная рекомендуемая схема вакцинации РотаТек: 2 – 3 – 4,5 месяцев.

Естественно, вакцинацию не будут делать ребенку, который болен в настоящий момент, также прививка от ротавируса противопоказана малышам с врожденными пороками развития желудочно-кишечного тракта. Как и перед любой вакцинацией, перед вакцинацией РотаТеком надо показаться педиатру с результатами анализов (клинический анализ крови и общий анализ мочи). Специальной подготовки к вакцинации от ротавируса не требуется.

Советы родителям.

Во время острой фазы заболевания кормить ребенка не стоит, если только он не попросит пищу сам.

Следует придерживаться строгой диеты не только во время лечения, но и некоторое время после выздоровления: полностью исключить из меню цельное молоко и молочные продукты, сладкие фрукты, выпечку, мясо, а также жирные и жареные блюда. Полезно кушать каши на воде, овощные супы, сухари из белого хлеба, печеные в духовке яблоки. Кормить надо часто и небольшими порциями.

Совсем маленьким детям с ротавирусной инфекцией в грудном молоке не отказывают, ограничений по питанию не вводят, но следят за тем, чтобы питье было обильным. Грудное молоко само по себе содержит самой природой предусмотренные противовирусные компоненты, что поможет крохе в процессе выздоровления.

Изредка при тяжелом протекании ротавирусной инфекции у грудничка из-за возникновения ферментного дефицита может проявиться непереносимость или частичная непереносимость грудного молока. В этом случае следует снизить количество кормлений грудью и временно добавить в рацион малыша (до полного выздоровления) безлактозные детские смеси.

Больного ротавирусом ребенка не стоит обязательно укладывать в постель. Если у него высокая температура, то постельный режим необходим. Во всех остальных случаях он должен вести обычный образ жизни — играть, гулять.

Конечно, стоит держаться подальше от дворовой детской площадки, чтобы не распространять ротавирус на других детей, но прогулка в немноголюдном парке или сквере пойдет на пользу.

Самая действенная профилактика ротавируса – вакцинация. Только потом следует гигиена – обязательно нужно мыть руки, разумеется с мылом, тщательно мыть овощи и фрукты, следить за качеством воды, которую пьет ребенок.

Но ещё раз, справедливости ради отметим – никакие гигиенические ухищрения не могут гарантировать низкой вероятности заражения. Поэтому и в странах развитых и цивилизованных, и в странах «третьего мира» уровень заболеваемости ротавирусом находится на одинаково высоком уровне.

Если вы собираетесь ездить на море с маленьким ребенком, мы настоятельно рекомендуем вакцину от ротавируса. В последнее время эта кишечная инфекция получила довольно широкое распространение именно на курортах, где дети инфицируются с водой. Ежегодно специалисты Роспотребнадзора «сигналят» о неблагоприятной обстановке из-за этого недуга на Черноморском побережье Кавказа, в Крыму и на побережьях Болгарии.

Врачи назвали отличия коронавируса от ОРВИ | Новости | Известия

Отличить COVID-19 при легком течении от ОРВИ нелегко, поэтому лучше сдать ПЦР-тест на коронавирус. При этом есть ряд симптомов, которые могут служить подозрением на коронавирусную инфекцию. Об этих симптомах в беседе с «Известиями» рассказала руководитель департамента по развитию медицины BestDoctor Юлия Ткаченко.

По ее словам, свидетельством коронавируса могут стать исчезновение или выраженное притупление обоняния и ощущения вкуса пищи, а также выраженная общая слабость и сонливость. Врач также призвала обратить внимание на интенсивный сухой кашель (без выделения мокроты), повышение температуры выше 38,5 градуса и чувство нехватки воздуха. При появлении таких симптомов Ткаченко рекомендовала вызвать врача или скорую помощь.

Ее также поддерживает медицинский директор «СберЗдоровья» Владислав Мохамед Али.

«Если у вас заболевание протекает в легкой форме, условно говоря — невысокая температура и насморк, и вы самоизолируетесь, то результат теста глобально не имеет никакого значения. В любом случае даже малейшее проявление вирусной инфекции должно заставить вас оставаться дома и не подвергать риску остальных, особенно если они не вакцинированы», — подчеркнул специалист.

Какого лечения придерживаться в случае заражения коронавирусом?

Как подчеркнула Ткаченко, в настоящее время не существует лекарства, которое бы обеспечивало излечение от коронавируса. Противовирусные препараты в большинстве своем неэффективны, поэтому врачи назначают лечение, направленное на звенья развития инфекции (патогенетическая терапия), и лекарства, которые борются с симптомами (симптоматическая терапия), отметила она.

«Патогенетическая терапия подбирается в зависимости от тяжести заболевания. К ней относятся различные противовоспалительные препараты (глюкокортикостероиды, ингибиторы рецептора ИЛ-6), препараты, разжижающие кровь (антикоагулянты). Эти лекарства назначают только при тяжелом течении инфекции, они вызывают множество побочных явлений, поэтому решение об их назначении может принять только врач», — рассказала Ткаченко.

При легком течении болезни врачи, как правило, назначают лечение, которое используется при обычной ОРВИ: парацетамол, обильное питье, постельный режим.

Мохамед Али в свою очередь подчеркивает, что не стоит заниматься самолечением, а необходимо проконсультироваться с врачом.

В каких случаях лучше прививаться?

«Вакцинироваться следует во всех случаях, кроме строгих противопоказаний. Вакцинация — это единственный способ сформировать коллективный иммунитет и побороть эпидемию. Иммунитет после вакцины более стабильный и качественный, чем иммунитет после болезни, особенно по сравнению с теми, кто перенес болезнь в легкой или бессимптомной форме. По данным мирового сообщества, существует крайне мало строгих противопоказаний от вакцинации. Одно из них связано с аллергией: это тяжелая аллергия на какой-либо компонент вакцины от коронавируса или аллергия на уже сделанный первый компонент, перед тем как вводить вторую вакцину», — поделилась сотрудник BestDoctor.

Другим противопоказанием к прививке от коронавируса является острое заболевание, например ОРВИ, вирусные инфекции или обострение хронического заболевания. Из остальных строгих противопоказаний — возраст до 18 лет, беременность и период кормления грудью, добавила Ткаченко.

При этом Мохамед Али отметил, что прививаться в первую очередь стоит людям с хроническими заболеваниями, так как они подвержены самому высокому риску в случае заражения. Среди них пациенты с артериальной гипертензией, сахарным диабетом, проблемами легочной системы — бронхиальной астмой, заболеваниями легких и др.

Какую вакцину выбрать?

По словам медицинского директора «СберЗдоровья», не имеет значения, какая вакцина будет выбрана пациентом, главное — это получение стойкого иммунитета к коронавирусу.

«Поэтому не важно, какую именно вакцину вы выберете. Исследования показывают, что каждая из доступных сегодня на российском рынке («Спутник V», «ЭпиВакКорона» и «КовиВак») дает хороший иммунитет. Можно вакцинироваться той вакциной, которая есть в наличии, не выбирая между разными вариантами», — выразил мнение Мохамед Али.

При этом Ткаченко прежде всего отметила эффективность и безопасность «Спутника V».

«На текущий момент она одобрена Минздравом: опубликованы результаты первой, второй и третьей фаз клинических испытаний на добровольцах, а это главное требование к регистрации препарата. По данным публикаций на основе проведенных клинических испытаний, вакцина в краткосрочной перспективе высокоэффективна и безопасна», — подчеркнула она.

Эффективна ли вакцина от индийского штамма?

Несмотря на то что данные по эффективности вакцины «Спутник V» против индийского штамма пока не опубликованы, Ткаченко заметила, что эффективность других векторных вакцин, аналогичных «Спутнику V», колеблется от 70 до 80% для предотвращения заражения и превышает 90% для предотвращения тяжелого течения болезни.

При этом вакцина работает и в случае с индийским штаммом, считает эксперт.

«Она вызывает достаточно интенсивный и качественный иммунный ответ против всех штаммов коронавируса, а индийский штамм умеет «обходить» антитела человека только частично. Поэтому вакцина все еще является эффективной, хотя эффективность ее против индийского штамма и ниже в отличие от уханьского, британского, бразильского и южноафриканского», — выразила мнение специалист.

Ткаченко также отметила важность того факта, что в случае заражения индийским штаммом COVID-19 заболевание будет протекать в более легкой форме у привитых людей в сравнении с невакцинированными.

«Да, [вакцины] эффективны, несмотря на то что этот штамм несколько отличается от изначального. Поскольку все вакцины вызывают иммунитет, который связан именно со Spike-белком, который является неизменной структурой всех вирусов, то каждая из них эффективна в том числе и в части индийского штамма», — дополняет Мохамед Али.

30 июня доктор биологических наук, завлабораторией бионанотехнологии, микробиологии и вирусологии Новосибирского госуниверситета Сергей Нетесов предупредил о последствиях промедления в вакцинации, в частности, указав на то, что недостаточный коллективный иммунитет может привести к возникновению более устойчивых к вакцинам мутаций.

По мнению вирусолога, темпы вакцинации населения в России необходимо резко увеличить. Он заявил, что, когда 20–30% населения вакцинировано, а остальные нет и возникает среда для появления новых вариантов вируса, в этом случае придется делать новые вакцины.

Масштабная вакцинация от COVID-19 проходит в России с 18 января. Прививку делают бесплатно всем желающим на добровольной основе. На данный момент в стране зарегистрировано четыре препарата от коронавируса: «Спутник V», «Спутник Лайт», «ЭпиВакКорона» и «КовиВак».

Вся актуальная информация по ситуации с коронавирусом доступна на сайтах стопкоронавирус.рф и доступвсем.рф, а также по хештегу #МыВместе. Телефон горячей линии по вопросам коронавируса: 8 (800) 2000-112.

Лечение ондансетроном уменьшает симптомы ротавирусной инфекции — рандомизированное двойное слепое плацебо-контролируемое исследование

PLoS One. 2017; 12(10): e0186824.

, Концептуализация, Формальный анализ, Методология, Управление проектом, Написание – первоначальный проект, Написание – обзор и редактирование, # 1 , Концептуализация, Курирование данных, Методология, Администрирование проекта, Написание – первоначальный проект, # 2 , Курирование данных, Исследование, Администрирование проекта, 2 , Курирование данных, Исследование, Администрирование проекта, 2 , Формальный анализ, Методология, Написание – первоначальный проект, 3 , Формальный анализ, Методология, Написание – первоначальный проект, 3 , Курирование данных, Формальный анализ, Методология, Программное обеспечение, Написание – первоначальный проект, Написание – обзор и редактирование, 1 и , Концептуализация, Привлечение финансирования, Методология, Администрирование проекта, Надзор, Написание – первоначальный проект, Написание – обзор и редактирование 1, 4, *

Мари Хэгбом

1 Кафедра клинической и экспериментальной медицины, Отделение молекулярной вирусологии, Медицинский факультет, Университет Линчепинга, Линчёпинг, Швеция

Даниэль Новак

2 Университетская больница Сальгренска, Детская больница королевы Сильвии, отделение неотложной помощи, Гетеборг, Швеция

Малин Экстрем

2 Университетская больница Сальгренска, Детская больница королевы Сильвии, отделение неотложной помощи, Гетеборг, Швеция

Юнис Халид

2 Университетская больница Сальгренска, Детская больница королевы Сильвии, отделение неотложной помощи, Гетеборг, Швеция

Мария Андерссон

3 Отделение инфекционных болезней/Отдел клинической вирусологии Института биомедицины Гетеборгского университета, Гётеборг, Швеция

Magnus Lindh

3 Отделение инфекционных болезней/Отдел клинической вирусологии, Институт биомедицины, Гетеборгский университет, Гётеборг, Швеция

Johan Nordgren

1 Кафедра клинической и экспериментальной медицины, отделение молекулярной вирусологии, медицинский факультет, Университет Линчепинга, Линчёпинг, Швеция

Леннарт Свенссон

1 Кафедра клинической и экспериментальной медицины, отделение молекулярной вирусологии, медицинский факультет, Университет Линчепинга, Линчёпинг, Швеция

4 Медицинский факультет Каролинского института, Стокгольм, Швеция

Ашхам Мансур, редактор

1 Кафедра клинической и экспериментальной медицины, отделение молекулярной вирусологии, медицинский факультет, Университет Линчепинга, Линчепинг, Швеция

2 Университетская больница Сальгренска, Детская больница королевы Сильвии, отделение неотложной помощи, Гетеборг, Швеция

3 Отделение инфекционных болезней/Отдел клинической вирусологии, Институт биомедицины, Гетеборгский университет, Гётеборг, Швеция

4 Медицинский факультет Каролинского института, Стокгольм, Швеция

Университетский медицинский центр Геттингена, ГЕРМАНИЯ

# Внесены равные взносы.

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Поступила в редакцию 3 апреля 2017 г .; Принято 6 октября 2017 г.

Эта статья находится в открытом доступе и распространяется в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.Эта статья была процитирована. по другим статьям в PMC.
Дополнительные материалы

S1 Counce CheckList: (Док)

GUID: FFD11619-A3D8-48D5-A58F-277BEAB97E06

S1 Учебный протокол: (PDF)

GUID: AD449026-4E13-486F- B0A2-ED1CAF7

Заявление о доступности данных

Все соответствующие данные содержатся в документе и в файлах сопутствующей информации.

Abstract

Справочная информация

Ротавирусы и норовирусы вызывают острый гастроэнтерит с тяжелой диареей и рвотой, симптомы, которые могут привести к тяжелому обезвоживанию организма и смерти. Цель этого рандомизированного двойного слепого плацебо-контролируемого исследования заключалась в том, чтобы выяснить, может ли ондансетрон, антагонист серотониновых рецепторов, ослаблять рвоту и диарею, вызванные ротавирусом и норовирусом, что облегчило бы пероральную регидратацию и, возможно, ускорило бы выздоровление и уменьшило потребность в госпитализации.

Методы

Дети с острым гастроэнтеритом в возрасте от 6 месяцев до 16 лет, включенные в исследование (n = 104) и рандомизированные для получения однократной пероральной дозы (0,15 мг/кг) ондансетрона (n = 52) или плацебо (n = 52) . Сообщалось о количестве эпизодов диареи и рвоты в течение 24 часов после лечения, а также о количестве дней с симптомами. Патогены в фекалиях диагностировали с помощью ПЦР в реальном времени. Исходные параметры были проанализированы для ротавирус- и норовирус-позитивных детей.

Результаты

Одна доза перорального ондансетрона уменьшала продолжительность клинических симптомов ротавирусной инфекции (p = 0.014), с медианой два дня. Кроме того, ондансетрон уменьшал количество эпизодов диареи, наиболее выраженных у детей, болевших более 3 дней до начала лечения (p = 0,028).

Заключение

Ондансетрон может быть эффективным средством для лечения детей с ротавирусным гастроэнтеритом.

Регистрация исследования

Европейская база данных клинических испытаний EudraCT 2011-005700-15.

Введение

Диарейная болезнь является второй причиной смерти детей в возрасте до 5 лет, ежегодно вызывая примерно 760 000 смертей[1].Ротавирус (RV) является основной причиной этих смертей, а норовирус (NoV) является вторым наиболее распространенным вирусным патогеном. На ротавирусные инфекции приходится около трети тяжелых случаев острого гастроэнтерита (ОГЭ), требующих госпитализации [2], и ежегодно от РВ-инфекции умирают 200 000 детей, в основном в развивающихся странах [2, 3].

Основное внимание при лечении возрастных заболеваний направлено на восстановление водного баланса с помощью пероральной регидратационной терапии (ОРТ). Однако обильная рвота усложняет лечение ОРТ, и у детей с тяжелым обезвоживанием педиатры чаще выбирают внутривенное введение вместо ОРТ [4].Было показано, что противорвотные препараты, такие как гранисетрон и ондансетрон (антагонисты рецепторов серотонина-3 (5-гидрокситриптамин-3, 5-HT 3 )), обладают хорошим противорвотным эффектом у пациентов, получающих химиотерапию, и в ситуациях с рвотой после операции. 5, 6]. Кроме того, было показано, что ондансетрон облегчает ОРТ у детей с возрастом в независимых клинических исследованиях [7–13], хотя этиология была изучена только в одном из исследований, а патогены не принимались во внимание для получения результата [12].

Ондансетрон является одним из наиболее известных антагонистов 5-HT 3 рецепторов, блокирующих рецепторы блуждающего и симпатического нервов и триггерную зону хеморецепторов [14]. Однако антагонисты рецепторов 5-HT 3 не только ингибируют передачу сигналов в ЦНС, они также снижают перистальтику кишечника, предположительно, вмешиваясь в серотонинергическую нейротрансмиссию в энтеральной нервной системе (ЭНС) и блокируя инициацию рефлексов [15].

Хотя было показано, что ондансетрон оказывает влияние на уменьшение рвоты во время AGE, еще неизвестно, можно ли уменьшить рвоту и диарею, вызванные RV и NoV, с помощью ондансетрона у людей.

Ранее нами было показано, что РВ-инфекция активирует энтеральную нервную систему (ЭНС) [16–18], стимулирует высвобождение серотонина (5-гидрокситриптамина, 5-НТ) из энтерохромаффинных (ЭК) клеток и активирует структуры мозга в рвотном центре [19]. Недавно мы также продемонстрировали, что ондансетрон может ослаблять диарею, вызванную RV, у мышей, и что инфицированные мыши, получавшие лечение, набирали больше веса и выделяли меньше вируса [20]. Эти наблюдения, а также тот факт, что антагонисты рецепторов 5-HT 3 вызывают запор в качестве побочного эффекта [15, 21] и используются для лечения синдрома раздраженного кишечника (СРК) с преобладанием диареи [22, 23], привели к нас, чтобы проверить гипотезу о том, может ли ондансетрон уменьшить рвоту и диарею у детей с инфекцией RV или NoV.

Методы

Одобрение этики

Это исследование (протокол исследования S1) было одобрено комитетом по этике Линчепингского университета в Швеции (Dnr: 2011/502-31, 2013/27-32, 2014/288-32) и Агентством по медицинским продуктам (MPA, Уппсала, Швеция) и проводилось в соответствии с рекомендациями по надлежащей клинической практике. Исследование зарегистрировано в европейской базе данных клинических испытаний EudraCT (2011-005700-15). Дата регистрации: 2011-12-28.

Исследуемая популяция

Дети в возрасте от 6 месяцев до 16 лет с рвотой и диареей были набраны в детское отделение неотложной помощи Детской больницы королевы Сильвии Гётеборг, Швеция.Дети и/или их родители получили письменную информацию об исследовании, были проинформированы устно и получили возможность задать вопросы. Письменное информированное согласие было получено от всех участников или их опекунов.

Дизайн исследования

Это исследование было академическим проспективным рандомизированным двойным слепым плацебо-контролируемым исследованием. Критериями включения были не менее одного эпизода рвоты за последние 4 часа и не менее одного эпизода бескровной диареи за период болезни.Обезвоживание оценивали, как описано ранее [8], а обезвоживание более чем умеренной степени было критерием исключения, см.

Таблица 1

Критерии исключения.

аллергия на Ondansetron
предыдущий брюшной хирургию
Использование антиметикости в течение последних 72 часов
предыдущий Участие в исследовании
суровые врожденные дефекты сердца
кистозные фиброз
серповидная клетка анемия
Фруктоза нетерпимость
Сахарный диабет
Подозрение на другое заболевание, кроме гастроэнтерита

Медсестра переводит на лечение ондансетроном или плацебо, вслепую как раствор А или Б.Ондансетрон и плацебо назначались перорально. В случае рвоты в течение 15 минут давали вторую дозу того же раствора для приема внутрь. Согласно предыдущему исследованию, регидратация раствором для пероральной регидратации (ОРС) начиналась через 15 минут после приема ондансетрона или плацебо [8]. ОРТ регулярно применялась в качестве стандартного лечения в исследуемой больнице в соответствии с рекомендациями ВОЗ. Гидратация с помощью ОРС продолжалась не менее одного часа, после чего тот же врач снова осмотрел ребенка, и было решено, нужна ли ребенку внутривенная терапия или ребенок может вернуться домой для продолжения ОРТ.Образцы стула были собраны у всех участников и исследованы на наличие кишечных вирусов и бактерий с помощью ПЦР в реальном времени.

Ослепленный член исследовательской группы из Университета Линчепинга в Швеции позвонил опекуну через 24–72 часа после выписки и спросил о количестве эпизодов рвоты и диареи, а на 7–10-й день – о количестве дней с симптомами (рвота и/или диарея) после лечения.

Рандомизация и ослепление

Рандомизация была проведена компанией Apotek Produktion & Laboratorier AB (APL), Стокгольм, Швеция.Препараты и плацебо были помечены слепыми буквами A или B, и был предоставлен список рандомизации. Рандомизация проводилась блоками (n = 8), а кодовый ключ был запечатан APL, хранился в закрытом шкафу в клинике и оставался запечатанным до полного завершения сбора данных и оценок.

Исследуемый медицинский продукт

Ондансетрон, антагонист 5-НТ 3 антагониста рецептора в растворе для перорального применения (Зофран ® ) 0,8 мг/мл вводили в дозе 0,15 мг/кг в соответствии с предыдущими исследованиями [8, 24].Плацебо, произведенное APL, было идентично по вкусу, запаху, цвету и содержанию раствору Zofran ® , за исключением того, что оно не содержало активного лекарственного средства.

Сбор данных

Все данные, полученные в больнице, были собраны в форму истории болезни (CRF) и хранились в закрытом шкафу.

В больнице регистрировались следующие параметры: лихорадка, вес, уровень гидратации, количество эпизодов рвоты, количество эпизодов диареи, переносимость перорального приема, объем перорального приема, потребность во внутривенной регидратации и потребность в госпитализации.Опекуны получили памятку, чтобы отметить количество эпизодов рвоты и диареи через 24 часа после начала лечения, и они были проинформированы обо всех данных, которые необходимо собрать при последующем наблюдении, по телефону, который был собран через 24–72 часа после начала лечения. лечения и на 7-10 день.

Конечные точки

Первичными конечными точками (E.5.1, Реестр клинических испытаний ЕС) было количество эпизодов рвоты и диареи в течение первых 24 часов после лечения. Когда исследование уже продолжалось, была введена вторичная конечная точка с количеством дней с симптомами (диарея и/или рвота) после лечения, начиная с 21-го участника и далее.

Обнаружение вирусов и бактерий с помощью ПЦР в реальном времени

Ректальные мазки (Копан, Брешиа, Италия) объемом 250 мкл смешивали с 2 мл лизирующего буфера, и этот объем использовали для выделения общей нуклеиновой кислоты в приборе EasyMag ( Biomerieux, Марси Л’Этуаль, Франция). Нуклеиновые кислоты элюировали 110 мкл буфера для элюата, из этого объема 5 мкл использовали для каждой реакции ПЦР в реальном времени.

ПЦР в реальном времени проводили в 384-луночной системе ABI 7900 (Applied Biosystems, Foster City, CA) в девяти параллельных реакциях, нацеленных на аденовирус, астровирус, норовирус генотипа I (GI) или генотип II (GII), ротавирус, саповирус , Campylobacter Jejuni , , Cryptosporidium Parvum / Hominis , энтеротоксин-производящий Escherichia Coli (ETEC), кодируя для тепловой лабильной токсины ( ELTB ) или теплый стабильный токсин ( ESTA ), энтеропатогенный ESCERICHIA COLI ) кодирование интимина ( eae ) или пучкообразующих ворсинок ( bfpA ), Salmonella , Shigella и Yersinia .Последовательности праймеров и зонда были описаны ранее [25, 26]. Closttridium Difficile был обнаружен с использованием праймеров ( 5`-atcattacttcatttttggggatagc-3` и 5'-ATCTCGAAGTACAAGTTCATTGTTTTTCATCAGTACTACAAGTTCATTGTTTTTACTAAAAGTACAAGTTCATTGTTTTTACTAAAAGTACAAGTTCATTTTTTTTACTAA-3 ), а также зонд (Caggaatttcagcagtata), нацеленные на амплификацию токсина B.

, проводили в 20 мкл реакциях, содержащих олигонуклеотиды и Taqman Fast Virus 1-step Mastermix (Applied Biosystems) для мишеней РНК или Universal Mastermix (Applied Biosystems) для мишеней ДНК.После стадии обратной транскрипции при 46°С в течение 30 мин и последующей 10 мин денатурации при 95°С проводили 45 циклов двухстадийной ПЦР (15 с при 95°С, 60 с при 56°С). В каждом цикле плазмиды, содержащие области-мишени для всех агентов, амплифицировали параллельно с образцами пациентов для проверки эффективности каждой ПЦР-мишени.

Расчет размера выборки и статистические методы

Наше предположение состояло в том, что примерно 60% детей с возрастом будут страдать от RV- или NoV-инфекции, расчет основан на предыдущих исследованиях этиологии [4, 27–30].

По нашим оценкам, доля детей с RV или NoV, у которых возникла рвота после лечения, составила 50% в контрольной группе и 20% в группе лечения. Основываясь на этом, мы рассчитали, что регистрация 133 детей (соответствующих 80 положительным результатам на RV или NoV) даст мощность 80% с двусторонним уровнем значимости 95%. Из-за трудностей с набором детей мы достигли 104 участников в течение двухлетнего периода исследования. Однако доля детей с ВОЗРАСТОМ, вызванным RV и NoV, была выше, чем ожидалось: 86 детей были положительными на RV или NoV.

Решение о прекращении исследования было принято спонсором, но было связано с тем, что клиника не имеет возможности проводить исследование дальше.

Программа Statistical Package for Social Sciences (IBM SPSS Statistics, версия 22.0, Чикаго, Иллинойс, США) использовалась для анализа данных с порогом значимости 0,05. Распределение непрерывных конечных переменных значительно отклонялось от нормального распределения (р<0,01 одновыборочного критерия Колмогорова-Смирнова) и анализировалось с помощью U-критерия Манна-Уитни с двусторонней значимостью).Пропорции сравнивали с использованием точного критерия Фишера с двусторонней значимостью.

Результаты

Поток участников

Всего было обследовано 166 пациентов, 104 пациента были включены в исследование и рандомизированы. Образцы фекалий были получены от 102 пациентов и проанализированы на наличие кишечных патогенов.

Таблица 2

Патогены, обнаруженные в образцах фекалий методом ПЦР в реальном времени.

4
Возбудитель Выявлен методом ПЦР % от 102 участников
Ротавирус 92 70212 7,59095
Clostridium Difficile 19 18.6
Nov Gii 13 12.7 Adenovirus 40/41 13 13 12.7
EPEC EAE 9 9 80212
9 9 8 80211 Astrovirus 4 3.9
ETEC ELTB 3 2.9
Salmonella 3 29
ETEC ESTA 2 20211 EPEC BFPA 2 2 2.0
Nov Gi 2 2.0 2.0
Cryptosporidium 1 1,0
Campylobacter 0 0 0.0
Shigella 0 0.0
Yersinia 0 0.0

суммирует поток. Последующая информация о первичных конечных точках была получена от 101 ребенка; трое детей погибли, так как с опекунами нельзя было связаться по телефону. У первых 20 детей, включенных в исследование, спросили только о первичных конечных точках. Параметр дней с симптомами был добавлен, когда исследование уже продолжалось, и 79 детей завершили последующее наблюдение как по первичной, так и по вторичной конечной точке.

В анализ результатов были включены только дети с подтвержденной инфекцией RV или NoV. Четверых детей лечили противодиарейным препаратом, поэтому они были исключены из анализа исходов. Характеристики участников с RV или NoV представлены в . Не было никаких существенных различий в характеристиках между группами лечения плацебо и ондансетроном. Демографические данные по возрасту и полу: 46%, соответственно, 44% мужчин в группе ондансетрона по сравнению с плацебо и в возрасте 27 лет.95 соответственно 28,64 мес.

Таблица 3

Исходные характеристики участников анализа результатов (только дети с вирусом RV или NoV).

A B B B B B A B

Характеристики Ondansetron Group Placebo Group
N = 40 N = 41
MALE-N (%) 19 (47.5) 18 (43.9 )
Возраст–(месяцев) 28,70 ± 18.38 A 28.22 ± 22.99 A
24.007 24,00 ± 24.00 B
N рвотные эпизоды в предыдущих 24 часах 6.41 ± 3,78 A 7.28 ± 5.67 A
5.50 ± 3,69 B 5,33 ± 3,50212 5,33 ± 3,50212
N Эпизоды диареи в предыдущих 24 часах 3,83 ± 2,75 A 5.38 ± 7.38 A
3.00 ± 4.17 B
дня с симптомами до лечения (дни) 2,65 ± 1,61 A 3.07 ± 2,25
3,00 ± 3,00 B 3,00 ± 2,50 B
Rotavirus Infection-N (%) 33 (82.5) 34 (82.9)
Norovirus Infection- n (%) 7 (17.5) 4 (9.8)
ROTAVIRUS + NOROVIRUS-N (%) 0 (0,0) 3 (7.3) 3 (7.3)

Патогенные патогены

Обнаруженные патогены были в основном вирусными, особенно RV ( ). Из 102 пациентов, проанализированных на присутствие вируса в фекалиях, 86 детей были положительными на RV или NoV, четыре из которых были положительными на оба вируса. Как показано в , 75 детей (74%) были RV-позитивными, 13 детей были положительными на NoV GII (13%) и двое детей были положительными на NoV GI (2%).Из 102 проанализированных участников у 47 детей была инфекция, вызванная одним возбудителем, у 32 детей выявлено два возбудителя, у 12 детей выявлено три возбудителя и у одного ребенка выявлено четыре возбудителя. В 10 образцах фекалий ни один из проверенных патогенов не был обнаружен.

Первичные конечные точки

Различий в количестве эпизодов рвоты в течение первых 24 часов после лечения между группами ондансетрона и плацебо не наблюдалось (p = 0,988; медиана 0.0 ± 2,0 IQR против 0,0 ± 2,0; ). Более чем у 50% детей не было рвоты после лечения, независимо от лечения ондансетроном (21 из 40) или плацебо (21 из 41). Было меньше эпизодов диареи у детей, инфицированных RV, получавших ондансетрон (p = 0,057; медиана 1,0 ± 6,0 IQR) (n = 33) по сравнению с плацебо (медиана 4,0; ± 9,0 IQR) (n = 33) (), хотя статистически это не значительное. Аналогичное наблюдение было сделано для детей, инфицированных RV и NoV (p = 0,063; медиана 1,0 ± 5,0 IQR против 3,5 ± 9,0; ).

Таблица 4

Исходы для детей, инфицированных RV или NoV.


Средняя конечная точка,
2.29 7.15 2.29

Ondansetron Group Placebo Group
Начальная конечная точка
N Среднее
(± SD)
Median (± IQR) N Среднее
(± SD)
Median (± IQR) P-значение A
(P) Нет рвота
Эпизоды после лечения
40 1.43 ± 2.29 0,00 ± 2,00 41 1.32 ± 1.94 ± 1.94 ± 1.94 0,00 ± 2,00 0,988
(P) Нет диареи Эпизоды после лечения 40 3.75 ± 7.15 1,00 ± 5.00 40 5.68 ± 8.50 ± 8.50 3,5 ± 9.00 0,063

(ы) Всего дней с симптомами * во время болезни 33 4.64 ± 2.29 4,00 ± 3,00 31 6.10 ± 2,87 60212 60211 0.0319 0.031

Таблица 5

Таблица 5

7 Результаты для RV-инфицированных детей.

9062
Средняя конечная точка (ы) 9066
9028

OnDansetron Group Placebo Group
Национальная конечная точка
N Среднее
(± SD)
Median
(± IQR)
N Среднее (± SD) Median P-значение A
(P) Нет эпизодов диареи после лечения 33 4.18 ± 7.80 1,00 ± 6.00 3100 33 6.24 ± 9.10 4.00 ± 9.00 0.057
(ы) Общие дни с симптомами * во время болезни 26 4,69 ± 2,02 4,00 ± 2,00 24 6.25 ± 2.07 6.25 ± 2.07 6.007 6.00 ± 3,00 0.014

Вторичные конечные точки

Общие дни с симптомами у детей с РВ был средней 2 дня короче у детей, получающих ондансэтрон (P = 0.014; медиана 4,0; ±2,0 МКР; ) (n = 26) по сравнению с плацебо (медиана 6,0; ±3,0 IQR) (n = 24). Точно так же дни с симптомами были на 2 дня короче у получавших ондансетрон детей с RV или NoV-инфекцией (p = 0,031; медиана 4,0 ± 3,0 IQR против 3,0 ± 4,0; ).

Более того, частота госпитализаций после лечения была ниже у детей, получавших ондансетрон, по сравнению с детьми, получавшими плацебо. Трое из 40 детей, получавших ондансетрон, были госпитализированы после лечения (7,5%), по сравнению с 8 из 41 (20%) в группе плацебо.

Значительный эффект ондансетрона у детей с симптомами более чем за 3 дня до лечения

Поскольку была дана только одна доза ондансетрона, мы хотели выяснить, влияет ли продолжительность болезни на эффект лечения. Этот эффект был проанализирован путем стратификации по дням болезни до лечения (≤ 3 дней и > 3 дней, 3 дня — медиана). У детей с симптомами более чем за 3 дня до лечения ондансетрон значительно уменьшал диарею у детей, инфицированных RV и NoV, в течение 24 часов после лечения (p = 0.028; медиана 0,0 ± 2,0 IQR против 7,0 ± 9,0; ). Кроме того, продолжительность симптомов была на 4,5 дня короче у детей, получавших ондансетрон (p = 0,013; медиана 4,0 ± 3,0 межквартального интервала) по сравнению с плацебо (медиана 8,5; ±3,0 межквартального интервала).

Таблица 6

Стратифицированные исходы у детей, инфицированных RV или NoV, с симптомами >3 и ≤ 3 дней за сутки до лечения.

Стратифицированный результат
N Среднее 9069 (± SD) Median
(± IQR)
N N N N N Среднее
(± SD)
Median
(± IQR)
P-значение A
Длительность заболеваний
Нет рвоты. Эпизоды после лечения
> 3
≤ 3
16
24
0.69 ± 1,58
1,92 ± 2,57
1,92 ± 2.57
0,00 ± 1,00
1,00 ± 3,00
11
30
0,64 ± 0,81
1,57 ± 2,18
1,57 ± 2,18
0,00 ± 1,00
0,50-200
0.425
0.516
No Эпизоды диареи после лечения > 3
≤ 3
16 2,50 ± 5,38
4,58 ± 8.12
4,58 ± 8.12
0,00 ± 2,00
2,50 ± 5.00
11
29
5,73 ± 4,74
5.66 ±9,62
7.00 ± 9.00
3,00 ± 6.00
3,00 ± 6.00
0.028 0.028
0.651
№ дней с симптомами * После лечения > 3
≤ 3
12 4 21 5,17 ± 1,95
4,33 ± 1,95
4,33 2.46
4,00 ± 3,00
5,00 ± 4,00
5.00 ± 4.00
8
23
80-50 ± 3.51
5,26 ± 2.12
8.50 ± 3,00
5.00 ± 9.00
0.013
0.191

Неблагоприятные события

Две сообщения о были зарегистрированы нежелательные явления, ни одно из которых не было сочтено связанным с исследуемым препаратом.У одного из детей развился острый средний отит, а у другого ребенка появились высыпания, которые появились в течение 30 минут после приема ОРС и исчезли через 60 минут. Считалось, что сыпь связана с сиропом, который использовался для придания вкуса ОРС. Сообщалось о трех серьезных нежелательных явлениях (СНЯ), все из которых были возвращены в больницу в течение трех дней после лечения, обезвожены и госпитализированы. Двое из детей, о которых сообщалось о СНЯ, получали плацебо, а один ребенок получал ондансетрон.Все СНЯ считались следствием естественного процесса инфекции и были зарегистрированы как маловероятные/сомнительно связанные с исследуемым препаратом.

Обсуждение

Хотя ондансетрон ранее широко изучался у детей с гастроэнтеритом в целом, ни одно из предыдущих исследований не было направлено на конкретное определение того, может ли ондансетрон уменьшить симптомы у детей, инфицированных RV и NoV.

В этом исследовании наблюдалось явное преобладание вирусного гастроэнтерита, а RV и NoV были обнаружены у 74% и 14.7% детей соответственно (). Вирусные агенты были обнаружены у 93% (95/102) детей, бактериальные – у 31% (32/102).

Мы не обнаружили влияния ондансетрона на рвоту через 24 часа после лечения однократной дозой 0,15 мг/кг. Это может быть связано с тем, что после лечения было очень мало эпизодов рвоты как в группах ондансетрона, так и в группах плацебо, со средним значением, равным нулю в обеих группах, и 51% и 53% детей сообщили об отсутствии рвоты в группах плацебо и плацебо. групп ондансетрона соответственно.Таким образом, несколько эпизодов рвоты в обеих группах затрудняют какие-либо выводы относительно того, может ли препарат ограничивать рвоту, вызванную RV и NoV. У инфицированных ротавирусом людей рвота начинается внезапно [27] со средней продолжительностью два дня [31]. Сравнить количество эпизодов диареи и рвоты до и после лечения было невозможно, потому что родители сделали предположение о количестве эпизодов диареи и рвоты до обращения за помощью в больницу, и они были проинформированы об исследовании при обращении за помощью в больницу и им было сказано обратить внимание и сообщите количество случаев рвоты и диареи, а также количество дней с симптомами после того, как ребенок получил лечение.Поскольку дни с симптомами, включая рвоту, до лечения в нашем исследовании составляли в среднем 3 дня, это может, таким образом, объяснить ограниченное количество эпизодов РВ-рвоты в группах ондансетрона и плацебо. Наши результаты согласуются с исследованием Ramsook et al. , которые не обнаружили статистических различий в количестве эпизодов рвоты и указали, что это может быть связано с тем, что пациенты не были достаточно больны. и группа плацебо имеют медиану нуля в последующем [9].

В нашем исследовании мы обнаружили, что у детей, инфицированных вирусом риновируса, получавших лечение ондансетроном, было меньше эпизодов диареи и меньше дней с клиническими симптомами (p = 0,014; медиана 4,0; ±2,0 IQR, ) по сравнению с плацебо (медиана 6,0; ±3,0 IQR) ). Количество детей, инфицированных NoV, было слишком мало, чтобы их можно было анализировать отдельно (n = 15), поэтому они были проанализированы вместе с детьми, инфицированными RV. Точно так же у детей, получавших ондансетрон, было меньше эпизодов диареи и меньше дней с клиническими симптомами (p = 0,031; медиана 4,031).0; ±2,0 IQR, ) по сравнению с плацебо (медиана 6,0; ±3,0 IQR). У детей с симптомы более чем за 3 дня до лечения ().

Это исследование является первым, в котором изучалось влияние ондансетрона на вирус-индуцированную диарею. Предыдущие исследования не принимали во внимание этиологию, и результаты были получены как от бактериального, так и от вирусного гастроэнтерита.Были опубликованы противоречивые результаты [7–10, 12], и объяснение этих противоречивых результатов может быть связано с различными патогенами, поскольку патогенетические механизмы диареи могут быть не идентичными для бактерий и вирусов. Бактериальные инфекции, такие как, например. Salmonella , Shigella и Yersinia в большей степени связаны с продолжительной и часто кровавой диареей, выраженной воспалительной реакцией и меньшей рвотой[27]. Напротив, инфекции RV и NoV имеют клиническую картину с ограниченным воспалительным ответом [32-38], относительно короткую продолжительность и связаны с более обширной рвотой по сравнению с бактериальными инфекциями [27, 33, 37, 39].Было показано, что РВ-инфекция вызывает секреторную диарею [16, 17] и вовлекает 5-НТ [17, 19], медиатор не только рвоты, но и кишечной секреции и, как известно, вызывает диарею [40]. Тяжесть диареи у детей с AGE, получавших ондансетрон, изучалась как параметр исхода в предыдущих исследованиях [7, 9–12]. Исследование Кубедду и его коллег [12] — единственное предыдущее исследование, в котором сообщалась причина инфекции [12]. Они обнаружили, что 58% включенных детей в возрасте от 6 месяцев до 8 лет страдают от вирусных инфекций и 31% от бактериальных инфекций.Однако они не учитывали патогены при анализе результатов [12]. Они сообщили о большем количестве эпизодов диареи в течение 24 часов после введения ондансетрона и указали, что это может быть связано с различиями в патогенах, таким образом, у участников, получавших ондансетрон, была большая доля бактериально-индуцированного гастроэнтерита, который мог вызвать более тяжелую диарею и по механизму отличается от вируса[12]. В этом исследовании уменьшение количества эпизодов диареи было менее выраженным у детей с бактериальной инфекцией (ондансетрон; медиана 1.0 по сравнению с плацебо; медиана 2,5), однако цифры были слишком малы (n = 30), чтобы сделать какой-либо надежный вывод.

Наш результат со снижением числа эпизодов диареи у детей, инфицированных вирусом риновируса, получавших лечение ондансетроном, согласуется с тем фактом, что гранизитрон [17] и ондансетрон могут ослаблять вызванную вирусом диареи у мышей [20] и что запор является одним из наиболее частый побочный эффект препарата [21, 41]. Кроме того, антагонисты рецепторов 5-HT 3 используются при лечении СРК с преобладанием диареи [23, 41], а общие эффекты антагонистов 5HT 3 подразумевают, что они замедляют кишечный транзит, уменьшают кишечную секрецию и уменьшают количество воды в организме. состав стула[42].Период полувыведения ондансетрона зависит от возраста и у детей в возрасте от 1 месяца до 12 лет составляет от 2,9 до 6,7 часов. Возможное объяснение длительного эффекта однократной дозы может заключаться в том, что рекомендуемая и используемая доза значительно выше, чем доза, необходимая для достижения эффекта, и поэтому эффект может сохраняться в течение нескольких дней. Влияние ондансетрона на эпизоды диареи было наиболее выражено у детей, болевших более трех дней до начала лечения; эффект, который может быть связан с дозой.Кажется, что доза 0,8 мг/кг может уменьшить или остановить диарею на поздних стадиях инфекции, но недостаточно эффективна для ослабления диареи в начальной фазе симптомов.

Большим преимуществом ондансетрона является его безопасное длительное применение и возможность применения у маленьких детей. Меньше дней с диареей приведет к меньшему распространению вируса и меньшему количеству дней, когда родителям придется оставаться дома с больными детьми. Потенциальные преимущества лечения ондансетроном детей с вирусным гастроэнтеритом, включая меньшую госпитализацию и более быстрое выздоровление, будут иметь большое экономическое значение.

Ограничения

Число набранных детей было ниже запланированного, хотя исследование было продлено на один год. Одним из возможных объяснений сложности набора детей является то, что обычно родители не везут своих детей в больницу в ранние сроки желудочно-кишечных инфекций, а дети с сильным обезвоживанием не могут быть включены, поскольку это было критерием исключения из соображений безопасности. Небольшое количество детей, инфицированных NoV, 14,7% (15/102), затрудняет вывод о том, оказывал ли ондансетрон специфическое влияние на конечные параметры у этих детей, хотя мы считаем, что механизм для RV и NoV аналогичен. в связи со сходной клинической картиной.

Вспомогательная информация

Контрольный список S1 CONSORT

(DOC)

Благодарности

Выражаем искреннюю благодарность всем детям и семьям, участвовавшим в исследовании, а также персоналу отделения детской неотложной помощи Детской больницы королевы Сильвии, Гетеборг, Швеция .

Заявление о финансировании

Это исследование было поддержано спонсором исследования Шведским исследовательским советом (LS) 320301, URL: http://www.vr.se/. Это исследование является академическим исследованием; профессор Леннарт Свенссон является спонсором, и его поддерживает Шведский исследовательский совет.

Доступность данных

Все соответствующие данные содержатся в документе и в его файлах вспомогательной информации.

Ссылки

3. Tate JE, Burton AH, Boschi-Pinto C, Parashar UD, Координируемое Всемирной организацией здравоохранения глобальное наблюдение за ротавирусом N. Глобальные, региональные и национальные оценки смертности от ротавируса у детей в возрасте до 5 лет, 2000–2000 гг. 2013. Клинические инфекционные заболевания: официальное издание Американского общества инфекционистов. 2016;62 Приложение 2: S96–S105.Эпб 2016/04/10. дои: 10.1093/cid/civ1013. . [PubMed] [Google Scholar]4. Чоу К.М., Люн А.К., Хон К.Л. Острый гастроэнтерит: от рекомендаций к реальной жизни. Клиническая и экспериментальная гастроэнтерология. 2010;3:97–112. Эпублик 01.01.2010. ; Центральный PMCID в PubMed: PMC3108653. [Бесплатная статья PMC] [PubMed] [Google Scholar]5. Патель Р.И., Дэвис П.Дж., Орр Р.Дж., Феррари Л.Р., Римар С., Ханналла Р.С. и др. Однократный прием ондансетрона предотвращает послеоперационную рвоту у амбулаторных педиатрических больных. Анестезия и обезболивание. 1997;85(3):538–45.Эпб 1997/09/20. . [PubMed] [Google Scholar]6. Швелла Н., Кониг В., Швердтфегер Р., Шмидт-Вольф И., Шмид Х., Рисс Х. и др. Ондансетрон для эффективного контроля рвоты при тотальном облучении тела. Трансплантация костного мозга. 1994;13(2):169–71. Эпб 1994/02/01. . [PubMed] [Google Scholar]7. Ривз Дж.Дж., Шеннон М.В., Флейшер Г.Р. Ондансетрон уменьшает рвоту, связанную с острым гастроэнтеритом: рандомизированное контролируемое исследование. Педиатрия. 2002;109(4):e62 Epub 2002/04/03. . [PubMed] [Google Scholar]8.Фридман С.Б., Адлер М., Сешадри Р., Пауэлл Э.К. Пероральный ондансетрон при гастроэнтерите в педиатрическом отделении неотложной помощи. N Engl J Med. 2006;354(16):1698–705. дои: 10.1056/NEJMoa055119. . [PubMed] [Google Scholar]9. Ramsook C, Sahagun-Carreon I, Kozinetz CA, Moro-Sutherland D. Рандомизированное клиническое исследование, сравнивающее пероральный ондансетрон с плацебо у детей с рвотой при остром гастроэнтерите. Анналы экстренной медицины. 2002;39(4):397–403. Эпублик 2002/03/29. . [PubMed] [Google Scholar] 10. Йылмаз Х.Л., Йилдиздас Р.Д., Сертдемир Ю.Клинические испытания: пероральный ондансетрон для уменьшения рвоты, вторичной по отношению к острому гастроэнтериту у детей — двойное слепое рандомизированное исследование. Пищевая фармакология и терапия. 2010;31(1):82–91. Эпб 2009/09/18. doi: 10.1111/j.1365-2036.2009.04145.x. . [PubMed] [Google Scholar] 11. Рослунд Г., Хеппс Т.С., Маккуиллен К.К. Роль перорального ондансетрона у детей с рвотой в результате острого гастрита/гастроэнтерита, у которых пероральная регидратационная терапия оказалась неэффективной: рандомизированное контролируемое исследование. Анналы экстренной медицины.2008;52(1):22–9 e6. Эпублик 17.11.2007. doi: 10.1016/j.annemergmed.2007.09.010. . [PubMed] [Google Scholar] 12. Cubeddu LX, Trujillo LM, Talmaciu I, Gonzalez V, Guariguata J, Seijas J и др. Противорвотная активность ондансетрона при остром гастроэнтерите. Пищевая фармакология и терапия. 1997;11(1):185–91. Эпб 1997/02/01. . [PubMed] [Google Scholar] 13. Аист К.М., Браун К.М., Рейли Т.Х., Секрети Л., Браун Л.Х. Лечение в отделении неотложной помощи вирусного гастрита с применением внутривенного введения ондансетрона или дексаметазона у детей.Академическая неотложная медицина: официальный журнал Общества академической неотложной медицины. 2006;13(10):1027–33. Эпублик 12.08.2006. doi: 10.1197/j.aem.2006.05.018. . [PubMed] [Google Scholar] 14. Коэн ИТ. Обзор клинического применения ондансетрона у детей дошкольного возраста. Терапия и управление клиническими рисками. 2007;3(2):333–9. Эпб 2008/03/25. ; Центральный PMCID в PubMed: PMC1936315. [Бесплатная статья PMC] [PubMed] [Google Scholar]15. Гершон МД. Обзорная статья: рецепторы и переносчики серотонина — роль в нормальной и аномальной моторике желудочно-кишечного тракта.Пищевая фармакология и терапия. 2004;20 Дополнение 7:3–14. Эпублик 2004/11/04. doi: 10.1111/j.1365-2036.2004.02180.x. . [PubMed] [Google Scholar] 16. Лундгрен О., Перегрин А. Т., Перссон К., Кордасти С., Уноо И., Свенссон Л. Роль кишечной нервной системы в секреции жидкости и электролитов при ротавирусной диарее. Наука. 2000; 287(5452):491–5. Эпублик 22 января 2000 г. . [PubMed] [Google Scholar] 17. Kordasti S, Sjovall H, Lundgren O, Svensson L. Антагонисты серотонина и вазоактивных интестинальных пептидов ослабляют ротавирусную диарею.Кишка. 2004;53(7):952-7. Эпб 2004/06/15. PubMed doi: 10.1136/gut.2003.033563; Центральный PMCID в PubMed: PMC1774112. [Бесплатная статья PMC] [PubMed] [Google Scholar]18. Istrate C, Hagbom M, Vikstrom E, Magnusson KE, Svensson L. Ротавирусная инфекция увеличивает перистальтику кишечника, но не проницаемость в начале диареи. Дж Вирол. 2014;88(6):3161–9. doi: 10.1128/ОВИ.02927-13. ; Центральный PMCID PubMed: PMCPMC3957942. [Бесплатная статья PMC] [PubMed] [Google Scholar]19. Хагбом М., Истрате С., Энгблом Д., Карлссон Т., Родригес-Диас Дж., Буэса Дж. и др.Ротавирус стимулирует высвобождение серотонина (5-НТ) из энтерохромаффинных клеток человека и активирует структуры головного мозга, связанные с тошнотой и рвотой. PLoS Патог. 2011;7(7):e1002115 Epub 23/07/2011. doi: 10.1371/journal.ppat.1002115. ; Центральный PMCID в PubMed: PMC3136449. [Бесплатная статья PMC] [PubMed] [Google Scholar]21. Olver I, Paska W, Depierre A, Seitz JF, Stewart DJ, Goedhals L, et al. Многоцентровое двойное слепое исследование, в котором сравнивали плацебо, ондансетрон и ондансетрон плюс дексаметазон для контроля отсроченной рвоты, вызванной цисплатином.Исследовательская группа по отсроченной рвоте Ондансетрон. Анналы онкологии: официальный журнал Европейского общества медицинской онкологии / ESMO. 1996;7(9):945–52. Эпублик 1 ноября 1996 г. . [PubMed] [Google Scholar] 22. Мангель А.В., Норткатт А.Р. Обзорная статья: безопасность и эффективность алосетрона, антагониста рецептора 5-HT3, у женщин с синдромом раздраженного кишечника. Пищевая фармакология и терапия. 1999;13 Дополнение 2:77–82. Эпб 1999/08/03. . [PubMed] [Google Scholar] 23. Файяз М., Лакнер Дж.М. Модуляторы серотониновых рецепторов в лечении синдрома раздраженного кишечника.Терапия и управление клиническими рисками. 2008;4(1):41–8. Эпб 2008/08/30. ; Центральный PMCID в PubMed: PMC2503665. [Бесплатная статья PMC] [PubMed] [Google Scholar]24. Марчетти Ф., Маэстро А., Ровере Ф., Занон Д., Арригини А., Бертолани П. и др. Пероральный ондансетрон в сравнении с домперидоном для симптоматического лечения рвоты при остром гастроэнтерите у детей: многоцентровое рандомизированное контролируемое исследование. БМС Педиатр. 2011;11:15. Эпб 2011/02/12. doi: 1471-2431-11-15 [pii] doi: 10.1186/1471-2431-11-15. ; Центральный PMCID в PubMed: PMC3045958.[Бесплатная статья PMC] [PubMed] [Google Scholar]25. Kabayiza JC, Andersson ME, Nilsson S, Bergstrom T, Muhirwa G, Lindh M. Идентификация ПЦР в реальном времени агентов, вызывающих диарею у руандийских детей в возрасте до 5 лет. Журнал детских инфекционных болезней. 2014;33(10):1037–42. Эпб 2014/07/19. doi: 10.1097/INF.0000000000000448. . [PubMed] [Google Scholar] 26. Эльфвинг К., Андерссон М., Мселлем М.И., Велиндер-Олссон С., Петцольд М., Бьоркман А. и др. Пороговые значения цикла ПЦР в реальном времени помогают идентифицировать агенты, вызывающие острую детскую диарею на Занзибаре.Журнал клинической микробиологии. 2014;52(3):916–23. Эпублик от 10.01.2014. doi: 10.1128/JCM.02697-13. ; Центральный PMCID в PubMed: PMC3957757. [Бесплатная статья PMC] [PubMed] [Google Scholar]27. Uhnoo I, Olding-Stenkvist E, Kreuger A. Клинические особенности острого гастроэнтерита, связанного с ротавирусом, кишечными аденовирусами и бактериями. Арч Дис Чайлд. 1986; 61 (8): 732–8. . [Бесплатная статья PMC] [PubMed] [Google Scholar]28. Uhnoo I, Wadell G, Svensson L, Olding-Stenkvist E, Ekwall E, Molby R. Этиология и эпидемиология острого гастроэнтерита у шведских детей.J заразить. 1986;13(1):73–89. . [PubMed] [Google Scholar] 29. Олдак Э., Сулик А., Розкевич Д., Ливох-Ниенартович Н. Норовирусные инфекции у детей в возрасте до 5 лет, госпитализированных по поводу острого вирусного гастроэнтерита на северо-востоке Польши. Eur J Clin Microbiol Infect Dis. 2011. Эпублик 2011/07/07. doi: 10.1007/s10096-011-1321-z. . [Бесплатная статья PMC] [PubMed] [Google Scholar]30. Пуустинен Л., Блажевич В., Хухти Л., Шакал Э.Д., Халкосало А., Салминен М. и соавт. Генотипы норовирусов при эндемическом остром гастроэнтерите младенцев и детей в Финляндии в период с 1994 по 2007 год.Эпидемиол инфекции. 2012;140(2):268–75. Эпб 2011/04/15. doi: S0950268811000549 [pii] doi: 10.1017/S0950268811000549. ; Центральный PMCID в PubMed: PMC3243036. [Бесплатная статья PMC] [PubMed] [Google Scholar]31. Uhnoo I, Svensson L. Клинико-эпидемиологические особенности острого детского гастроэнтерита, связанного с подгруппами ротавируса человека 1 и 2. J Clin Microbiol. 1986; 23 (3): 551–5. . [Бесплатная статья PMC] [PubMed] [Google Scholar]33. Chen CC, Huang JL, Chang CJ, Kong MS. Фекальный кальпротектин как корреляционный маркер клинической тяжести инфекционной диареи и полезность для оценки бактериальных или вирусных патогенов у детей.J Pediatr Gastroenterol Nutr. 2012;55(5):541–7. Эпб 2012/06/16. doi: 10.1097/MPG.0b013e318262a718. . [PubMed] [Google Scholar] 35. Моррис А.П., Эстес М.К. Микробы и микробные токсины: парадигмы микробно-слизистых взаимодействий. VIII. Патологические последствия ротавирусной инфекции и ее энтеротоксина. Am J Physiol Gastrointest Liver Physiol. 2001; 281(2):G303–10. . [PubMed] [Google Scholar] 36. Ко Г., Цзян З.Д., Охуйсен П.С., DuPont HL. Фекальные цитокины и маркеры воспаления кишечника у международных путешественников с диареей, вызванной норовирусами.Журнал медицинской вирусологии. 2006;78(6):825–8. Эпублик 22.04.2006. doi: 10.1002/jmv.20630. . [PubMed] [Google Scholar] 37. Podewils LJ, Mintz ED, Nataro JP, Parashar UD. Острая инфекционная диарея у детей в развивающихся странах. Семин Педиатр Инфект Дис. 2004;15(3):155–68. . [Бесплатная статья PMC] [PubMed] [Google Scholar]39. Кутуккулер Н., Чаглаян С. Фактор некроза опухоли-альфа и интерлейкин-6 в стуле детей с бактериальным и вирусным гастроэнтеритом. J Pediatr Gastroenterol Nutr. 1997;25(5):556–57.. [PubMed] [Google Scholar]40. Camilleri M. Серотонин в желудочно-кишечном тракте. Современное мнение в области эндокринологии, диабета и ожирения. 2009;16(1):53–9. Эпублик от 01.01.2009. ; Центральный PMCID в PubMed: PMC2694720. [Бесплатная статья PMC] [PubMed] [Google Scholar]41. Гарсед К., Чернова Дж., Гастингс М., Лам С., Марчиани Л., Сингх Г. и др. Рандомизированное исследование ондансетрона для лечения синдрома раздраженного кишечника с диареей. Кишка. 2014;63(10):1617–25. Эпублик 18.12.2013. doi: 10.1136/gutjnl-2013-305989.; Центральный PMCID в PubMed: PMC4173656. [Бесплатная статья PMC] [PubMed] [Google Scholar]

Frontiers | Порошок Shenling Baizhu ингибирует RV-SA11-индуцированное воспаление и ротавирусный энтерит через сигнальный путь TLR4/MyD88/NF-κB

Введение

острый гастроэнтерит у детей раннего возраста во всем мире. В 2016 году более 258 миллионов детей в возрасте до 5 лет были инфицированы ротавирусом с годовой заболеваемостью 0.42 случая на ребенка (Troeger et al., 2018). РВ также является ведущей инфекционной причиной смерти детей в возрасте до 5 лет, связанной с диареей, в мире; на его долю приходится 37% от общего числа смертей, связанных с диареей (Sestak, 2018). В 2013 г. от ротавирусного энтерита умерло около 2,15 тыс. детей; из которых более 95% произошли в странах Африки и Азии (Tate et al., 2016). На сегодняшний день ни ВОЗ, ни ЮНИСЕФ не рекомендовали эффективных лекарств против РВЕ, за исключением низкоосмолярного раствора солей для пероральной регидратации для предотвращения обезвоживания и цинка для сокращения продолжительности и тяжести эпизодов диареи.С 2006 г. две живые аттенуированные ротавирусные вакцины (Rotarix R ™, RotaTeq R ™) лицензированы более чем в 100 странах. Однако эффективность ротавирусной вакцины составляет всего 50–60 % в странах с низким уровнем дохода и 80–90 % в странах с высоким уровнем дохода (Burnett et al., 2018; Carvalho and Gill, 2018). Поэтому разработка эффективных и безопасных противоротавирусных препаратов имеет большое значение.

Традиционная китайская медицина (ТКМ) предлагает уникальные преимущества в поддержании здоровья; таким образом, он широко использовался на протяжении тысячелетий (Gu and Pei, 2017).Порошок Shenling baizhu представляет собой классическую формулу, используемую для лечения желудочно-кишечных заболеваний, и обладает эффектом восполнения ци (энергии), укрепления селезенки и облегчения диареи. SBP был впервые обнаружен в Taiping Huimin Heji Ju Fang, составленный официальными лицами династии Сун (1078–1085 гг. Н.э.) и зарегистрирован в Фармакопее Китайской Народной Республики, 2020 г. Полная информация об основных компонентах SBP, включая фамилию, народное имя , функции TCM и т.д. были сведены в Таблицу 1.Недавние исследования показали, что СБП обладает хорошей эффективностью и безопасностью при лечении ротавирусного энтерита (Pu, 2017; Chen, 2018a; Qi, 2019). Однако об антиротавирусном эффекте и его механизме СБП не сообщалось.

ТАБЛИЦА 1 . Детали формулы SBP.

Сетевая фармакология — это систематический анализ заболеваний, генов, белков-мишеней и сетей взаимодействия лекарств, который выявляет синергетический эффект нескольких молекулярных лекарств (Hopkins et al., 2008; Kibble et al., 2015). Сетевая фармакология дает альтернативу изучению сложных механизмов действия традиционной китайской медицины. Поэтому в этом исследовании мы сначала предсказали активные соединения, потенциальные мишени и сигнальные пути СБП на основе предсказания на основе сетевой фармакологии. Кроме того, мы оценили антиротавирусный эффект и возможные механизмы SBP в клетках Caco-2, инфицированных обезьяньим ротавирусом (SA-11) (Knipping et al., 2012).

Материалы и методы

Реагенты и антитела

Тризол и фетальную бычью сыворотку (FBS) были приобретены у Shanghai ExCell Bio Co., ООО, Китай. Набор для обратной транскрипции был получен от Takara Biological Engineering Co., Ltd., Китай. Набор для подсчета клеток-8 (CCK-8) был получен от Dojindo Laboratories, Кумамото, Япония. Антитела против TLR4, MyD88 и NF-kB p65, первичные антитела и β-актин были получены от Abcam (Кембридж, Великобритания). Наборы ELISA для TNF-α, IL-1β, IL-6 и IFN-β были приобретены у Boster Biological Technology Co., Ltd., Китай. Модифицированная среда Игла (MEM) была получена от Procell Life Science and Technology Co., ООО, Китай. 1% пенициллин-стрептомициновая смесь и реагент электрохемилюминесценции (ECL) были приобретены у Beijing Solarbio Science and Technology Co., Ltd., Китай.

Приготовление лекарств

Как сообщалось ранее, пропорция СБП соответствовала рекомендациям, указанным в Фармакопее Китайской Народной Республики (издание 2020 г.), как показано в Таблице 1. Все травы были приобретены в Пекине Тонг Рен. Tang Co., Ltd (Пекин, Китай). Эти травы замачивали в воде в соотношении 1:10 в течение получаса и нагревали в течение 1 ч.Ингредиенты экстрагировали дважды. Эти экстракты объединяли, фильтровали и концентрировали до 1 г/мл с помощью роторного испарителя. Гранулы рибавирина (Qianjin Xiangjiang Pharmaceutical Co., Ltd.) готовили с дистиллированной водой до концентрации 5 мг/мл.

Приготовление сыворотки, содержащей SBP

Тридцать самцов крыс Wistar (возраст 4 недели, 100–120 г) были приобретены в Центре испытаний медицинских животных Шаньдунского университета (Цзинань, Китай). После адаптации в течение трех дней крысы были случайным образом разделены на три группы (по десять крыс в группе): нормальная группа, группа рибавирина (40.5 мг/кг/сут, с. п.о.) и группу САД (8,37 г/кг/сутки, п.о.). Крысам в нормальной группе давали соответствующее количество физиологического раствора. В конце третьего дня всех крыс анестезировали. Образцы сыворотки собирали из брюшной аорты и центрифугировали при 3000 об/мин при 4°C в течение 10 мин. Часть супернатанта анализировали с использованием высокоэффективной жидкостной хроматографии с квадрупольным/электростатическим полем с орбитальной масс-спектрометрией гидразина высокого разрешения (UPLC-Q-Orbitrap HRMS/MS), а другие части использовали для экспериментов.

Анализ UPLC-Q-Orbitrap HRMS/MS

Анализ выполнен с использованием UPLC-Q-Orbitrap HRMS/MS (UltiMate 3000 RS) и масс-спектрометра высокого разрешения Q-Exactive, которые были приобретены у компании Thermo Fisher Technology (Китай). Компания с ограниченной ответственностью.). Хроматографическое разделение проводили на колонке RP-C18 (150 × 2,1 мм, 1,8 мкм) при 35°C. Подвижная фаза состояла из 1): 0,1% водного раствора муравьиной кислоты и 2): 0,1% муравьиной кислоты в ацетонитриле. Градиент элюирования был следующим: 0–1 мин, 2% B; 1–5 мин, 20% В; 5–10 мин, 50 % В; 10–15 мин, 80 % В; 15–25 мин, 90 % В; 25–30 мин 2% Б.Скорость потока составляла 0,3 мл/мин. Получение МС было выполнено с использованием режимов сканирования с переключением положительных и отрицательных ионов. Масс-спектрометрический метод обнаружения: полная МС/дд-МС 2 ; источник ионов: источник ионизации электрораспылением. Расходы защитного газа и вспомогательного газа составляли 40 условных единиц (усл. ед.) и 15 условных единиц соответственно при 350°C. Температура капилляра 300°С. Напряжение распыления составляло 3,8 кВ для положительной ионизации и 3,8 кВ для отрицательной ионизации. Первичное разрешение сканирования составляло 70 000 FWHM, а вторичное разрешение сканирования составляло 17 500 FWHM.Диапазон сканирования составлял 150–2000 м/з.

Активные соединения и предполагаемые мишени СБП

Использование фармакологии системы традиционной китайской медицины (TCMSP) (Ru et al., 2014) (https://tcmspw.com/tcmsp.php) и Энциклопедии традиционной китайской медицины (ETCM) ) (Xu et al., 2018) (http://www.tcmip.cn/ETCM/index.php/Home/Index/) мы собрали данные о химических компонентах, содержащихся в десяти традиционных китайских травах в состав SBP, и выбрали соединения с пероральной биодоступностью ≥30% и лекарственным сходством ≥0.18 в качестве активных соединений СБП. Основываясь на соответствующих результатах фармакологических исследований в литературе, мы включили в исследование некоторые фармакологически активные соединения, хотя упомянутые выше критерии включения не были соблюдены. Мишени этих соединений были получены через базы данных TCMSP и SwissTarget (Daina et al., 2019) (http://www.swisstargetprediction.ch/), а целевые белки были преобразованы в названия генов с использованием базы данных UniProt (https: //sparql.uniprot.org/). Родственные гены РВС были получены из базы данных Genecard (https://www.Genecards.org/), а сеть SBP «лекарственное соединение — мишень» была построена с использованием Cytoscape 3.7.2.

Используя биоинформатику и эволюционную геномику (http://bioinformatics.psb.ugent.be/webtools/Venn/), мы построили диаграмму Венна для скрининга мишеней на пересечении активных соединений SBP и RVE Вышеупомянутые мишени пересечения были импортированы в базу данных Search Tool for the Retrieval of Interacting Genes/Proteins (Szklarczyk et al., 2019) (https://string-db.org/) для построения сети PPI.Используя Metascape (http://metascape.org/gp/index.html), мы провели анализ обогащения онтологии генов и анализ обогащения Киотской энциклопедии генов и геномов целей на пересечении и подготовили гистограмму для анализа обогащения. На основе анализа обогащения KEGG и результатов аннотации была построена сетевая диаграмма целевого пути.

Клетки и вирус

Клетки Caco-2 (Банк клеток коллекции типовых культур Китайской академии наук, Шанхай, Китай) культивировали в MEM с добавлением 20% FBS и 1% смеси пенициллин-стрептомицин при 37°C и 5% CO 2 .Штамм RV-SA11 (Институт контроля и профилактики вирусных заболеваний Китайского центра по контролю и профилактике заболеваний) культивировали в клетках Caco-2 в среде, содержащей 2% FBS и 1% пенициллин-стрептомициновую смесь. Инфекционная доза 50% культуры ткани (TCID50) была рассчитана с использованием метода Рида-Мюнха (TCID50 = 10– 4,31 /100 мкл, дополнительная таблица S1) (Reed and Muench, 1938).

Тест на цитотоксичность

Цитотоксичность сыворотки, содержащей SBP, в отношении клеток Caco-2 определяли с помощью анализов CCK-8 (Zhang et al., 2018). Клетки Caco-2 (3 × 10 4 клеток/лунку) высевали в 96-луночный планшет и инкубировали в течение 24 часов. Затем клетки обрабатывали сывороткой, содержащей лекарство, в последовательных концентрациях 50%, 40%, 30%, 20%, 10%, 5% и 2,5%. Образцы инкубировали в 5% CO 2 при 37°C в течение 24 ч, затем в каждую лунку добавляли по 10 мкл CCK-8 и инкубировали еще 2 ч. Оптическую плотность измеряли при 450 нм с помощью устройства для считывания микропланшетов и рассчитывали 50 % цитотоксическую концентрацию (CC50) лекарственной сыворотки, вызывающую 50 % цитопатического эффекта (CPE) клеток Caco-2 (Mosmann, 1983).Все эксперименты проводились в трехкратной повторности.

Противовирусные эффекты сыворотки, содержащей SBP

Конфлюэнтные монослои клеток Caco-2 инокулировали 100 TCID50/мл раствора вируса штамма RV-SA11 в 96-луночном планшете (100 мкл на лунку) и адсорбировали при 37°C на 2 ч. Супернатант с вирусом удаляли и добавляли различные концентрации (40%, 30%, 20%, 10%, 5% и 2,5%) SBP-содержащей сыворотки (100 мкл на лунку). Все они были ниже токсической концентрации препарата по результатам теста на цитотоксичность.Для каждой концентрации устанавливали по три лунки, контроль нормальных клеток и контроль вирусов одновременно. ЦПД наблюдали ежедневно, а ОП выявляли методом ССК-8 при ЦПД вирусного контроля более 90%. По результатам в последующем опыте использовали концентрацию сыворотки, содержащую 20% препарата.

Количественная ПЦР с обратной транскрипцией в реальном времени (RT-qPCR)

TRIzol использовали для экстракции тотальной РНК из клеток Caco-2, а кДНК получали с помощью обратной транскрипции мРНК с использованием набора для обратной транскрипции.Метод qRT-PCR проводили следующим образом: предденатурация при 95°С 10 мин, денатурация при 95°С 20 с, отжиг при 58°С 30 с, элонгация при 72°С 20 с, 40 циклов. . Последовательности праймеров были следующими: β-актин: прямой 5′-CCC ATC TAT GAG GGT TAC GC-3′, обратный 5′-TTT AAT GTC ACG CAC GAT TTC -3′; TLR4: вперед 5′-AGG​TTT​CCA​TAA​AAG​CCG​AAA​G-3′, назад 5′-CAA​TGA​AGA​TGA​TAC​CAG​CAC​G-3′; MyD88: прямой 5′-CGC CGC CTG TCT CTG TTC TTG-3′, обратный 5′-GGT CCG CTT GTG TCT CCA GTT G-3′; NF-κB p65: прямой 5′-ACA GAA GCA GGC TGG AGG TAA GG-3′, обратный 5′-GGA CAA TGC CAG TGC CAT ACA GG-3′ .Относительные уровни экспрессии мРНК рассчитывали методом 2 -△△CT .

Вестерн-блоттинг

Клетки лизировали для получения образцов белка, и концентрацию белка в образцах определяли с использованием набора для анализа белка BCA (Beijing Solarbio Science and Technology Co., Ltd., Китай). Белки из клеточных лизатов разделяли на 10% полиакриламидном геле с додецилсульфатом натрия и затем переносили на поливинилиденфторидную мембрану (Millipore, США).Мембраны трижды промывали трис-буферным солевым раствором с 0,1% детергентом Tween ® 20 (TBST), блокировали 5% бычьим сывороточным альбумином в течение 3 ч при 25°C, а затем инкубировали в течение ночи с соответствующими первичными антителами при 4 °С. Мембраны пятикратно промывали TBST и инкубировали со вторичными антителами в течение 1 ч при 25°C. Впоследствии, после пятикратной промывки TBST, мы использовали реагент ECL для захвата белковых сигналов, а программное обеспечение ImageJ (NIH, США) использовали для визуализации белковых полос.Все эксперименты проводились в трехкратной повторности.

Иммуноферментный анализ (ELISA)

Уровни воспалительных цитокинов, включая TNF-α, IL-1β, IL-6 и IFN-β, в супернатанте определяли с использованием наборов ELISA. Экспериментальные этапы проводились в соответствии с инструкциями производителя. OD измеряли с помощью устройства для считывания микропланшетов при 450 нм.

Статистический анализ

Все данные в экспериментах были проверены на нормальность и соответствовали нормальному распределению.Данные выражали как среднее значение ± стандартное отклонение. Программное обеспечение SPSS 19.0 (IBM, Чикаго, Иллинойс, США) использовалось для однофакторного дисперсионного анализа с последующим тестом наименьшей значимой разницы Фишера (LSD) для множественных сравнений. Значение p <0,05 считалось статистически значимым различием между группами.

Результаты

Химические составляющие сыворотки, содержащей SBP

Химические составляющие сыворотки, содержащей SBP, анализировали с помощью UPLC-Q-Orbitrap HRMS.Результаты показаны на рисунке 1; Дополнительная таблица S2. Всего было идентифицировано девять ингредиентов с использованием эксимерных пиков, информации о фрагментации и литературных данных. К ним относятся N1-(1,3,5-триметил-1H-пиразол-4-ил)-2-циано-3-(диметиламино)акриламид, изоликвиритигенин, два метоксиэстрона, 6-O-пентопиранозил-1-O-[ (2,6,6-триметил-1-циклогексен-1-ил)карбонил]-β-d-глюкопираноза, олеоноловая кислота, моноолеин, 18-β-глицирретиновая кислота, 9(Z),11(E)-конъюгированная линолевая кислота кислота и олеиновая кислота.

РИСУНОК 1 .Суммарная ионная хроматограмма SBP-содержащей сыворотки в (А) положительном и (Б) отрицательном режимах. Пик 1: N1-(1,3,5-триметил-1Н-пиразол-4-ил)-2-циано-3-(диметиламино)акриламид; 2: изоликвиритигенин; 3: 2-метоксиэстрон; 4: 6-О-пентопиранозил-1-О-[(2,6,6-триметил-1-циклогексен-1-ил)карбонил]-β-d-глюкопиранозу; 5: олеаноловая кислота; 6: моноолеин; 7: 18-β-глицирретиновая кислота; 8: 9(Z),11 (E) – Конъюгированная линолевая кислота; и 9: олеиновая кислота.

Активные соединения и прогнозируемые мишени СБП

В соответствии с биодоступностью при пероральном приеме ≥30% и лекарственным сходством ≥0.18, из 10 ингредиентов состава SBP было выбрано в общей сложности 219 активных соединений, которые действовали на 471 потенциальную мишень. Сеть «лекарственное соединение-цель», построенная с использованием Cytoscape 3.7.2, состоит из 708 узлов и 3921 ребра (рис. 2А). Из этой сети мы определили, что несколько соединений действуют на несколько целей, и наоборот. Всего из базы данных GeneCards было получено 226 генов-мишеней РВС.

РИСУНОК 2 . Сетевой фармакологический анализ (A) Сеть «Лекарственное соединение-мишень» антиротавирусного действия СБП.10 трав показаны красными треугольниками, 219 активных соединений показаны кружками разных цветов, а 471 целевой ген показан желтыми ромбами (B) Общие мишени SBP и RVE (C) Сеть PPI SBP -RVE (D) Анализ GO и анализ пути KEGG общих целей SBP и ротавируса с использованием гистограммы для ранжирования важности сверху вниз (E) Сеть Target-Pathways. Гены-мишени SBP-RVE показаны желтым овальным узлом.Чем выше степень целевого гена, тем темнее цвет. Пути отмечены зелеными треугольными узлами.

Диаграмма Венна показала, что SBP и RVE имеют 44 общих белка-мишени (рис. 2B), которые могут быть биологической основой влияния SBP на RVE. Сеть PPI показала, что существует тесное взаимодействие между этими 44 общими целями. Это показало, что ключевыми мишенями этой сети PPI были RGFR, EGF, IL-6, TGFB1, TNF, IL-2 и INF (рис. 2C).

Анализы GO и KEGG были выполнены с использованием базы данных Metascape (рис. 2D).Анализ обогащения GO показал, что SBP в первую очередь действует на мембранные рафты, комплексы плазматическая мембрана-белок и просвет везикул, а также влияет на цитокин-опосредованные сигнальные пути, межклеточную адгезию лейкоцитов и другие биологические процессы, влияя на функции связывания цитокинов с рецепторами. . Чтобы показать взаимосвязь между 44 мишенями и соответствующими им путями KEGG, мы построили сеть путей-мишеней (рис. 2E), и результаты показали, что SBP действовал на RVE, влияя на несколько воспалительных путей и кишечные иммунные сети.

Ингибирующее действие сыворотки, содержащей SBP, на RV-SA11

Для оценки противовирусной эффективности SBP было протестировано ингибирующее действие сыворотки, содержащей SBP, на репликацию и пролиферацию RV-SA11. CC50 сыворотки, содержащей SBP, в клетках Caco-2 составлял 68,75% (рис. 3A; дополнительная таблица S3). Значение EC50 сыворотки, содержащей SBP, составляло 5,911% (рис. 3B; дополнительная таблица S4)), а SI составлял 11,63. CC50 сыворотки, содержащей рибавирин, в клетках Caco-2 составляла 65,08% (рис. 3А).Значение EC50 сыворотки, содержащей рибавирин, составило 3,467% (рис. 3B), а SI — 18,77. Результаты показали, что как SBP, так и рибавирин значительно ингибировали репликацию и пролиферацию вируса с менее токсичным воздействием на жизнеспособность клеток Caco-2. Тем временем мы изучили влияние SBP на патологические изменения в инфицированных вирусом клетках Caco-2 (рис. 3C). Клетки Caco-2 в нормальной контрольной группе (NC) имели однородную морфологию с неправильными и овальными плотными соединениями и четкими краями клеток.Клетки группы RV были неравномерной формы с вакуолями, большим межклеточным пространством, размытыми краями, мертвыми клетками и клеточным детритом. Сыворотка, содержащая лекарство, воздействует на ротавирусно-инфицированные клетки. По мере увеличения концентрации сыворотки, содержащей лекарство, количество клеточных вакуолей и мертвых клеток уменьшалось, границы клеток становились более четкими, а связи более плотными.

РИСУНОК 3 . Ингибирование активности RV-SA11 в различных концентрациях SBP-содержащей сыворотки in vitro (A) Цитотоксическое действие сыворотки на клетки Caco-2 выявляли с помощью анализа CCK-8 ( n = 3) (B) Ингибирующее действие сыворотки на клетки Caco-2, инфицированные RV-SA11.Столбики погрешностей указывают диапазон значений, полученных в трех экспериментах; представлено как среднее ± стандартное отклонение трех отдельных экспериментов (C) Влияние сыворотки на патологические изменения в инфицированных вирусом клетках Caco-2 (40 X).

Влияние SBP на сигнальный путь TLR4/MyD88/NF-κB

Чтобы исследовать механизм SBP на RV, мы обнаружили экспрессию мРНК и белка TLR4 и нижестоящих MyD88 и NF-κB p65. Экспрессия мРНК и белка TLR4, MyD88 и NF-kB p65 была значительно увеличена в клетках Caco-2, инфицированных RV-SA11 ( p <0.01). SBP значительно снижал экспрессию мРНК и белков TLR4, MyD88 и NF-kB p65, индуцированную RV-SA11 ( p <0,01). Это указывает на то, что SBP ингибирует вирус RV-SA11, ингибируя сигнальный путь TLR4/MyD88/NF-κB (рис. 4; дополнительные таблицы S5, 6).

РИСУНОК 4 . Экспрессию мРНК и белка TLR4, MyD88 и NF-κB p65 (A–C) Вестерн-блоттинг проводили для измерения экспрессии TLR4, MyD88 и NF-κB p65 и ImageJ 1.Программное обеспечение 8,0 112 использовалось для анализа и преобразования статистических данных всех белков (n = 3) (D–F) RT-qPCR для экспрессии мРНК TLR4, MyD88 и NF-κB p65 ( n = 3 ). Все значения были представлены как среднее значение ± стандартное отклонение. ## p < 0,01 по сравнению с группой NC; * P <0,05, ** p <0,01 по сравнению с группой RV.

Влияние сыворотки, содержащей SBP, на воспаление клеток, инфицированных вирусом .Уровни экспрессии IL-1β, IL-6, TNF-α и IFN-β в группе RV были значительно выше, чем в группе NC (

p < 0,01). Уровни экспрессии IL-1β, IL-6 и TNF-α в группе SBP были значительно снижены ( p <0,01) по сравнению с группой RV (рис. 5A-C; дополнительная таблица S7). Между тем уровень экспрессии IFN-β еще больше увеличился в группе SBP, чтобы играть свою противовирусную роль (рис. 5D; дополнительная таблица S7). Эти результаты показали, что SBP способен регулировать сверхэкспрессию различных воспалительных цитокинов в клетках Caco-2, инфицированных RV-SA11.

РИСУНОК 5 . Экспрессию цитокинов выявляют с помощью ИФА ( n = 3). Все значения были представлены как среднее значение ± стандартное отклонение. ## p < 0,01 по сравнению с группой NC; * p < 0,05, ** p < 0,01 по сравнению с группой RV.

Обсуждение

Клетки Caco-2 представляют собой клонированные клетки аденокарциномы толстой кишки человека, структурно и функционально сходные с дифференцированными эпителиальными клетками тонкого кишечника, и обычно используемые клеточные линии для исследования вирусной инфекции (Knipping et al., 2012). В этом исследовании мы обнаружили, что сыворотка, содержащая SBP, оказывает менее токсическое действие на клетки Caco-2 и сильное ингибирующее действие на RV-SA11, что указывает на то, что SBP обладает хорошим антиротавирусным эффектом. Наши данные согласуются с предыдущими исследованиями, показывающими, что несколько активных ингредиентов в SBP обладают противовирусными свойствами. Гинзенозид-Rb2 и его гидролизат 20(S)-гинзенозид Rg3 ингибировали рост РВ и оказывали защитное действие на инфицированные клетки (Yang et al., 2018a). Глицирризиновая кислота и ее первичный метаболит 18β-глицирретиновая кислота (GRA) являются фармакологически активными соединениями Glycyrrhiza uralensis Fisch и обладают противовирусными и иммуномодулирующими свойствами.GRA обладала значительной противовирусной активностью в отношении репликации ротавируса in vitro и снижала уровни вирусных белков VP2, VP6 и NSP2 в инфицированных клетках (Hardy et al., 2012). Atractylodes lactone III оказывал противовирусное действие путем прямой инактивации RV in vivo и in vitro (Zhou et al., 2019). Тритерпеноидные сапонины Platycodon grandiflorus (Jacq.) A.DC. подавленная активность против репликации ВГС (Kim et al., 2013).

SBP состоит из 10 различных китайских трав, и его активные соединения являются сложными.Трудно прояснить каждый его механизм с помощью классических фармакологических методик. Сетевая фармакология является мощным инструментом для изучения механизма таких соединений в китайских растительных препаратах и ​​помогает прояснить сложные биологические явления. Чтобы определить молекулярный механизм SBP, мы построили сеть «лекарственное соединение-мишень», выбрали 44 мишени «лекарственное заболевание» и провели анализ обогащения GO и анализ пути KEGG. Результаты показали, что SBP действовал на RVE, влияя на несколько воспалительных путей и кишечные иммунные сети.

Многочисленные исследования показали, что вирусная инфекция способствует выработке воспалительных цитокинов, таких как IL-1β, IL-6, IL-8 и TNF-α (Ye et al., 2017; Hakim et al., 2018; Shen et al. др., 2019). Результаты этого исследования показали, что RV может повышать экспрессию IL-1β, TNF-α и IL-6, которая может быть реверсирована с помощью SBP. Гинзенозид Rg3 обладал иммуномодулирующим действием, при этом исследования показали, что он может повышать продукцию противовоспалительных цитокинов (ИЛ-2, ИЛ-10 и др.), снижать уровень провоспалительных медиаторов (ФНО-α и ИЛ-1β). ) и усиливают иммунную функцию (Yang et al., 2018б; Лю и др., 2019). Изоликвиритигенин (ILG), природный флавоноид, может ингибировать вызванное воспалением повреждение тонкой кишки за счет снижения уровня расщепленной каспазы-1 и продукции зрелого IL-1β (Nakamura et al., 2018). Многочисленные исследования показали, что соединения, выделенные из Atractylodes macrocephala Koidz., гликопротеина Dioscorea opposita Thunb. и платикодина D, могут снижать уровни провоспалительных цитокинов (IL-1β, IL-6 и TNF-α). ) посредством ингибирования сигнальных путей NF-κB (Jeong et al., 2019; Ниу и др., 2020 г.; Йе и др., 2019).

IFN типа I, такие как цитокины IFN-α, IFN-β и IFN-κ, участвуют в активации и регуляции врожденного и приобретенного иммунного ответа. Они обладают сильным противовирусным и иммуномодулирующим действием (Klotz et al., 2017). После того, как вирус заражает клетки, рецепторы распознавания образов (PRR) активируют врожденный иммунный ответ. PRR используют специфические адаптерные белки, включая MyD88 и домен Toll / IL-1R, индуцирующий адаптер, индуцирующий IFN-β (TRIF), для активации регуляторного фактора интерферона 3 (IRF3), IRF7 и NF-κB.Эти факторы инициировали транскрипцию IFN I типа и провоспалительных цитокинов (таких как IL-1β, IL-6 и TNF-α) (Carty et al., 2014; Klotz et al., 2017). Однако предыдущие исследования показали, что эндогенный IFN не может эффективно ограничивать репликацию RV. RV может ингибировать иммунный ответ IFN с помощью различных механизмов: неструктурный белок RV (NSP1) может ингибировать продукцию IFN 1 типа путем деградации индуцированных IFN факторов транскрипции IRF или ингибирования активации NF-kB; RV может изолировать NF-κB в вирионе и ингибировать накопление STAT в ядре, стимулированное IFN (Sherry, 2009).В конечном счете, ингибирование иммунного ответа IFN зависело от штамма RV и типа клеток (Sen et al., 2018). В нашем эксперименте экспрессия IFN-β увеличивалась в клетках, инфицированных RV. После лечения СБП экспрессия IFN-β еще больше увеличивалась, что в определенной степени играло противовирусную роль. Точно так же гинзенозид Rg3 усиливал врожденный иммунный ответ, индуцируя экспрессию IFN-β посредством стимуляции экспрессии хеликазы РНК DEAD-box DDX3 посредством p53-опосредованной трансактивации и активации пути TBK1/IKKɛ/IRF3 (Choi et al., 2014). Glycyrrhiza uralensis Fisch. дозозависимо стимулировал секрецию IFN-β в клетках A549 и Hep-2 с инфекцией HRSV и без нее (Feng Yeh et al., 2013).

NF-κB является важным активатором транскрипции, который регулирует экспрессию медиаторов воспаления. Он был тесно связан с различными типами воспаления и играет важную роль в опосредовании иммунных ответов (Mitchell et al., 2016). Активация NF-κB может индуцировать выработку цитокинов, взаимодействие которых может усугубить воспалительные реакции (Zhang et al., 2020). Мы обнаружили, что экспрессия мРНК и белка р65 NF-κB была значительно увеличена в клетках Caco-2, инфицированных RV-SA11, и значительно снизилась после обработки SBP.

Toll-подобные рецепторы (TLR) представляют собой тип PRR, который играет важную роль в иммунной системе хозяина. Они могли распознавать бактерии, вирусы и другие микробные молекулы и активировать организм для выработки ответа иммунных клеток (Chen et al., 2018b). Toll-подобный рецептор 4 (TLR4), член семейства Toll-подобных, расположен в клеточной мембране и цитоплазме и представляет собой PRR для липополисахаридов (LPS).Взаимодействие между LPS и TLR4 способствовало активации нижестоящего сигнального пути NF-κB, что в конечном итоге приводило к воспалению (Ciesielska et al., 2020). РВ представляет собой вирус, который может инфицировать как людей, так и животных. Он локализуется в эпителиальных клетках кишечника и индуцирует иммунный ответ через определенные сигнальные пути. Эпителиальные клетки кишечника были важными местами экспрессии и кодирования TLR, IL-1β, IL-6 и GM-CSF (Soderholm and Pedicord, 2019). RV может индуцировать активацию дендритных клеток, что может повышать уровни CD40, CD86, TLR3 и TLR4 и продуцировать воспалительные цитокины, такие как IL-6, IL-10, TNF-α и интерферон-β (Rosales- Мартинес и др., 2016; Йе и др., 2017). MyD88 является ключевым белком передачи сигнала, участвующим в сигнальном пути TLR. За исключением TLR3, все остальные TLR используют MyD88-зависимые пути. MyD88 может активировать NF-κB и индуцировать инициацию иммунного ответа после инфекции RV, включая высвобождение провоспалительных цитокинов и экспрессию защитных белков (Saikh et al., 2020). Было обнаружено, что иммунный ответ инфицированных RV мышей, лишенных MyD88, был ниже, что способствовало инфицированию и передаче RV, и подтвердило, что MyD88-опосредованный сигнальный путь TLR ограничивал инфекцию и передачу RV (Uchiyama et al., 2014). Следовательно, регуляция сигнального пути TLR4/MyD88/NF-κB может помочь уменьшить воспалительную реакцию. Здесь мы обнаружили, что SBP явно ингибирует уровни мРНК и белка TLR4 и MyD88 в инфицированных RV клетках Caco-2. ILG оказывает антиоксидантное и противовоспалительное действие за счет активации пути KEAP-1/Nrf2 и ингибирования пути NF-kB и NLRP3 (Gao et al., 2020). Олеаноловая кислота может облегчить диарею, вызванную Salmonella typhimurium , поддерживать целостность кишечного барьера через сигнальный путь TLR4/NF-kB и MAPK и ингибировать секрецию провоспалительных цитокинов, таких как TNF-α, IL-1β и ИЛ-6 (Донг и др., 2020). Жирные кислоты, сложные эфиры, лактамы и полифенолы в Coix lacryma-jobi var. ma-yuen (Rom.Caill.) Stapf обладал противовоспалительным действием. Механизм может быть связан со снижением сосудистой проницаемости и воспалительной экссудации, вмешательством в сигнальный путь IKK/NF-κB и снижением секреции воспалительных факторов, таких как IL-6, CCl2, IL-1α, IL-1β. (Ли и др., 2020).

Заключение

В заключение, наши результаты показали, что SBP может значительно ингибировать репликацию и пролиферацию вируса с низкой цитотоксичностью in vitro .Противовирусный эффект СБП может быть связан с регуляцией сигнального пути TLR4/MyD88/NF-kB и запретом высвобождения цитокинов, вызванного РВ. Эти предварительные данные не могли полностью объяснить основной механизм антиротавирусного действия СБП. Также отсутствуют защитные эффекты SBP на RVE in vivo . Настоящее исследование пролило новый свет на медикаментозную терапию РВЭ. Более того, из-за сложности компонентов ТКМ необходимы новые технологии для исследования материальной основы и детального механизма СБП.

Заявление о доступности данных

Необработанные данные, подтверждающие сделанные выводы, будут предоставлены авторами без неоправданных оговорок любому квалифицированному исследователю.

Заявление об этике

Исследование на животных было рассмотрено и одобрено Комитетом по экспериментальной этике Шаньдунского университета традиционной китайской медицины (Цзинань, Китай).

Вклад авторов

WX и WF задумали эксперименты. WW и YQ провели сетевые фармакологические исследования.ZX и CT провели эксперименты с in vitro. WW и DL провели статистический анализ. WX и WF написали рукопись. Все авторы внесли свой вклад в статью и одобрили представленную версию.

Финансирование

Это исследование финансировалось Национальным фондом естественных наук Китая (№: 81704038, 818), Планом постдокторских инноваций провинции Шаньдун, Китай (№: 202003069). Фонд естественных наук провинции Шаньдун, Китай (№: ZR2020Mh487).

Конфликт интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Дополнительный материал

Дополнительный материал к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/articles/10.3389/fphar.2021.642685/full#supplementary-material.

Аббревиатура

CC50, 50% цитотоксическая концентрация; ЦПЭ, цитопатический эффект; DL, сходство с наркотиками; ECL, электрохемилюминесценция; ELISA, твердофазный иммуноферментный анализ; ETCM, Энциклопедия традиционной китайской медицины; FBS, эмбриональная бычья сыворотка; ГО, Генная онтология; KEGG, Киотская энциклопедия генов и геномов; ЛПС, липополисахариды; LSD, наименьшее существенное различие; MEM, модифицированная среда Игла; ОП, оптическая плотность; RT-qPCR: количественная ПЦР с обратной транскрипцией в реальном времени; РВЭ; Ротавирусный энтерит, СБП; порошок шэньлин байчжу, SI; индекс селективности; TCMSP, фармакология системы традиционной китайской медицины; TLRs, толл-подобные рецепторы; UPLC-Q-Orbitrap HRMS/MS, ультравысокоэффективная жидкостная хроматография-квадруполь/масс-спектрометрия высокого разрешения с орбитальным гидразином в электростатическом поле

Ссылки

Burnett, E., Парашар, У., и Тейт, Дж. (2018). Ротавирусные вакцины: эффективность, безопасность и перспективы. Педиатр. Наркотики 20 (3), 223–233. doi:10.1007/s40272-018-0283-3

Полный текст CrossRef | Google Scholar

Карти М., Рейнерт Л., Палудан С. Р. и Боуи А. Г. (2014). Врожденная противовирусная передача сигналов в центральной нервной системе. Тренды Иммунол. 35 (2), 79–87. doi:10.1016/j.it.2013.10.012

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Карвалью, М.Ф. и Гилл Д. (2018). Эффективность ротавирусной вакцины: текущее состояние и области для улучшения. Гул. Вакцина. Иммунотер. 15 (6), 1237–1250. doi:10.1080/21645515.2018.1520583

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Чен С.-Ю., Као С.-Л. и Лю С.-М. (2018б). Профилактика рака, противовоспалительное и антиоксидантное действие биоактивных фитохимических веществ, нацеленных на сигнальный путь TLR4. Ijms 19 (9), 2729–2745. doi:10.3390/ijms129

Полный текст CrossRef | Google Scholar

Чен, Л.(2018а). Клинический эффект порошка Shenling Baizhu при лечении детской осенней диареи. клин. Мед. Рез. Практика. 3 (13), 124–125. doi:10.19347/j.cnki.2096-1413.201813059

Полный текст CrossRef | Google Scholar

Чой, Ю.-Дж., Канг, Л.-Дж., и Ли, С.-Г. (2014). Стимуляция экспрессии DDX3 гинсенозидом Rg3 через путь akt/p53 активирует врожденный иммунный ответ посредством передачи сигналов TBK1/ikkε/IRF3. Смс 21 (8), 1050–1060. doi:10.2174/0

73113206660306

CrossRef Full Text | Google Scholar

Чесельская А., Матийек М. и Квятковска К. (2020). Перенос TLR4 и CD14 и его влияние на LPS-индуцированную провоспалительную передачу сигналов. Сотовый. Мол. Науки о жизни . 78, 1233–1261doi:10.1007/s00018-020-03656-y

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Дайна, А., Мишелин, О., и Зоете, В. (2019). SwissTargetPrediction: обновленные данные и новые функции для эффективного предсказания белков-мишеней малых молекул. Рез. нуклеиновых кислот. 47 (W1), W357–W364.doi:10.1093/nar/gkz382

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Н. Донг, К. Сюэ, Л. Чжан, Т. Чжан, К. Ван, К. Би, и др. (2020). Олеаноловая кислота усиливает плотные соединения и уменьшает воспаление при диарее, вызванной Salmonella typhimurium, у мышей посредством пути TLR4/NF-κB и MAPK. Функц. 11 (1), 1122–1132. doi:10.1039/c9fo01718f

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Фэн Е, К., Chih Wang, K., Chai Chiang, L., Shieh, D.E., Hong Yen, M., and San Chang, J. (2013). Водный экстракт солодки обладал противовирусной активностью в отношении респираторно-синцитиального вируса человека в клеточных линиях дыхательных путей человека. J. Этнофармакология 148 (2), 466–473. doi:10.1016/j.jep.2013.04.040

Полный текст CrossRef | Google Scholar

Гао Ю., Лев X., Ян Х., Пэн Л. и Ци Х. (2020). Изоликвиритигенин оказывает антиоксидантное и противовоспалительное действие посредством активации пути KEAP-1/Nrf2 и ингибирования путей NF-κB и NLRP3 при каррагинан-индуцированном плеврите. Функц. 11 (3), 2522–2534. doi:10.1039/c9fo01984g

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Гу, С., и Пей, Дж. (2017). Инновационная китайская фитотерапия: от традиционной медицинской практики до научного открытия лекарств. Фронт. Фармакол. 8, 381–385. doi:10.3389/fphar.2017.00381

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Хаким М.С., Чен С., Дин С., Инь Ю., Икрам А., Ма Х.-х. и др. (2018).Базальная передача сигналов интерферона и терапевтическое использование интерферонов для борьбы с ротавирусной инфекцией в кишечных клетках и органоидах человека. Науч. Респ. 8 (1), 8341–8353. doi:10.1038/s41598-018-26784-9

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Харди, М. Э., Хендрикс, Дж. М., Полсон, Дж. М., и Фаунс, Н. Р. (2012). 18β-глицирретиновая кислота ингибирует репликацию ротавируса в культуре. Вирол. Дж. 9, 96–111. doi:10.1186/1743-422x-9-96

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Хопкинс, А.Л. Д., Донг, Г. З., Ли, Х. Дж., и Рю, Дж. Х. (2008). Сетевая фармакология: следующая парадигма в открытии лекарств Противовоспалительные соединения из Atractylodes macrocephala. Нац. хим. Биолмолекулы 4 (11), 682–690. doi:10.1038/nchembio.118

Полный текст CrossRef | Google Scholar

Хусто А., Миеттинен О., Флудас Д., Ортис-Сантана Б., Шёквист Э., Линднер Д. и др. (2017). Пересмотренная классификация Polyporales (Basidiomycota) на уровне семейства. Грибковая биол. 121 (9), 798–824. doi:10.1016/j.funbio.2017.05.010

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Киббл М., Сааринен Н., Танг Дж., Веннерберг К., Мякеля С. и Айттокаллио Т. (2015). Сетевые фармакологические приложения для отображения неизведанного целевого пространства и терапевтического потенциала натуральных продуктов. Нац. Произв. Респ. 32 (8), 1249–1266. doi:10.1039/c5np00005j

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Ким Дж.-W., Park, S.J., Lim, J.H., Yang, J.W., Shin, J.C., Lee, S.W., et al. (2013). Тритерпеноидные сапонины, выделенные из Platycodon grandiflorum, ингибируют репликацию вируса гепатита С. Доказательное дополнение. Альтерн. Мед. 2013, 1–11. doi:10.1155/2013/560417

Полный текст CrossRef | Google Scholar

Клотц Д., Баумгертнер В. и Герхаузер И. (2017). Интерфероны I типа в патогенезе и лечении заболеваний собак. Вет. Иммунол. Иммунопатология 191, 80–93.doi:10.1016/j.vetimm.2017.08.006

Полный текст CrossRef | Google Scholar

Книппинг К., Гарссен Дж. и Вантланд Б. (2012). Оценка ингибирующего действия экстрактов пищевых растений на ротавирусную инфекцию. Вирол. J. 9, 137–144. doi:10.1186/1743-422X-9-137

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Ли, X., Гу, К., Лян, М., Чжан, Ю., Ван, Ю. и Ли, Ю. (2020). Прогресс исследований химических компонентов и фармакологических эффектов Coicis Semen. Подбородок. Традиционные травяные лекарства 51 (21), 5645–5657. doi:10.7501/j.issn.0253-2670.2020.21.031

Полный текст CrossRef | Google Scholar

Liu X., Zhang Z., Liu J., Wang Y., Zhou Q., Wang S. и др. (2019). Гинзенозид Rg3 улучшает индуцированную циклофосфамидом иммунокомпетентность у мышей Balb/c. Междунар. Иммунофармакология 72, 98–111. doi:10.1016/j.intimp.2019.04.003

Полный текст CrossRef | Google Scholar

Мосманн, Т. (1983). Быстрый колориметрический анализ клеточного роста и выживания: применение для анализа пролиферации и цитотоксичности. J. Иммунологические методы 65, 55–63. doi:10.1016/0022-1759(83)-4

Полный текст CrossRef | Google Scholar

Накамура С., Ватанабэ Т., Танигава Т., Шимада С., Надатани Ю., Миядзаки Т. и др. (2018). Изоликвиритигенин улучшает индуцированное индометацином повреждение тонкой кишки путем ингибирования семейства NOD-подобных рецепторов, активации 3 инфламмасом, содержащих домен пирина. Противовоспалительное действие гликопротеина ямса на липополисахарид-индуцированное острое повреждение легких через сигнальный путь NLRP3 и NF-κB/TLR4. Фармакология. 101 (5-6), 236–245. doi:10.1159/000486599

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Niu, X., Zang, L., Li, W., Xiao, X., Yu, J., Yao, Q., et al. (2020). Противовоспалительное действие гликопротеина ямса на липополисахарид-индуцированное острое повреждение легких через сигнальный путь NLRP3 и NF-kB/TLR4. Междунар. Иммунофармак. 81, 106024. doi:10.1016/j.intimp.2019.106024

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Пу, Х.Б. (2017). Клиническое наблюдение порошка Shenling Baizhu при лечении детской осенней диареи. Азиатско-Тихоокеанский традиционный Med. 13 (11), 114–115. doi:10.11954/ytctyy.201711051

Полный текст CrossRef | Google Scholar

Ци, В. (2019). Клиническое исследование гранул Shenling Baizhu в сочетании с западной медициной при лечении ротавирусного энтерита у детей. Новый традиционный хин. Мед. 51 (4), 94–96. doi:10.13457/j.cnki.jncm.2019.04.030

Полный текст CrossRef | Google Scholar

Рид, Л.Дж. и Мюнх Х. (1938). Простой метод оценки пятидесяти процентов конечных точек12. утра. Дж. Хиг. 27 (3), 493–497. doi:10.1093/oxfordjournals.aje.a118408

CrossRef Full Text | Google Scholar

Росалес-Мартинес Д., Гутьеррес-Шикотенкатль Л., Бадильо-Годинез О., Лопес-Герреро Д., Сантана-Кальдерон А., Кортес-Гомес Р. и др. (2016). Ротавирус активирует дендритные клетки, полученные из моноцитов пуповинной крови. Микроб. Патогенез 99, 162–172.doi:10.1016/j.micpath.2016.08.020

Полный текст CrossRef | Google Scholar

Ru, J., Li, P., Wang, J., Zhou, W., Li, B., Huang, C., et al. (2014). TCMSP: база данных системной фармакологии для поиска лекарств из растительных лекарственных средств. Ж. Хеминформ 6 (1), 13–18. doi:10.1186/1758-2946-6-13

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Сайх К.У., Мораццани Э.М., Пайпер А.Е., Баккен Р.Р. и Гласс П.Дж. (2020). Низкомолекулярный ингибитор MyD88 проявляет противовирусную активность широкого спектра за счет повышающей регуляции интерферона I типа. Противовирусный рез. 181, 104854. doi:10.1016/j.antiviral.2020.104854

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Сен А., Шарма А. и Гринберг Х. Б. (2017). Ротавирус разрушает множественные рецепторы типа интерферона (IFN), чтобы ингибировать передачу сигналов IFN и защищает мышей-сосунков от смертности от эндотоксина. Дж. Вирол. 92 (1), e01394–17. doi:10.1128/JVI.01394-17

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Шэнь Дж., Chen, J.-J., Zhang, B.-M., Zhao, J., Chen, L., Ye, Q.-Y., et al. (2019). Байкалин является лечебным средством против ротавирусной влажной жары, настраивая барьер слизистой оболочки толстой кишки и иммунную функцию легких. Коп. Дис. науч. 65 (8), 2234–2245. doi:10.1007/s10620-019-05977-w

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Содерхольм, А. Т., и Педикорд, В. А. (2019). Эпителиальные клетки кишечника: на стыке микробиоты и иммунитета слизистой оболочки. Иммунология 158 (4), 267–280.doi:10.1111/imm.13117

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Шклярчик Д., Гейбл А. Л., Лайон Д., Юнге А., Видер С., Уэрта-Сепас Дж. и др. (2019). STRING v11: сети белок-белковых ассоциаций с увеличенным охватом, поддерживающие функциональные открытия в полногеномных экспериментальных наборах данных. Рез. нуклеиновых кислот. 47 (Д1), Д607–Д613. doi:10.1093/nar/gky1131

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Тейт Дж.Э., Бертон, А. Х., Боски-Пинто, К., и Парашар, У. Д. (2016). Глобальные, региональные и национальные оценки детской смертности от ротавирусной инфекции. клин. Заразить. Дис. 62 (Прил. 2), S96–S105. doi:10.1093/cid/civ1013

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Троегер К., Халил И. А., Рао П. К., Цао С., Блэкер Б. Ф., Ахмед Т. и др. (2018). Вакцинация против ротавирусной инфекции и глобальное бремя ротавирусной диареи среди детей младше 5 лет. JAMA Педиатр. 172 (10), 958–965. doi:10.1001/jamapediatrics.2018.1960

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Утияма Р., Чессейн Б., Чжан Б. и Гевирц А. Т. (2014). Опосредованная MyD88 передача сигналов TLR защищает от острой ротавирусной инфекции, в то время как воспалительные цитокины направляют ответ антител. Врожденный иммун. 21 (4), 416–428. doi:10.1177/17534257435

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Сюй Х.-Ю., Чжан Ю.-Q., Liu, Z.-M., Chen, T., Lv, C.-Y., Tang, S.-H., et al. (2018). ETCM: энциклопедия традиционной китайской медицины. Рез. нуклеиновых кислот . Октябрь 47, D976–D982. doi:10.1093/nar/gky987

Полный текст CrossRef | Google Scholar

Ян, Х., О, К.-Х., Ким, Х.Дж., Чо, Ю.Х., и Ю, Ю.К. (2018a). Ginsenoside-Rb2 и 20(S)-Ginsenoside-Rg3 из корейского красного женьшеня предотвращают ротавирусную инфекцию у новорожденных мышей. J. Microbiol. Биотехнолог. 28 (3), 391–396.doi:10.4014/jmb.1801.01006

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Ян Дж., Ли С., Ван Л., Ду Ф., Чжоу X., Сун К. и др. (2018б). Гинзенозид Rg3 ослабляет липополисахарид-индуцированное острое повреждение легких посредством MerTK-зависимой активации пути PI3K/AKT/mTOR. Фронт. Фармакол. 9, 850–863. doi:10.3389/fphar.2018.00850

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Е Л., ​​Цзян Ю., Ян Г., Ян В., Hu, J., Cui, Y., et al. (2017). ДК мышиного костного мозга, активированные ротавирусом свиньи, стимулируют ответ подтипа Th2 in vitro . Микроб. Патогенез 110, 325–334. doi:10.1016/j.micpath.2017.07.015

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Ye, Y., Pei, L., Ding, J., Wu, C., Sun, C., Liu, S., et al. (2019). Влияние платикодина D на индуцированный S100A8/A9 воспалительный ответ в клетках карциномы молочной железы мышей 4T1. Спирт пачули активирует PXR и подавляет NF-κB-опосредованное воспаление кишечника. Междунар. ImmunopharmacologyJournal Ethnopharmacology 67, 239–247. doi:10.1016/j.intimp.2018.12.008

Полный текст CrossRef | Google Scholar

Zhang, H.-H., Yu, W.-Y., Li, L., Wu, F., Chen, Q., Yang, Y., et al. (2018). Защитные эффекты дикетопиперазинов из Moslae Herba против воспаления легких, вызванного вирусом гриппа А, путем ингибирования репликации вируса и агрегации тромбоцитов. J. Этнофармакология 215, 156–166. doi:10.1016/j.jep.2018.01.005

Полнотекстовая перекрестная ссылка | Google Scholar

Zhou, R.X., Song, L.J., Shi, X.Y., Wang, X.T., Tan, W.P., Lu, H.Q., et al. (2019). Изучение антиротавирусного действия Atractylodes I, II и III in vivo и in vitro . Подбородок. травяная мед. 50 (1), 104–110. doi:10.7501/j.issn.0253-2670.2019.01.017

Полный текст CrossRef | Google Scholar

Медицинская терапия ротавирусной инфекции – wikidoc

Главный редактор: C.Майкл Гибсон, MS, MD [1]; Заместитель главного редактора: Ахмед Эльсайи, MBBCH [2]

Обзор

Наиболее важным аспектом лечения вирусного гастроэнтерита у детей и взрослых является предотвращение обезвоживания. Это лечение должно начинаться дома. Врач может дать конкретные инструкции о том, какие виды жидкости давать. CDC рекомендует семьям с младенцами и маленькими детьми всегда иметь дома запас раствора для пероральной регидратации (ОРС) и использовать его, когда у ребенка впервые возникает диарея.Лекарств, в том числе антибиотиков (которые не действуют на вирусы) и других методов лечения следует избегать, если только это не рекомендовано врачом.

Медицинская терапия

Целью лечения является предотвращение обезвоживания путем обеспечения организма достаточным количеством воды и жидкости. Жидкости и электролиты (соли и минералы), потерянные из-за диареи или рвоты, должны быть восполнены дополнительным потреблением жидкости. Даже если больной может есть, он все равно должен пить больше жидкости между приемами пищи.

  • Дети старшего возраста и взрослые могут пить спортивные напитки, такие как Gatorade, но их нельзя употреблять детям. Вместо этого используйте растворы для замещения электролитов и жидкости или леденцы, доступные в магазинах продуктов питания и аптеках.
  • Не используйте фруктовые соки (включая яблочный сок), газированные напитки или колу (без газа или без газа), желе или бульон. Все они содержат много сахара, который усугубляет диарею, и они не заменяют потерянные минералы.
  • Пейте небольшое количество жидкости (2-4 унции.) каждые 30-60 минут, вместо того, чтобы пытаться форсировать большие количества за один раз, что может вызвать рвоту. Используйте чайную ложку или шприц для младенца или маленького ребенка.
  • Грудное молоко или смесь можно продолжать давать вместе с дополнительными жидкостями. Пациенту не нужно переходить на соевую смесь.

Пищу можно предлагать часто в небольших количествах. Предлагаемые продукты включают:

  • Крупы, хлеб, картофель, постное мясо
  • Простой йогурт, бананы, свежие яблоки
  • Овощи

Людям с диареей, которые не могут пить жидкости из-за тошноты, могут потребоваться внутривенные (непосредственно в вену) жидкости.Особенно это касается маленьких детей. Антибиотики не действуют на вирусы. Лекарства для замедления диареи (противодиарейные препараты) не следует давать без предварительной беседы с лечащим врачом. Они могут привести к тому, что инфекция продлится дольше. Не давайте эти противодиарейные препараты детям, если это не предписано врачом. Людям, принимающим водные таблетки (диуретики), у которых развилась диарея, лечащий врач может порекомендовать им прекратить прием диуретиков во время острого эпизода.Тем не менее, не прекращайте принимать лекарства, отпускаемые по рецепту, без предварительной консультации с врачом. Риск обезвоживания наиболее высок у младенцев и детей младшего возраста, поэтому родители должны внимательно следить за количеством смен мокрых подгузников в день, когда их ребенок болен.

  • Лечение диареи, вызванной ротавирусом
  • Регидратация раствором солей для пероральной регидратации (ОРС). Раствор солей для пероральной регидратации (ОРС) представляет собой смесь чистой воды, соли и сахара.Это стоит несколько центов за лечение. Раствор солей для пероральной регидратации (ОРС) всасывается в тонком кишечнике и замещает воду и электролиты, потерянные с фекалиями.
  • Добавки цинка: добавки цинка сокращают продолжительность эпизода диареи на 25% и связаны с уменьшением объема стула на 30%.
  • Регидратация внутривенными жидкостями в случае сильного обезвоживания или шока.
  • Пищевые продукты, богатые питательными веществами. Порочный круг недоедания и диареи можно разорвать, продолжая давать пищевые продукты, богатые питательными веществами, включая грудное молоко, во время приступа, а также обеспечивая питательную диету, включая исключительно грудное вскармливание, в течение первых шести месяцев жизни детей, когда они хорошо.
  • Консультация медицинского работника, в частности, для лечения затяжной диареи или при наличии крови в стуле или при наличии признаков обезвоживания.
Примечание (1): Ротавирус и кишечная палочка являются двумя наиболее распространенными этиологическими агентами диареи в развивающихся странах.
Примечание (2): противовирусных препаратов для лечения ротавирусной инфекции не существует. Антибиотики не помогут, потому что антибиотики борются с бактериями, а не с вирусами.
Примечание (3): Ротавирусная инфекция может вызывать сильную рвоту и диарею.Это может привести к обезвоживанию (потере жидкости в организме). Во время ротавирусной инфекции наибольшему риску обезвоживания подвергаются младенцы и маленькие дети, пожилые люди и люди с другими заболеваниями.
Примечание (4): Симптомы обезвоживания включают снижение мочеиспускания, сухость во рту и горле, головокружение при вставании. Обезвоженный ребенок может также плакать с небольшим количеством слез или вообще без слез и быть необычно сонливым или суетливым.

Каталожные номера

Ротавирусная диарея крупного рогатого скота и других домашних животных

  • Adah, M.И., Нагашима С., Вакуда М. и Танигути К., 2003. Тесная связь между ротавирусами крупного рогатого скота серотипа G8 и человеческим, выделенными в Нигерии. Journal of Clinical Microbiology , 41, 3945–3950

    PubMed КАС Google ученый

  • Агравал Д.К., Сингх Н.П. и Чаухан, Р.С., 2002. Колостральные антитела против ротавирусной инфекции у новорожденных телят. Журнал иммунологии и иммунопатологии , 4, 107–109

    Google ученый

  • Айх, П., Wilson, H.L., Kaushik, R.S., Potter, A.A., Babiuk, L.A. and Griebel, P., 2007. Сравнительный анализ врожденных иммунных реакций после заражения новорожденных телят бычьим ротавирусом и бычьим коронавирусом. Journal of General Virology , 88, 2749–2761

    PubMed КАС Google ученый

  • Альфиери, А.Ф., Альфиери, А.А., Баррейрос, М.А., Лейте, Дж.П. и Рихценхайн, Л.Дж., 2004. Генотипы G и P штаммов ротавируса группы А, циркулирующие у телят в Бразилии, 1996–1999 гг. Ветеринарная микробиология , 99, 167–173

    PubMed Google ученый

  • Альфьери А.А., Парацци М.Э., Такиучи Э., Медичи К.С. и Alfieri, A.F., 2006. Частота ротавируса группы А у телят с диареей в бразильских стадах крупного рогатого скота, 1998–2002 гг. Здоровье и производство тропических животных , 38, 521–526

    PubMed КАС Google ученый

  • Барбоза, Э.Ф., Фигейредо, Х.Ч.П., Гарсия, А.М., Лобато, З.И.П. и Lage, A.P., 1998. Ротавирус группы А у телят в штате Минас-Жерайс, Бразилия. Ciencia Rural , 28, 435–439

    Google ученый

  • Barrandeguy, M., Parreno, V., Lagos Marmol, M., Pont Lezica, F., Rivas, C., Valle, C. and Fernandez, F., 1998. Профилактика ротавирусной диареи у жеребят путем парентеральная вакцинация кобыл: полевые испытания. Разработка биологических стандартов , 92, 253–257

    CAS Google ученый

  • Бендали, Ф., Bichet, H., Schelcher, F. и Sanaa, M., 1999. Характер диареи у новорожденных телят мясного направления на юго-западе Франции. Ветеринарные исследования , 30, 61–74

    PubMed КАС Google ученый

  • Бильбао, Г.Н., Чакана, П.А., Мендибуру, А., Родригес, Э., Блэкхолл, Дж.О. и Terzolo, H.R., 2006. Профилактика неонатальной диареи у молочных телят с использованием иммуноглобулинов яичного желтка (IgY). Revue Medicinia Veterinaria Buenos Aires , 87, 135–139

    Google ученый

  • Берч, К.Дж., Хит, Р.Л., Маршалл, Дж.А., Лю, С. и Гаст, И.Д., 1985. Выделение кошачьих ротавирусов и их связь с изолятами человека и обезьян по электроферотипу и серотипу. Journal of General Virology , 66, 2731–2735

    PubMed КАС Google ученый

  • Блатт, Ю.Е. и Conner, ME, 2007. Ротавирус: в кишечник и дальше! Текущие мнения в области гастроэнтерологии , 23, 39–43

    Google ученый

  • Бриджер, Дж.C., 1994. Определение вирулентности бычьего ротавируса. Journal of General Virology , 75, 2807–2812

    PubMed Google ученый

  • Бриджер, Дж. К., Вуд, Г. Н., Джонс, Дж. М., Флеветт, Т. Х., Брайден, А. С. и Davies, H., 1975. Передача ротавирусов человека гнотобиотическим поросятам. Journal of Medical Microbiology , 8, 565–569

    PubMed КАС Google ученый

  • Брюссов, Х., Nakagomi, O., Gerna, G. и Eichhorn, W., 1992. Выделение птичьего ротавируса группы А от теленка с диареей. Journal of Clinical Microbiology , 30, 67–73

    PubMed КАС Google ученый

  • Каструччи Г., Фриджери Ф., Феррари М., Чилли В., Калеффи Ф., Альдрованди В. и Нигрелли А., 1984a. Эффективность молозива от коров, вакцинированных ротавирусом, для защиты телят от экспериментально индуцированной ротавирусной инфекции. Сравнительная иммунология и микробиология , 7, 11–18

    CAS Google ученый

  • Каструччи Г., Фриджери Ф., Феррари М., Чилли В., Альдрованди В., Калеффи Ф. и Гатти Р., 1984b. Сравнительное изучение штаммов ротавирусов крупного рогатого скота и кроликов. Сравнительная иммунология и микробиология , 7, 171–178

    Google ученый

  • Каструччи, Г., Frigeri, F., Ferrari, M., Cilli, V., Aldronvandi, V., Gatti, R. and Rampichini, L., 1985. Сравнение штаммов ротавируса крупного рогатого скота, обезьян и свиней. Европейский журнал эпидемиологии , 1, 274–280

    PubMed КАС Google ученый

  • Каструччи Г., Фригери Ф., Феррари М., Альдрованди В., Тассини Ф. и Гатти Р., 1988a. Защита новорожденных телят от экспериментальной ротавирусной инфекции путем скармливания молочных выделений вакцинированных коров. Microbiologica , 11, 379–385

    PubMed КАС Google ученый

  • Каструччи Г., Фригери Ф., Феррари М., Чилли В., Гуаланди Г.Л. и Альдрованди В., 1988b. Диарея новорожденных телят, вызванная ротавирусом. Сравнительная иммунология и микробиология , 11, 71–84

    CAS Статья Google ученый

  • Чейси Д. и Бэнкс Дж., 1986. Репликация атипичного ротавируса овец в тонком кишечнике и культуре клеток. Journal of General Virology , 67, 567–576

    PubMed Google ученый

  • Чаухан, Р.С. и Сингх, Н.П., 1992а. Экспресс-диагностика ротавирусной инфекции у телят методом дот-иммуносвязывания. Ветеринарная запись , 130, 381

    PubMed КАС Google ученый

  • Чаухан Р.С. и Сингх Н.П., 1992b. Клеточный иммунный ответ у телят, инфицированных ротавирусом: анализ ингибирования миграции лейкоцитов. Journal of Comparative Pathology , 107, 115–118

    PubMed КАС Google ученый

  • Чаухан, Р.С. и Сингх, Н.П., 1992c. Выявление ротавирусной инфекции у телят методом иммунофлуоресценции. Journal of Applied Animal Research , 1, 51–55

    Google ученый

  • Чаухан Р.С. и Сингх Н.П., 1992d. Оценка повреждения кишечника у телят, инфицированных ротавирусом, с помощью теста мальабсорбции D-ксилозы. Индийский журнал ветеринарной патологии , 16, 13–16

    Google ученый

  • Чаухан, Р.С. и Сингх, Н.П., 1992e. Цитопатология, индуцированная ротавирусом в клетках почек плода макаки-резус (MA104). Индийский журнал ветеринарной патологии , 16, 76–78

    Google ученый

  • Чаухан Р.С. и Сингх Н.П., 1993а. Ротавирусная инфекция у телят – электронно-микроскопические исследования. Израильский журнал ветеринарных исследований , 48, 110–112

    Google ученый

  • Чаухан, Р.С. и Сингх, Н.П., 1993b. Ротавирусная инфекция телят – диагностика с помощью электрофореза в полиакриламидном геле. Индийский журнал наук о животных , 63, 1–3

    Google ученый

  • Чаухан Р.С. и Сингх Н.П., 1996. Эпидемиология ротавирусной инфекции у телят в Индии. International Journal of Animal Sciences , 11, 221–223

    Google ученый

  • Чаухан, Р.С. и Сингх, Н.П., 1999. Обнаружение ротавируса у экспериментально инфицированных телят с использованием иммунопероксидазного метода. Индийский журнал наук о животных , 69, 239–291

    Google ученый

  • Чаухан Р.С. и Сингх, Н.П., 2001. Демонстрация клеток, продуцирующих антиротавирусные антитела, в кишечнике телят с использованием метода иммунопероксидазы. Журнал иммунологии и иммунопатологии , 3, 41–44

    Google ученый

  • Чаухан, Р.С., Дхама, К. и Махендран, М., 2008 г. Патобиология ротавирусной диареи у телят, ее диагностика и контроль: обзор. Журнал иммунологии и иммунопатологии , 10, 1–13

    Google ученый

  • Чинсангарам, Дж., Шор, К.Э., Гутербок, В., Уивер, Л.Д. и Osburn, B.I., 1995. Распространенность ротавирусов группы А и группы В в фекалиях новорожденных молочных телят из Калифорнии. Сравнительная иммунология и микробиология , 18, 93–103

    CAS Google ученый

  • Ciarlet, M., Pina, C.I., Garcia, O. и Liprandi, F., 1997. Идентификация ротавирусов крупного рогатого скота в Венесуэле: антигенная и молекулярная характеристика штамма ротавируса крупного рогатого скота. Исследования в области вирусологии , 148, 289–297

    PubMed КАС Google ученый

  • Чиарлет, М., Кроуфорд, С.Э., Бароне, К., Бертолотти-Чиарлет, А., Рэмиг, Р.Ф., Эстес, М.К. и Conner, M.E., 1998. Субъединичная ротавирусная вакцина, введенная парентерально кроликам, индуцирует активный защитный иммунитет. Journal of Virology , 72, 9233–9246

    PubMed КАС Google ученый

  • Чиарлет, М., Ia, P., Conner, M.E. и Liprandi, F., 2001. Антигенный и молекулярный анализы показывают, что штамм ротавируса лошадей H-1 тесно связан со свиными, но не с лошадиными ротавирусами: межвидовая передача от свиней к лошадям? Вирусные гены , 22, 5–20

    PubMed КАС Google ученый

  • Кук, Н., Бриджер, Дж., Кендалл, К., Гомара, М.И., Эль-Аттар, Л. и Грей, Дж., 2004. Зоонозный потенциал ротавируса. Journal of Infection , 48, 289–302

    PubMed Google ученый

  • Day, JM, Spackman, E. and Pantin-Jackwood, M., 2007. Мультиплексный тест RT-PCR для дифференциальной идентификации астровируса индейки типа 1, астровируса индейки типа 2, астровируса курицы, вируса птичьего нефрита, и птичий ротавирус. Болезни птиц , 51, 681–684

    PubMed Google ученый

  • Де Грация, С., Мартелла В., Джамманко Г.М., Гомара М.И., Рамирес С., Касио А., Коломба К. и Ариста С., 2007 г. Штамм ротавируса G3P[3] собачьего происхождения у ребенка с острым гастроэнтеритом . Emerging Infectious Diseases , 13, 1091–1093

    PubMed Google ученый

  • De Leeuw, P.W., Ellens, D.J., Straver, P.J., Balken, J.A.M., Meerman, A. and Baanvinger, T., 1980. Ротавирусные инфекции у телят в молочных стадах. Исследования в области ветеринарии , 29, 135–141

    PubMed Google ученый

  • де Вердье Клингенберг, К.и Svensson, L., 1998. Ротавирус группы А как причина неонатального энтерита телят в Швеции. Acta Veterinaria Scandinavia , 39, 195–199

    Google ученый

  • Dennehy, M., Bourn, W., Steele, D. и Williamson, A.L., 2007. Оценка рекомбинантной БЦЖ, экспрессирующей ротавирус VP6, в качестве антиротавирусной вакцины. Вакцина , 25, 3646–3657

    PubMed КАС Google ученый

  • Дессельбергер, У., Iturriza-Gomara, M. and Gray, J.J., 2001. Эпидемиология и эпиднадзор за ротавирусом. В: Чедвик Д., Гуд Дж. А. (ред.), Вирусы гастроэнтерита, Уайли, Нью-Йорк, США, 82–100.

    Google ученый

  • Дессельбергер У., Грей Дж. и Эстес М.К., 2005. Ротавирусы. В: B.W.J. Мэхи и В.Т. Meulen (eds), Topley and Wilson’s Microbiology and Microbial инфекция, ASM Press, USA, 946–958

    Google ученый

  • Дхама, К., Чаухан, Р.С., Катариа, Дж.М., Махендран, М. и Томар, С., 2005 г. Птичий грипп: текущие перспективы. Журнал иммунологии и иммунопатологии , 7, 1–33

    Google ученый

  • Дхама, К., Махендран, М., Гупта, П.К. и Рай А., 2008 г. ДНК-вакцины и их применение в ветеринарной практике: современные перспективы. Ветеринарные исследовательские коммуникации 32 , 341–356

    PubMed КАС Google ученый

  • Дхаракул, Т., Rott, L. и Greenberg, H.B., 1990. Восстановление после хронической ротавирусной инфекции у мышей с тяжелым комбинированным иммунодефицитом: элиминация вируса, опосредованная адоптивным переносом иммунных CD8+T-лимфоцитов. Journal of Virology , 64, 4375–4382

    PubMed КАС Google ученый

  • Додет Б., Хезелтин Э., Мэри К. и Салиу П., 1997. Ротавирусы в медицине и ветеринарии. Sante , 7, 195–199

    PubMed КАС Google ученый

  • Дуань З., Ли, Д., Чжан, К., Лю, Н., Хуанг, К., Цзян, X., Цзян, Б., Гласс, Р., Стил, Д., Тан, Дж., Ван, З. и Fang, Z., 2007. Новый ротавирус человека генотипа G5P[6], идентифицированный в образце стула китайской девочки с диареей. Journal of Clinical Microbiology , 45, 1614–1617

    PubMed КАС Google ученый

  • Эллис, Г.Р. и Daniels, E., 1988. Сравнение прямой электронной микроскопии и иммуноферментного анализа для обнаружения ротавирусов у телят, ягнят, поросят и жеребят. Австралийский ветеринарный журнал , 65, 133–135

    PubMed КАС Google ученый

  • Эстес, М.К., 2001. Ротавирусы и их репликация. В: Найп, Д.М., Хоули, П.М. (ред.), Вирусология Филда, Липпинкотт Уильямс и Уилкинс, Филадельфия, США, 1747–1785 гг.

    Google ученый

  • Эстес, М.К., 2003. Ротавирусный энтеротоксин NSP4: текущее состояние и проблемы, В: Дессельбергер, У., Грей, Дж. (ред.), Вирусный гастроэнтерит, Elsevier Science, Амстердам, Нидерланды, 207–224.

    Google ученый

  • Фернандес, Ф.М., Коннер, М.Е., Ходжинс, Д.К., Парвани, А.В., Нильсен, П.Р., Кроуфорд, С.Е., Эстес, М.К. и Saif, L.J., 1998. Пассивный иммунитет к ротавирусу крупного рогатого скота у новорожденных телят, получавших молозиво от коров, иммунизированных рекомбинантными вакцинами на основе ядерных частиц (CLP) или вирусоподобных частиц (VLP) против ротавируса SA11. Вакцина , 16, 507–516

    PubMed КАС Google ученый

  • Fukai, K., Sakai, T. and Kamata, H., 1998. Распространение серотипов G и генотипов P бычьего ротавируса группы А, выделенного в Японии. Австралийский ветеринарный журнал , 76, 418–422

    PubMed КАС Google ученый

  • Фукаи К., Маэда Ю., Фудзимото К., Ито Т. и Сакаи Т., 2002. Изменения в распространенности ротавирусов типов G и P у страдающих диареей телят из префектуры Кагосима в Японии. Ветеринарная микробиология , 86, 343–349

    PubMed КАС Google ученый

  • Фукаи, К., Сайто, Т., Фукуда, О., Хагивара, А., Иноуэ, К. и Сато, М., 2006. Молекулярная характеристика лошадиного ротавируса группы А, Насуно, выделенного в префектуре Тотиги , Япония. Ветеринарный журнал , 172, 369–373

    CAS Google ученый

  • Фукаи К., Takahashi, T., Tajima, K., Koike, S., Iwane, K. и Inoue, K., 2007. Молекулярная характеристика нового бычьего ротавируса группы A. Ветеринарная микробиология , 123, 217–224

    PubMed КАС Google ученый

  • Фултон, Р.В., Джонсон, К.А., Пирсон, Дж. и Вуд, Г.Н., 1981. Выделение ротавируса у новорожденной собаки с диареей. Американский журнал ветеринарных исследований , 42, 841–843

    PubMed КАС Google ученый

  • Гарайкоэчеа, Л., Бок К., Джонс Л.Р., Комбесси Г., Одеон А., Фернандес Ф. и Паррено В., 2006 г. Молекулярная характеристика ротавируса крупного рогатого скота, циркулирующего в мясных и молочных стадах в Аргентине в течение 10 лет. период (1994–2003 гг.). Ветеринарная микробиология , 118, 1–11

    PubMed КАС Google ученый

  • Гарсия-Диас, А., Лопес-Андухар, П., Родригес Диас, Дж., Монтава, Р., Торрес Барсело, К., Рибес, Дж. М. и Буэса, Дж., 2004.Назальная иммунизация мышей ротавирусной ДНК-вакциной, которая индуцирует защитные кишечные антитела IgA. Вакцина , 23, 489–498

    PubMed КАС Google ученый

  • Гош С., Варгезе В., Самайдар С., Синха М., Кобаяши Н. и Наик Т.Н., 2007a. Молекулярная характеристика штаммов ротавируса крупного рогатого скота группы А G3P[3]. Архив вирусологии , 152, 1935–1940

    PubMed КАС Google ученый

  • Гош, С., Варгезе В., Синха М., Кобаяши Н. и Найк Т.Н., 2007b. Доказательства передачи между штатами и увеличения распространенности штаммов ротавируса крупного рогатого скота группы B с новым генотипом VP7 среди страдающих диареей телят в восточных и северных штатах Индии. Эпидемиология инфекций , 135, 1324–1330

    CAS Google ученый

  • Гилл Х. и Прасад Дж., 2008 г. Пробиотики, иммуномодуляция и польза для здоровья. Достижения в области экспериментальной и медицинской биологии , 606, 423–454

    Google ученый

  • Грэм, К.L., Takada, Y. and Coulson, B.S., 2006. Ротавирусный шиповидный белок VP5* связывает интегрин альфа-2-бета-1 на поверхности клеток и конкурирует с вирусом за связывание клеток и инфекционность. Journal of General Virology , 87, 1275–1283

    PubMed КАС Google ученый

  • Gueguen, C., Maga, A., McCrae, M.A. и Bataillon, G., 1996. Ротавирусы коз и крупного рогатого скота в западной Франции: групповая идентификация путем северной гибридизации. Ветеринарные исследования , 27, 171–176

    PubMed КАС Google ученый

  • Гулати Б.Р., Дипа Р., Сингх Б.К. и Rao, C.D., 2007. Разнообразие ротавирусов индийских лошадей: идентификация штаммов генотипа G10, P6[1] и G1 и нового штамма генотипа VP7 (G16) в образцах жеребят, страдающих диареей, в Индии. Journal of Clinical Microbiology , 45, 972–978

    PubMed КАС Google ученый

  • Гумусова С.O., Yazici, Z., Albayrak, H. и Meral, Y., 2007. Распространенность ротавируса и коронавируса у здоровых телят и телят с диареей. Медицина Ветеринария , 63, 62–64

    Google ученый

  • Холл, Г.А., Парсонс, К.Р., Рейнольдс, Д.Дж. и Morgan, J.H., 1985. Обнаружение энтеропатогенных вирусов в залитых парафином тканях кишечника телят с помощью иммунопероксидазы. Журнал медицинской микробиологии , 19, 14

    Google ученый

  • Холл, Г.А., Бриджер, Дж.К., Парсон, К.Р. и Cook, R., 1993. Изменение вирулентности ротавируса: сравнение патогенеза у телят двух ротавирусов с разной вирулентностью. Ветеринарная патология , 30, 223–233

    PubMed КАС Google ученый

  • Hammami, S., Castro, AE и Osburn, BI, 1990. Сравнение электрофореза в полиакриламидном геле, иммуноферментного анализа и реакции агглютинации для прямой идентификации бычьего ротавируса из фекалий и коэлектрофореза вирусных РНК. Journal of Veterinary Diagnostic Investigation , 2, 184–190

    PubMed КАС Google ученый

  • Hasso, S.A. and Pandey, R., 1986. Возможные половые различия в восприимчивости телят к ротавирусной инфекции. Canadian Journal of Veterinary Research , 50, 287–288

    PubMed КАС Google ученый

  • Генрих Х.В., Ширмайер Х., Lange, E. и Granzow, H., 1983. Перекрестная инфекция ротавирусами разных видов. Архив экспериментальной ветеринарной медицины , 37, 55–60

    CAS Google ученый

  • Herrmann, J.E., 2006. ДНК-вакцины против кишечных инфекций. Вакцина , 24, 3705–3708

    PubMed КАС Google ученый

  • Holland, R.E., 1990. Некоторые инфекционные причины диареи у молодых сельскохозяйственных животных. Клинические микробиологические обзоры , 3, 345–375

    CAS Google ученый

  • Хосино Ю., Болдуин К.А. и Scott, F.W., 1981. Выделение и характеристика кошачьего ротавируса. Journal of General Virology , 54, 313–323

    PubMed КАС Google ученый

  • Hoshino, Y., Wyatt, R.G., Scott, F.W. и Appel, M.J., 1982. Выделение и характеристика собачьего ротавируса. Архив вирусологии , 72, 113–125

    PubMed КАС Google ученый

  • Hoshino, Y., Wyatt, RG, Greenberg, HB, Kalica, AR, Flores, J. and Kapikian, AZ, 1983. Серологическое сравнение собачьего ротавируса с различными обезьяньими и человеческими ротавирусами путем нейтрализации уменьшения бляшек и ингибирования гемагглютинации тесты. Инфекция и иммунитет , 41, 169–173

    PubMed КАС Google ученый

  • Хуан Дж.А., Нагеша, Х.С., Снодграсс, Д.Р. и Holmes, I.H., 1992. Молекулярный и серологический анализ двух бычьих ротавирусов (B-11 и B-60), вызывающих диарею у телят в Австралии. Journal of Clinical Microbiology , 30, 85–92

    PubMed КАС Google ученый

  • Хусейн А.Х., Корналья Э., Сабер М.С. и el-Azhary, Y., 1995. Распространенность ротавирусов серотипов G6 и G10 группы A у молочных телят в Квебеке. Canadian Journal of Veterinary Research , 59, 235–237

    PubMed КАС Google ученый

  • Имагава, Х., Исида С., Уэсуги С., Масанобу К., Фукунага Ю. и Накагоми О., 1994. Генетический анализ ротавируса лошадей методом гибридизации РНК-РНК. Journal of Clinical Microbiology , 32, 2009–2012

    PubMed КАС Google ученый

  • Jackwood, P.M.J., Spackman, E., Day, J.M. и Rives, D., 2007. Периодический мониторинг коммерческих индеек на наличие кишечных вирусов указывает на постоянное присутствие астровируса и ротавируса на фермах. Болезни птиц , 51, 674–680

    Google ученый

  • Каминджоло, Дж.С. и Adesiyun, A.A., 1994. Ротавирусная инфекция у телят, поросят, ягнят и козлят в Тринидаде. Британский ветеринарный журнал , 150, 293–299

    PubMed КАС Google ученый

  • Кан, Б.К., Сонг, Д.С., Юнг, К.И., Ли, К.С., Пак, С.Дж., О, Дж.С., Ан, Д.Дж., Ян, Дж.С., Мун, Х.Дж., Ли, С.С., Юн, Ю.Д. и Парк, Б.К., 2007. Генетическая характеристика собачьего ротавируса, выделенного от щенка в Корее, и экспериментальное воспроизведение болезни. Journal of Veterinary Diagnostic Investigation , 19, 78–83

    PubMed Google ученый

  • Кхамрин, П., Манекарн, Н., Пиракоме, С., Ягю, Ф., Окицу, С. и Усидзима, Х., 2006. Молекулярная характеристика редкого реассортантного штамма ротавируса человека G3P[3] выявила доказательства множественной межвидовой передачи от человека к животному. Journal of Medical Virology , 78, 986–994

    PubMed КАС Google ученый

  • Кхамрин П., Манекарн Н., Пиракоме С., Чан-ит В., Ягю Ф., Окицу С. и Усиджима Х., 2007. Новый свиной ротавирус генотипа P[ 27] разделяет новую филогенетическую линию со штаммом ротавируса свиней G2. Вирусология , 361, 243–252

    Google ученый

  • Хараламбиев К.Х., Георгиев, Г.К. и Митов Б., 1983. Иммуноферментный анализ (ИФА) для выявления ротавируса. Ветеринарный бюллетень , 53, 5274

    Google ученый

  • Ким Ю., Нильсен П.Р., Ходжинс Д., Чанг К.О. и Саиф Л.Дж., 2002а. Реакции лактогенных антител у коров, вакцинированных рекомбинантными бычьими ротавирусоподобными частицами (ВПЧ) двух серотипов или инактивированными бычьими ротавирусными вакцинами. Вакцина , 20, 1248–1258

    PubMed КАС Google ученый

  • Ким Б., Бауэрсок Т., Грибель П., Кидане А., Бабюк Л.А., Санчес М., Аттах-Поку С., Каушик Р.С. и Мутвири, Г.К., 2002b. Иммунные ответы слизистых оболочек после пероральной иммунизации ротавирусными антигенами, инкапсулированными в альгинатные микросферы. Journal of Controlled Release , 85, 191–202

    PubMed КАС Google ученый

  • Kohara, J. and Tsunemitsu, H., 2000. Корреляция между материнскими сывороточными антителами и защитой от бычьей ротавирусной диареи у телят. Journal of Veterinary Medical Science , 62, 219–221

    PubMed КАС Google ученый

  • Комото С., Сасаки Дж. и Танигучи К., 2006 г. Система обратной генетики для введения сайт-специфических мутаций в двухцепочечный РНК-геном инфекционного ротавируса. Proceedings of the National Academy of Science, USA , 103, 4646–4651

    CAS Google ученый

  • Ли, Дж.Б., Юн, С.Дж., Накагоми, Т., Пак, С.Ю., Ким, Т.Дж., Сонг, К.С., Джанг, Х.К., Ким, Б.С. и Nakagomi, O., 2003. Выделение, серологическая и молекулярная характеристика первого ротавируса коз G3. Архив вирусологии , 148, 643–657

    PubMed КАС Google ученый

  • Легротталье Р., Вольпе А., Рицци В. и Агрими П., 1993. Выделение и идентификация ротавирусов как этиологических агентов неонатальной диареи у детей.Электрофоретическая характеристика с помощью PAGE. Новая микробиология , 16, 227–235

    CAS Google ученый

  • Луан, Дж. Дж., Ян, С. Х., Чжан, В. Дж., Гао, Ю. Д., Чжун, Дж. Ф. и Чжао, Х. К., 2006. Быстрое обнаружение ротавируса крупного рогатого скота с помощью полугнездового анализа ОТ-ПЦР. Китайский журнал зоонозов , 22, 671–673

    CAS Google ученый

  • Лугинбуль, А., Reitt, K., Metzler, A., Kollbrunner, M., Corboz, L. and Deplazes, P., 2005. Полевое исследование распространенности и диагностики агентов, вызывающих диарею, у новорожденных телят в швейцарской ветеринарной клинике. . Schweiz Arch Tierheilkd , 147, 245–252

    PubMed КАС Google ученый

  • Малик, С.В.С., Кумар, А. и Бхилегаонкар, К.Н., 1995. Ротавирус – новый энтеропатоген человека и животных: обзор. Journal of Communicable Diseases , 27, 199–207

    PubMed КАС Google ученый

  • Малик С.В.С., Барбудде С.Б., Равул Д.Б., Вайдья В.М. и Sahare, A.M., 2005. Информационный бюллетень по ротавирусам (Глобальный статус ротавирусных инфекций у человека и животных), В: Справочник по здоровью животных и производству, CAB International, Уоллингфорд, Великобритания.

  • Мартелла В., Прателли А., Греко Г., Джентиле М., Фьоренте П., Темпеста М. и Буонаволья К., 2001a. Вариация нуклеотидной последовательности гена VP7 двух ротавирусов типа G3, выделенных от собак. Virus Research , 74, 17–25

    PubMed КАС Google ученый

  • Мартелла, В., Прателли А., Элиа Г., Декаро Н., 2001b. Tempesta M., Buonavoglia C., Выделение и генетическая характеристика двух штаммов ротавируса собак G3P5A [3] в Италии. Journal of Virological Methods , 96, 43–49

    PubMed КАС Google ученый

  • Мартелла В., Баньяи К., Лоруссо Э., Беллачикко А.Л., Декаро Н., Камеро М., Боццо Г., Мошиду П., Ариста С., Пеццотти, Г., Лавацца А. и Буонаволья К., 2007а.Распространенность ротавирусов группы С у поросят-отъемышей и поросят после отъема с энтеритом. Ветеринарная микробиология , 123, 26–33

    PubMed Google ученый

  • Мартелла В., Чиарлет М., Баньяи К., Лоруссо Э., Ариста С., Лавацца А., Пеццотти Г., Декаро Н., Кавалли А. и Лусенте , МС, 2007б. Идентификация штаммов ротавируса свиней группы А, несущих новый генотип VP4 (P) в итальянских стадах свиней. Journal of Clinical Microbiology , 45, 577–580

    PubMed КАС Google ученый

  • Маскареньяс, Дж.Д., Лейте, Дж.П., Лима, Дж.К., Хайнеманн, М.Б., Оливейра, Д.С., Араужо, И.Т., Соареш, Л.С., Гусмао, Р.Х., Габбай, Ю.Б. и Linhares, A.C., 2007. Обнаружение неонатального штамма ротавируса человека с генами VP4 и NSP4 свиного происхождения. Journal of Medical Microbiology , 56, 524–532

    PubMed КАС Google ученый

  • McNulty, M.S., 2003. Ротавирусные инфекции, в: Saif Y.M., Barnes HJ, Glisson J.R., Fadly A.M., Макдугалд Л.Р., Суэйн Д.Е., (ред.), Болезни домашней птицы, издательство штата Айова, Эймс, США, 308–317.

    Google ученый

  • McNulty, M.S., Allan, G.M., Thompson, D.J., O’Boyle, J.D., 1978. Антитела к ротавирусу у собак и кошек. Veterinary Record , 102, 534–535

    PubMed КАС Google ученый

  • Мебус, Калифорния, Андердал, Н.Р., Родс, М.B. и Twiehaus, M.J., 1969. Диарея (понос) у телят, воспроизведенная вирусом из полевой вспышки. Бюллетень сельскохозяйственных исследований Университета Небраски , 233, 1–16

    Google ученый

  • Мебус, Калифорния, Коно, М., Андердал, Н.Р. и Твихаус, М.Дж., 1971а. Размножение клеточной культуры вируса диареи новорожденных телят (Scour). Канадский ветеринарный журнал , 12, 69–72

    CAS Google ученый

  • Мебус, К.А., Стейр, Э.Л., Андердал, Н.Р. и Twiehaus, M.J., 1971b. Патология диареи новорожденных телят, индуцированной реоподобным вирусом. Ветеринарная патология , 8, 490–505

    Google ученый

  • Мебус, Калифорния, Вятт, Р.Г. и Капикян А.З., 1977. Поражения кишечника, вызванные у гнотобиотических телят вирусом детского гастроэнтерита человека. Ветеринарная патология , 14, 273–282

    PubMed КАС Статья Google ученый

  • Мендес В.М., Де Бир, М.К., Гузен, Г.Х. и Steele, A.D., 1994. Выделение и предварительная характеристика ротавируса коз. Onderstepoort Journal of Veterinary Research , 61, 291–294

    PubMed КАС Google ученый

  • Mochizuki, M., Nakagomi, T. и Nakagomi, O., 1997. Выделение от диарейных и бессимптомных котят трех штаммов ротавируса, принадлежащих к геногруппе AU-1 ротавирусов человека. Journal of Clinical Microbiology , 35, 1272–1275

    PubMed КАС Google ученый

  • Мори Ю., Sugiyama, M., Takayama, M., Atoji, Y., Masegi, T., Minamoto, N., 2001. Передача птичьего ротавируса от птицы к млекопитающему: анализ его патогенности на гетерологичной мышиной модели. Вирусология , 288, 63–70

    PubMed КАС Google ученый

  • Muller, H. and Johne, R., 2007. Ротавирусы: разнообразие и зоонозный потенциал — краткий обзор. Berlin Munch Tierarztl Wochenschr , 120, 108–112

    Google ученый

  • Муниаппа, Л., Георгиев, Г.К. и Хараламбиев К., 1987. Ротавирусный энтерит буйволов. Ветеринария Науки , 24, 10–14

    Google ученый

  • Муньос М., Ланца И., Альварес М. и Карменес П., 1995a. Распространенность нейтрализующих антител к 9 штаммам ротавируса, представляющим 7 G-серотипов, в сыворотке крови овец. Ветеринарная микробиология , 45, 351–361

    PubMed КАС Google ученый

  • Муньос, М., Альварес М., Ланца И. и Карменес П., 1995b. Вспышка диареи, связанная с атипичными ротавирусами у козлят. Исследования в области ветеринарии , 59, 180–182

    PubMed КАС Google ученый

  • Мураками Т., Хирано Н., Инке А., Титосэ К., Цушия К., Оно К., Найто Ю., Янгихара Т., 1986. Защитные эффекты перорального вводили иммуноглобулины против экспериментальной диареи телят. Японский журнал ветеринарии , 48, 237–245

    PubMed КАС Google ученый

  • Мерфи, Ф.А., Гиббс, Э.П.Дж., Хорзинек, М.С. и Studdert, MJ, 1999. Reoviridae. В: Ф.А. Мерфи, Э.П.Дж. Гиббс, М.К. Horzinek and M.J. Studdert (eds), Veterinary Virology, Academic Press, USA, 391–404

    Google ученый

  • Майерс, Т.Дж. и Schat, K.A., 1990. Активность интраэпителиальных лейкоцитов цыпленка естественными клетками-киллерами против инфицированных ротавирусом клеток-мишеней. Ветеринарная иммунология и иммунопатология , 26, 157–170

    PubMed КАС Google ученый

  • Накагоми О.и Nakagomi, T., 1991. Генетическое разнообразие и сходство ротавирусов млекопитающих в отношении межвидовой передачи ротавируса. Архив вирусологии , 120, 43–55

    PubMed КАС Google ученый

  • Накагоми Т., Мацуда Ю., Ошима А., Мочизуки М. и Накагоми О., 1989. Характеристика штамма ротавируса собак с помощью анализов нейтрализации и молекулярной гибридизации. Архив вирусологии , 106, 145–150

    PubMed КАС Google ученый

  • Накагоми О., Ohshima, A., Aboudy, Y., Shif, I., Mochizuki, M., Nakagomi, T. and Gotlieb-Stematsky, T., 1990. Молекулярная идентификация с помощью РНК-РНК-гибридизации ротавируса человека, который является близкородственным к ротавирусам кошачьего и собачьего происхождения. Journal of Clinical Microbiology , 28, 1198–1203

    PubMed КАС Google ученый

  • Незервуд, Т., Вуд, Дж.Л., Таунсенд, Х.Г., Мамфорд, Дж.А. и Chanter, N., 1996. Диарея жеребят между 1991 и 1994 годами в Соединенном Королевстве, связанная с Clostridium perfringens , ротавирусом, Strongyloides westeri и Cryptosporidium spp. . Эпидемиология инфекций , 117, 375–383

    CAS Google ученый

  • Отто П., Либлер-Тенорио Э.М., Эльшнер М., Ритц Дж., Лорен У. и Диллер Р., 2006 г. Выявление ротавирусов и поражений кишечника у цыплят-бройлеров из стад с насморком и синдром задержки роста (RSS). Болезни птиц , 50, 411–418

    PubMed Google ученый

  • Паломбо, Э.А., 2002. Генетический анализ ротавирусов группы А: доказательства межвидовой передачи генов ротавирусов. Вирусные гены , 24, 11–20

    PubMed КАС Google ученый

  • Пак, С.Х., Саиф, Л.Дж., Чон, К., Лим, Г.К., Пак, С.И., Ким, Х.Х., Пак, С.Дж., Ким, Ю.Дж., Чон, Дж.Х., Канг, М.И. и Чо, К.О., 2006. Молекулярная характеристика новых штаммов ротавируса крупного рогатого скота G5. Journal of Clinical Microbiology , 44, 4101–4112

    PubMed КАС Google ученый

  • Парра, Г.И., Видалес Г., Гомес Х.А., Фернандес Ф.М., Паррено В. и Бок К., 2008 г. Филогенетический анализ ротавируса свиней в Аргентине: увеличение разнообразия штаммов G4 и свидетельства межвидовой передачи. Ветеринарная микробиология , 126, 243–250

    PubMed КАС Google ученый

  • Пол, П.С. и Лиоо Ю.С., 1993. Иммуногены ротавирусов. Ветеринарная микробиология , 37, 299–317

    PubMed КАС Google ученый

  • Пизанелли, Г., Martella, V., Pagnini, U., DeMartino, L., Lorusso, E., Iovane, G. and Buonavoglia, C., 2005. Распространение генотипов G (VP7) и P (VP4) в ротавирусах группы А буйволов изолированы в Южной Италии. Ветеринарная микробиология , 110, 1–6

    PubMed КАС Google ученый

  • Рамани С. и Канг П., 2007 г. Бремя болезней и молекулярная эпидемиология ротавирусных инфекций группы А в Индии. Индийский журнал медицинских исследований , 125, 619–632

    PubMed КАС Google ученый

  • Рэмиг, Р.Ф., 2004. Патогенез кишечной и системной ротавирусной инфекции. Journal of Virology , 78, 10213–10220

    PubMed КАС Google ученый

  • Rao, C.D., Gowda, K. and Reddy, B.S., 2000. Анализ последовательности генов VP4 и VP7 нетипируемых штаммов выявил новую пару белков внешнего капсида, представляющих новые генотипы P и G в бычьих ротавирусах. Вирусология , 276, 104–113

    PubMed КАС Google ученый

  • Рати, Р., Кадиан С.К., Хурана Б., Гровер Ю.П. и Gulati, B.R., 2007. Оценка иммунного ответа на ротавирус крупного рогатого скота после перорального и внутрибрюшинного введения мышам. Индийский журнал экспериментальной биологии , 45, 212–216

    PubMed Google ученый

  • Reading, P.C., Holmskov, U. and Anders, E.M., 1998. Противовирусная активность бычьих коллектинов против ротавирусов. Journal of General Virology , 79, 2255–2263

    PubMed КАС Google ученый

  • Рейди, Н., Леннон Г., Фаннинг С., Пауэр Э. и О’Ши Х., 2006 г. Молекулярная характеристика и анализ штаммов ротавируса крупного рогатого скота, циркулировавших в Ирландии в 2002–2004 гг. Ветеринарная микробиология , 117, 242–247

    PubMed КАС Google ученый

  • Rohwedder, A., Schutz, KI, Minamoto, N. and Brussow, H., 1995. Анализ последовательности ротавируса голубя, индейки и курицы VP8* идентифицирует ротавирус 993/83, выделенный из фекалий телят, как ротавирус голубей. Вирусология , 210, 231–235

    PubMed КАС Google ученый

  • Саиф Л.Дж. и Фернандес Ф.М., 1996. Ветеринарные вакцины против ротавируса группы А. Journal of Infectious Diseases , 174, 98–106

    Google ученый

  • Сато К., Инака Ю., Шинозаки Т. и Матумото М., 1981. Нейтрализующие антитела к бычьему ротавирусу у различных видов животных. Ветеринарная микробиология , 6, 259–261

    Google ученый

  • Schlafer, D.H. and Scott, F.W., 1979. Распространенность нейтрализующих антител к ротавирусу телят у крупного рогатого скота в Нью-Йорке. Cornell Veterinarian , 69, 262–271

    PubMed КАС Google ученый

  • Schroeder, B.A., Street, J.E., Kalmakoff, J. and Bellamy, A.R., 1982. Отношения последовательности между сегментами генома штаммов ротавируса человека и животных. Journal of Virology , 43, 379–385

    PubMed КАС Google ученый

  • Schwers, A., Hoyois, P., Chappuis, G., Dagenais, L. and Pastoret, P.P., 1982. Распространение бычьего ротавируса кошками и собаками. Annals Research in Veterinary Science , 13, 303–308

    CAS Google ученый

  • Селим С.А., Азиз К.М., Саркер А.Дж. и Рахман, Х., 1991. Ротавирусная инфекция телят в Бангладеш. Связь с ветеринарными исследователями , 15, 327–333

    PubMed КАС Google ученый

  • Shawky, S.A., Saif, Y.M. и Swayne, D.E., 1993. Роль циркулирующего материнского антиротавирусного IgG в защите поверхности слизистой оболочки кишечника у индюшат. Болезни птиц , 37, 1041–1050

    PubMed КАС Google ученый

  • Шен С., Burke B. и Desselberger U., 1994. Реаранжировка гена VP6 ротавируса группы А в сочетании с точковой мутацией, влияющей на стабильность тримера. Journal of Virology , 68, 1682–1688

    PubMed КАС Google ученый

  • Снодграсс, Д.Р., Херринг, Дж.А., Кэмпбелл, И., Инглис, Дж.М., Харгривз, Ф.Д., 1984. Сравнение атипичного ротавируса у телят, поросят, ягнят и человека. Journal of General Virology , 65, 909–914

    PubMed Google ученый

  • Снодграсс, Д.Р., Фицджеральд Т., Кэмпбелл И., Скотт Ф.М., Браунинг Г.Ф., Миллер Д.Л., Херринг А.Дж. и Greenberg, H.B., 1990. Ротавирусы серотипов 6 и 10 преобладают у крупного рогатого скота. Journal of Clinical Microbiology , 28, 504–507

    PubMed КАС Google ученый

  • Сонг, Д.С., Канг, Б.К., О, Дж.С., Ха, Г.В., Ян, Дж.С., Мун, Х.Дж., Джанг, Ю.С. и Park, B.K., 2006. Мультиплексная ПЦР с обратной транскрипцией для быстрого дифференциального обнаружения вируса эпидемической диареи свиней, вируса трансмиссивного гастроэнтерита и ротавируса группы А свиней. Журнал ветеринарных диагностических исследований , 18, 278–281

    Google ученый

  • Steele, A.D., Geyer, A. and Gerdes, GH, 2004. Ротавирусные инфекции. В: Coetzer, J.A.W. и Тастин, Р.К. (ред.), Инфекционные болезни домашнего скота, Oxford University Press, Южная Африка, 1256–1264.

    Google ученый

  • Штейер А., Полсак-Приятель М., Барлич-Маганя Д., Jamnikar, U., Mijovski, J.Z., Marin, J., 2007. Молекулярная характеристика нового генотипа ротавируса свиней P, обнаруженного у бессимптомной свиньи в Словении. Вирусология , 359, 275–282

    PubMed КАС Google ученый

  • Sugiyama, M., Goto, K., Uemukai, H., Mori, Y., Ito, N., Minamoto, N., 2004. Прикрепление и инфицирование клеток MA104 птичьими ротавирусами требует присутствия сиаловых кислоты на поверхности клеток. Journal of Veterinary Medical Science , 66, 461–463

    PubMed КАС Google ученый

  • Сунил-Чандра, Н.П. и Mahalingam, S., 1994. Диарея, связанная с ротавирусом, у телят-буйволов в Шри-Ланке. Исследования в области ветеринарии , 56, 393–396

    PubMed КАС Google ученый

  • Svensson, L., 2000. Диагностика пищевых вирусных инфекций у пациентов. International Journal of Food Microbiology , 59, 117–126

    PubMed КАС Google ученый

  • Суэйн П. и Дхама К., 1999. Диарея у телят. Индийское сельское хозяйство , 48, 25–27

    Google ученый

  • Тан, Дж.А. и Schnagl, R., 1981. Инактивация ротавируса дезинфицирующими средствами. Медицинский журнал Австралии , 1, 19–32

    PubMed КАС Google ученый

  • Теодорофф Т.А., Цунэмицу Х., Окамото К., Кацуда К., Комото М., Кавасима К., Накагоми Т. и Накагоми О., 2005 г. Преобладание свиного ротавируса G9 у японских поросят с диареей : близкое родство их генов VP7 с генами недавних штаммов G9 человека. Journal of Clinical Microbiology , 43, 1377–1378

    PubMed КАС Google ученый

  • Терретт Л.А., Саиф Л.Дж., Тейл К.В. и Kohler, E.M., 1987. Физико-химическая характеристика параротавируса свиней и обнаружение вируса и вирусных антител с помощью иммунофлуоресценции клеточной культуры. Journal of Clinical Microbiology , 25, 268–272

    PubMed КАС Google ученый

  • Тейл, К.В., Лэнс, С.Э. и McCloskey, C.M., 1996. Ротавирусы, связанные с диареей новорожденных ягнят в двух операциях по откорму ягнят в Вайоминге. Journal of Veterinary Diagnostic Investigation , 8, 245–248

    PubMed КАС Google ученый

  • Цунэмицу, Х., Имагава Х., Того М., Сёдзи Т., Кавасима К., Хорино Р., Имаи К., Нисимори Т., Такаги М. и Хигучи Т., 2001. Преобладание Ротавирусы группы А лошадей G3B и G14 одного серотипа VP4 в Японии. Архив вирусологии , 146, 1949–1962

    PubMed КАС Google ученый

  • Ципори С., Шервуд Д., Ангус К.В., Кэмпбелл И. и Гордон М., 1981. Диарея у ягнят: экспериментальные инфекции энтеротоксигенной кишечной палочкой, ротавирусом и Cryptosporidium sp. Инфекция и иммунитет , 33, 401–406

    PubMed КАС Google ученый

  • Ципори, С., 1985. Относительная важность кишечных патогенов, поражающих новорожденных домашних животных. Достижения в области ветеринарии и сравнительной медицины , 29, 103–193

    PubMed КАС Google ученый

  • Ван Пинкстерен, Л.А., Брюс, М.Г., Кэмпбелл, И., Вуд, А., Кларк, С.Дж., Беллман, А., Морейн, Б. и Снодграсс, Д.Р., 1999. Влияние оральных ротавирусных/Iscom вакцин на иммунный ответ у гнотобиотических ягнят. Ветеринарная иммунология и иммунопатология , 71, 53–67

    PubMed Google ученый

  • Варгезе В., Гош С., Дас С., Бхаттачарья С.К., Кришнан Т., Кармакар П., Кобаяши Н. и Наик Т.Н., 2006. Характеристика VP1, VP2 и Сегменты гена VP3 ротавируса человека тесно связаны со штаммами свиней. Вирусные гены , 32, 241–247

    PubMed КАС Google ученый

  • Варшней Б., Джаганнатх М.Р., Ветанаягам Р.Р., Кодхандхараман С., Джаганнатх Х.В., Гауда К., Сингх Д.К. и Rao, C.D., 2002. Распространенность и антигенная изменчивость ротавирусов серотипа G10 и обнаружение штаммов серотипа G3 у телят, страдающих диареей: значение для происхождения реассортантных бессимптомных штаммов типа G10P11 или P11 у новорожденных детей в Индии. Архив вирусологии , 147, 143–165

    Google ученый

  • Vende, P., Karoum, R., Manet, G., Rizet, C., Schelcher, F., Cohen, J. and Navetat, H., 1999. Молекулярная эпидемиология или ротавирусы крупного рогатого скота в районе Шароле . Ветеринарные исследования , 30, 451–456

    PubMed КАС Google ученый

  • Вильярреал, Л.Ю.Б., Ульяна, Г., Валенсуэла, К., Chacon, J.L.V., Saidenberg, A.B.S., Sanches, A.A., Brandao, P.E., Jerez, J.A. и Ferreira, A.J.P., 2006. Обнаружение и выделение ротавируса у цыплят с симптомами или без них. Revue Brasilia Ciencia Avicola , 8, 187–191

    Google ученый

  • Вани, С.А., Бхат, М.А., Исхак, С.М., Ашрафи, М.А., Буч, А.С. и Haq, M., 2003. Обнаружение ротавируса группы А, подобного млекопитающим, у кур, страдающих диареей. Ветеринарная микробиология , 94, 13–18

    PubMed КАС Google ученый

  • Вани С.А., Бхат, М.А., Научу, Р., Мунши, З.Х. и Бах, А.С., 2004. Доказательства ротавирусной инфекции, связанной с диареей у новорожденных ягнят в Индии. Здоровье и производство тропических животных , 36, 27–32

    PubMed КАС Google ученый

  • Ватанабэ, Т., Охта, К., Ширахата, Т., Гото, Х., Цунода, Н., Тагами, М. и Акита, Х., 1993. Профилактическое введение колостральных иммуноглобулинов крупного рогатого скота при диарее жеребят с ротавирусом. Journal of Veterinary Medical Science , 55, 1039–1040

    PubMed КАС Google ученый

  • Вигдоровиц, А., Мозговой, М., Сантос, MJD, Паррено, В., Гомес, К., Перес-Фильгейра, Д.М., Троно, К.Г., Риос, Р.Д., Франзоне, П.М., Фернандес, Ф. , Carillo, C., Babiuk, LA, Escribano, JM и Borac, MV, 2004. Защитный лактогенный иммунитет, придаваемый пищевой пептидной вакциной против бычьего ротавируса, продуцируемого в трансгенных растениях. Journal of General Virology , 85, 1825–1832

    PubMed КАС Google ученый

  • Woode, G.N., 1976. Вирусная диарея у телят. Ветеринарный ежегодник , 16, 30–34

    Google ученый

  • Вуд, Г.Н. and Bridger, J.C., 1975. Вирусный энтерит телят. Veterinary Record , 96, 85–88

    PubMed КАС Google ученый

  • Вуд, Г.N. и Crouch, C.F., 1978. Природные и экспериментально индуцированные ротавирусные инфекции домашних и лабораторных животных. Журнал Американской ветеринарной медицинской ассоциации , 173, 522–526

    CAS Google ученый

  • Вуд, Г. Н., Бью, М. Е. и Деннис, М. Дж., 1978. Исследования перекрестной защиты, индуцированной у телят ротавирусами телят, детей и жеребят. Veterinary Record , 103, 32–34

    PubMed КАС Google ученый

  • Ясон, К.В. и Шат К.А., 1985. Выделение и характеристика птичьих ротавирусов. Болезни птиц , 29, 499–508

    PubMed КАС Google ученый

  • Ясон, К.В. и Шат К.А., 1987. Патогенез ротавирусной инфекции в различных возрастных группах кур и индеек: клиника и вирусология. Американский журнал ветеринарных исследований , 48, 977–983

    PubMed КАС Google ученый

  • Йолкен Р.Х., Лосонский Г.А., Вондерфехт С., Лейстер Ф. и Ви С.Б., 1985. Антитела к ротавирусу человека в коровьем молоке. Медицинский журнал Новой Англии, 312, 605–610

    PubMed КАС Google ученый

  • %PDF-1.4 % 516 0 объект > эндообъект внешняя ссылка 516 183 0000000016 00000 н 0000004896 00000 н 0000005017 00000 н 0000005079 00000 н 0000005213 00000 н 0000005248 00000 н 0000005314 00000 н 0000005702 00000 н 0000005833 00000 н 0000006526 00000 н 0000006652 00000 н 0000007314 00000 н 0000007445 00000 н 0000008973 00000 н 0000009426 00000 н 0000009559 00000 н 0000009640 00000 н 0000015370 00000 н 0000015596 00000 н 0000015899 00000 н 0000015981 00000 н 0000050477 00000 н 0000050699 00000 н 0000051499 00000 н 0000051581 00000 н 0000083418 00000 н 0000083646 00000 н 0000084388 00000 н 0000084471 00000 н 0000100279 00000 н 0000100508 00000 н 0000100916 00000 н 0000100974 00000 н 0000101068 00000 н 0000101166 00000 н 0000101205 00000 н 0000101312 00000 н 0000101351 00000 н 0000101486 00000 н 0000101525 00000 н 0000101668 00000 н 0000101789 00000 н 0000101899 00000 н 0000101938 00000 н 0000102050 00000 н 0000102089 00000 н 0000102204 00000 н 0000102243 00000 н 0000102383 00000 н 0000102422 00000 н 0000102501 00000 н 0000102636 00000 н 0000102675 00000 н 0000102773 00000 н 0000102878 00000 н 0000103013 00000 н 0000103052 00000 н 0000103149 00000 н 0000103250 00000 н 0000103392 00000 н 0000103431 00000 н 0000103544 00000 н 0000103712 00000 н 0000103751 00000 н 0000103856 00000 н 0000103949 00000 н 0000103988 00000 н 0000104131 00000 н 0000104170 00000 н 0000104263 00000 н 0000104349 00000 н 0000104449 00000 н 0000104488 00000 н 0000104617 00000 н 0000104656 00000 н 0000104725 00000 н 0000104845 00000 н 0000104884 00000 н 0000104982 00000 н 0000105021 00000 н 0000105058 00000 н 0000105097 00000 н 0000105136 00000 н 0000105175 00000 н 0000105214 00000 н 0000105253 00000 н 0000105292 00000 н 0000105415 00000 н 0000105454 00000 н 0000105493 00000 н 0000105532 00000 н 0000105571 00000 н 0000105610 00000 н 0000105649 00000 н 0000105688 00000 н 0000105727 00000 н 0000105766 00000 н 0000105805 00000 н 0000105844 00000 н 0000105932 00000 н 0000106020 00000 н 0000106059 00000 н 0000106098 00000 н 0000106137 00000 н 0000106176 00000 н 0000106215 00000 н 0000106254 00000 н 0000106293 00000 н 0000106445 00000 н 0000106484 00000 н 0000106625 00000 н 0000106664 00000 н 0000106800 00000 н 0000106947 00000 н 0000106986 00000 н 0000107335 00000 н 0000107374 00000 н 0000107508 00000 н 0000107547 00000 н 0000107586 00000 н 0000107625 00000 н 0000107664 00000 н 0000107703 00000 н 0000107742 00000 н 0000107781 00000 н 0000107820 00000 н 0000107859 00000 н 0000107898 00000 н 0000107937 00000 н 0000107976 00000 н 0000108015 00000 н 0000108122 00000 н 0000108161 00000 н 0000108268 00000 н 0000108307 00000 н 0000108414 00000 н 0000108453 00000 н 0000108492 00000 н 0000108531 00000 н 0000108570 00000 н 0000108609 00000 н 0000108648 00000 н 0000108687 00000 н 0000108726 00000 н 0000108765 00000 н 0000108804 00000 н 0000108843 00000 н 0000108882 00000 н 0000108921 00000 н 0000108960 00000 н 0000108999 00000 н 0000109185 00000 н 0000109479 00000 н 0000109518 00000 н 0000109839 00000 н 0000109878 00000 н 0000110073 00000 н 0000110112 00000 н 0000110399 00000 н 0000110438 00000 н 0000110601 00000 н 0000110640 00000 н 0000110861 00000 н 0000110900 00000 н 0000110939 00000 н 0000110978 00000 н 0000111017 00000 н 0000111056 00000 н 0000111095 00000 н 0000111134 00000 н 0000111173 00000 н 0000111212 00000 н 0000111251 00000 н 0000111290 00000 н 0000111388 00000 н 0000111427 00000 н 0000111466 00000 н 0000111505 00000 н 0000111544 00000 н 0000111583 00000 н 0000111622 00000 н 0000111661 00000 н 0000003956 00000 н трейлер ]/предыдущая 347574>> startxref 0 %%EOF 698 0 объект >поток hвязьTmHq vtĕ]%fua/`凥,$eP51 T *JjjQ”E!Q_H=wR/n={~

    .

    Добавить комментарий

    Ваш адрес email не будет опубликован.