Чем нормализовать микрофлору кишечника: Препараты для восстановления микрофлоры кишечника

Содержание

Микрофлора кишечника: как восстановить баланс?

Важность системы микроорганизмов, населяющих желудочно-кишечный тракт, для здоровья человека сложно переоценить. Однако баланс в количественном и качественном составе микрофлоры является весьма чувствительным и его нарушение чревато развитием дисбактерио­за. Факторов, способствующих этому, довольно много: практически все воспалительные заболевания слизистой оболочки кишечника инфекционной и неинфекционной природы могут вызвать дисбактериоз, состав микрофлоры кишечника может существенно меняться под влиянием новых условий обитания и питания, физических и психических нагрузок. Но особо неблагоприятное воздействие на микрофлору кишечника оказывает длительная и интенсивная антибактериальная терапия. Следует помнить и о возрастном факторе. Давно отмечено, что кишечный дисбактериоз особенно часто возникает в старческом и детском возрастах (Самсыгина Г.А., 2003). Таким образом, в жизни многих из нас так или иначе присутствуют факторы, отрицательно влияющие на состояние микрофлоры кишечника и его здоровье в целом.

Для того чтобы позаботиться о здоровье собственного кишечника и восстановить баланс микрофлоры, актуальным является использование пробиотиков и пребиотиков.

Пробиотики — это живые микроорганизмы и вещества микробного происхождения, оказывающие при естественном способе введения позитивные эффекты на физиологические, биохимические и иммунные реакции организма человека через стабилизацию и оптимизацию функции его нормальной микрофлоры, в свою очередь, пребиотики — это вещества немикробного происхождения, способные оказывать позитивный эффект на организм через селективную стимуляцию роста или усиление метаболической активности нормальной микрофлоры кишечника.

Одним из наиболее перспективных пребиотических веществ является инулин, который избирательно стимулирует рост бифидо- и лактобактерий, подавляет рост условно-патогенных микроорганизмов, а также способствует нормализации моторной функции кишечника. Его комбинация с пробиотическими культурами является весьма перспективной основой для синбиотических средств (Кривущев Б.И., 2010). Поэтому для нормализации микрофлоры кишечника и его эвакуаторной функции актуальным является включение в рацион питания взрослых и детей в возрасте старше 11 лет диетической добавки ЛЕПИКОЛ, в состав которой входит сразу 3 компонента — клетчатка, пребиотик и пробиотические организмы. В 1 дозе (5 г) ЛЕПИКОЛА содержатся пробиотические организмы

Lactobacillus rhamnosus PXN 54, Bifidobacterium bifidum PXN 23, Lactobacillus acidophilus PXN 35, Lactobacillus plantarum PXN 47, Lactobacillus bulgaricus PXN 39 — суммарно 6,0·108 КУО, а также инулин и шелуха семян подорожника.

Благодаря слабительным свойствам компонентов ЛЕПИКОЛА и способности нормализовать эвакуаторную функцию кишечника, данная диетическая добавка подойдет пациентам с запором или тем, кто нуждается в смягчении каловых масс ввиду заболеваний желудочно-кишечного тракта, например, синдрома раздраженной толстой кишки с преобладанием запора, дивертикулита, геморроя и др. Поскольку не за горами долгожданное лето ЛЕПИКОЛ также будет актуальным для тех, у кого отмечают запоры в путешествиях вследствие изменения рациона питания или непривычной обстановки вокруг.

ЛЕПИКОЛ: позаботьтесь о здоровье кишечника!

Спрашивайте ЛЕПИКОЛ у оптовых поставщиков: «БАДМ», «Вента. ЛТД», «Оптима-Фарм», «Фармпланета», «ФРАМ КО». Производитель: «Probiotics International Limited» (Великобритания). Импортер: «Топ-Маркет», тел.: +38 (044) 458-96-54. Дополнительную информацию о продукте ЛЕПИКОЛ можно найти на сайте: 

www.lepicol.com.uarel="nofollow">rel="nofollow">

Пресс-служба «Еженедельника АПТЕКА»

Цікава інформація для Вас:

Восстановление после коронавируса

Многие лекарства, используемые во время лечения коронавиируса крайне токсичны, оказывают губительное воздействие на ЖКТ. Под воздействием воспалительных процессов в течение коронавируса гибнет полезная микрофлора кишечника, ее место занимает условно-патогенная и патогенная, падает защитная функция организма.

Курс содержит самые активные питьевые (безлактозные) пробиотики, которые начинают действовать сразу при попадании в организм. Комплексный курс для полного очищения восстановления организма включает 5 штаммов полезных бактерий.

Штаммы бактерий L.acidophilus, L.rhamnosus, B.bifidum, L.plantarum являются участниками нормального биоценоза микробиоты кишечника, по-просту – местными жителями нашего организма. Они не только борются с патогенными бактериями, синтезируют ферменты, аминокислоты, витамины, но и выполняют важную функцию обучения собственной микробиоты правильному метаболизму и реакции на нарушения в организме.

Пробиотик Нормоспорин (Bacillus subtilis) в составе курса оказывает локальный и системный иммуностимулирующий эффект. Он помогает ослабшему иммунитету восстановиться и способствует регуляции температуры тела.

Курс позволяет:

  • нормализовать функционирование всех систем организма
  • справиться со стрессом (полезные бактерии держат под контролем уровень гормонов кортизола и адреналина)
  • снизить риск развития болезней головного мозга
  • снизить токсичное действие лекарственных препаратов
  • уничтожить патогенные бактерии и грибки
  • восстановить здоровую микрофлору кишечника
  • нормализовать работу желудочно-кишечного тракта
  • ускорить обменные процессы в тканях
  • укрепить иммунитет организма
  • зарядить организм необходимыми витаминами, ферментами и аминокислотами
  • произвести профилактику обострения хронических заболеваний
  • вернуть хорошее самочувствие, силы и бодрость
  • запустить процессы самовосстановления микрофлоры
Состав курса:
Культуральный Биобаланс А - 6 шт
Культуральный Биобаланс Б - 6 шт
Культуральный Биобаланс В - 6 шт
Культуральный Биобаланс Л - 6 шт
Нормоспорин 7% 50 мл - 6 шт

В состав курса входят на 100% натуральные и безопасные биологически активные добавки со специально подобранными полезными бактериями.

Рассчитано на 30 дней. Рекомендуемая продолжительность – 90 дней.
По окончанию первого этапа рекомендуем курс – Восстановление после коронавируса (второй этап)

Рекомендации по приему:
- Принимать утром натощак, желательно за 15-20 минут до еды.
- Нормоспорин в течение 10 дней по 10 мл 1 раз в день, затем еще 20 дней по 5 мл
- Перед употреблением взболтать.
- Биобаланс А, Б, В, Л перед приёмом можно смешать в 1 стакане, отмерив мерным стаканом по 30 мл каждого.
- Между Нормоспорином и Биобалансами сделать паузу в 5-10 минут. Биобалансы питьевые можно смешать в одном стакане.
- Немного подержать во рту, затем проглотить.

Биологически активная добавка. Не является лекарственным средством.

Микрофлора кишечника у людей после 60 лет

Правильное функционирование желудочно-кишечного тракта является залогом крепкого здоровья и хорошего самочувствия. Многие недооценивают важность кишечника, полагая, что его функцией является лишь всасывание питательных веществ и вывод продуктов переработки.

На самом деле, кишечник отвечает за работу иммунной системы, является местом синтеза иммуноглобулинов и белков, усвоения аминокислот, микроэлементов и витаминов..

Микрофлора кишечника у пожилых людей

Все биологические процессы в кишечнике происходят с участием огромного количества микроорганизмов, которые обобщенно называют микрофлорой. В процессе пищеварения и синтеза микроэлементов участвуют более чем 450 видов полезных бактерий (бифидобактерии, лактобактерии и другие). Они составляют большую часть биоценоза кишечника. Оставшуюся часть микрофлоры кишечника составляют условно-патогенные микроорганизмы, они существуют в симбиозе с другими бактериями и поддерживают иммунную систему организма в тонусе. Стафилококки, кишечные палочки, протей и др. становятся опасными для пожилых людей только в том случае, когда иммунитет ослаблен и количество этих бактерий увеличивается. В результате баланс между полезными и вредными бактериями нарушается. Это состояние называют дисбактериоз.

Причины и симптомы дисбактериоза

Нарушение микрофлоры кишечника у пожилых людей происходит по разным причинам, вот некоторые из них:
  • стрессы на протяжении длительных периодов
  • плохая экология (некачественная питьевая вода, загрязненный воздух, опасный радиационный фон)
  • ослабление иммунитета вследствие перенесенных инфекционных или вирусных заболеваний
  • неправильное питание и др.

В большинстве случаев установить однозначную причину изменения микрофлоры кишечника пожилого человека становится затруднительным, поскольку на работу этого органа оказывают воздействие очень много факторов.

Дисбактериоз может стать причиной запора у пожилого человека, так как кишечная микрофлора участвует в моторной функции кишечника, что делает возможным его регулярное очищение.

Устранить запор и восстановить микрофлору кишечника у пожилых людей поможет мягкое слабительное Дюфалак®.

Слабительный эффект достигается путем расщепления лактулозы (действующее вещество препарата Дюфалак®) микрофлорой кишечника, в результате чего происходит стимуляция перистальтики и размягчение каловых масс. Кроме этого, лактулоза как пребиотическое вещество усиливает рост бифидо- и лактобактерий. Таким образом, она помогает восстановить естественный ритм очищения кишечника и нормализовать баланс микрофлоры.

Препарат имеет высокий профиль безопасности, поэтому его назначают как маленьким детям и беременным женщинам, так и пожилым людям с запором.

Левисел кормовая добавка, дрожжевой пробиотик

Фильтр

08.2017 / Шеламов С.Н. / Журнал "Свиноводство"

Высокая продуктивность поголовья - непременное условие конкурентоспособности и рентабельности свиноводства. Эффективность отрасли определяет оптимальный выход продукции в расчете на одну свиноматку. Для того чтобы поддерживать этот показатель на должном уровне, российским предприятиям необходимо не только контролировать технологическую структуру стада, но и Обеспечивать максимальную сохранность маточного поголовья и молодняка. Однако добиться этого зачастую бывает непросто.

Для достижения высоких производственных и экономических показателей прежде всего нужно по- заботиться о поддержании здоровья и оптимального функционирования желудочно-кишечного тракта животных. А это одна из наиболее сложных экосистем организма, где очень тонко сбалансировано взаимодействие между клетками и микробной популяцией. Нарушение функции ЖКТ сопровождается изменениями микрофлоры, от качественного и количественного состава которой зависит ход всех биохимических процессов, скорость прохождение химуса по пищеварительному тракту, эффективность переваривания корма, усвоение питательных веществ и, соответственно, основные производственные показатели.

Роль микробиоценоза кишечника

Микрофлора кишечника выполняет в организме животного разнообразные функции (табл. 1). Она участвует в регуляции темпов роста и развития, усвоении питательных (витаминов, кальция, микроэлементов) и выработке антибиотических веществ (лактолина, лактоцидина, ацидофилина), а также в формировании кислотности среды путем продукции уксусной, муравьиной, янтарной и молочной кислоты. По состоянию микрофлоры кишечника можно судить о резистентности животного к инфекциям, конверсии корма и т.д. Здоровая микрофлора предохраняет организм от действия ксенобиотиков, различных токсинов, перерабатывая их в безопасные вещества.

Таким образом, микрофлора ЖКТ оказывает не только местное, но и системное влияние на многие жизненно важные физиологические процессы (табл. 1). Именно по этой причине в современной науке микробиоценоз кишечника рассматривают как отдельный экстракорпоральный орган.

Значительные качественные и количественные изменения в составе нормальной микрофлоры (дисбактериоз) могут быть вызваны технологическими стрессами, нарушением норм содержания животных, применением несбалансированного, недоброкачественного корма. Дисбактериоз любой этиологии неизбежно сопровождается уменьшением числа полезных бактерий и бурным развитием условно-патогенной и патогенной микрофлоры в кишечнике.

Нормализация микрофлоры кишечника свиноматок

Поскольку организм свиней работает на пределе физиологических возможностей, необходимо неукоснительно соблюдать требования к их содержанию и кормлению. Высокий генетический потенциал продуктивности свиноматок неизбежно влечет за собой большое количество физиологических и технологических проблем. Многоплодие, например, закономерно увеличивает продолжительность опороса. Полученные от современных свиноматок поросята зачастую неоднородны по живой массе. Среди них все больше встречается очень маленьких (весом менее 1 кг), что неизбежно снижает потребление поросятами молозива и ухудшает их иммунную защиту.

Результаты исследований показывают, что из 2,9 дополнительных поросят, полученных благодаря успехам современной селекции, в среднем только 1,12 доживает до отъема (соответственно, теряется 62% генетического прогресса). Увеличение числа поросят в помете оказывает негативное влияние и на свиноматок: во второй половине супоросности, и особенно при переводе в маточник; y них нередко наблюдается замедление прохождения корма по пищеварительному тракту, Это в свою очередь приводит к значительным изменениям в составе микрофлоры пищеварительного тракта и нарушениям процессов ферментации пищевого кома в толстом отделе кишечника. А значит, к уменьшению численности нормофлоры и активному росту условно-патогенных и патогенных бактерий. Усиливается газообразование, что негативно отражается на поведении и здоровье свиноматок: они проявляют беспокойство, агрессивность, отказываются от корма, принимают вынужденные позы, а после опороса часто страдают гипогалактией и ММА.

В условиях современного интенсивного производства невозможно обойтись без применения анти- бактериальных и антипаразитарных средств, вакцинаций и иммунопрофилактики. C другой стороны, при все более жестком контроле качества животноводческой продукции, остатков антибиотиков B мясе и мясных изделиях работать по старинке, используя привычные методы, становится сложно. По этой причине особую актуальность приобретает применение биологических регуляторов обмена веществ. Сегодня основная задача животноводов - оптимизация условий содержания и кормления свиноматок, профилактика технологических стрессов. Для того чтобы максимально раскрыть и использовать генетический потенциал свиноматки, очень важна продолжительность опороса, обеспечение быстрого и полного на- чала лактации, а также стабильности работы пищеварительного тракта.

Живые пробиотики улучшают работу ЖКТ

В наши дни для оптимизации микробиоценоза пищеварительного тракта применяют различные пробиотические препараты. В их составе живые микроорганизмы, которые положительно воздействуют на физиологические, биохимические и иммунные процессы организма. Наиболее «раскрученными» стали продуценты молочной кислоты: лактобактерии (факультативные анаэробы), бифидобактерии (строгие анаэробы), энтерококки. Однако при их использовании ‚в свиноводстве возникают следующие проблемы:

  • микрофлора, входящая в состав таких препаратов, часто с трудом проходит через верхние отделы желудочно-кишечного тракта и не достигает толстого кишечника в количестве, достаточном для терапевтического эффекта;
  • нормофлора плохо приживается в конкурентной среде патогенных микроорганизмов и не способна занять свою экологическую нишу в кишечнике;
  • видовой состав внедряемых микроорганизмов не соответствует многообразию нормофлоры ЖКТ;
  • у продуцентов молочной кислоты отсутствует резистентность к антибиотикам.

В таких случаях на помощь приходят препараты, воздействующие на собственную микрофлору ЖКТ, которые сдвигают баланс в сторону позитивной флоры и нормализуют процессы пищеварения. Одно из таких эффективных средств - дрожжевой пробиотик «Левисел SB» производства компании «Лаллеманд». Дрожжи Saccharomyces cerevisiae boulardii, входящие в его состав, не относятся к нормальной микро- флоре, но проявляют выраженную антагонистическую активность в отношении широкого спектра как условно-патогенных, так и патогенных микробов. В отличие от бактериальных пробиотиков этот штамм дрожжей сохраняет жизнеспособность при транзите на всем протяжении ЖКТ, устойчив к агрессивной среде желудка и солям желчных кислот, воздействию антибиотиков и чувствителен только к противогрибковым препаратам. S.cerevisiae boulardii исчезают из пищеварительного тракта постепенно, в течение четырех-пяти дней после прекращения их применения. Механизм действия этих дрожжей хорошо изучен и описан в более чем 150 научных публикациях.

В свиноводстве «Левисел SB» изначально использовался для предотвращения диарей подсосных поросят, особенно в случаях подозрений на клостридиозы. Однако надо иметь в виду, что, скорее всего, причина таких диарей - патология свиноматки, так как при появлении на свет поросята полностью стерильны и их пищеварительный тракт заселяется из окружающей среды (микрофлора сосков матери, фекалии и т.д.).

Комплексный механизм действия «Левисела SB» обеспечивают пере- численные ниже способности входящих в его состав дрожжей.

Прямой антагонизм. S.cerevisiae boulardii угнетают рост клостридий, Escherichia coli, Salmonella typhi, вывела dysenteriae, Vibrio cholerae, Salmonella enteritidls защищают организм от различных кишечных патогенов и бактерий семейства Enterobacteriaceae.

Антитоксичный эффект. S. cerevisiae boulardii продуцируют протеолитический фермент, препятствующий связыванию клостридиальных токсинов с рецепторами кишечных клеток. Также они значительно снижают секрецию токсинов патогенными штаммами C.difficile.

Трофическое влияние. «Левисел SB» стимулирует ферментную активность энтероцитов и развитие ворсинок. Дрожжи выделяют биологически активные вещества, способствующие восстановлению стенки энтероцитов и укреплению слизистой оболочки кишечника.

S. cerevisiae boulardii препятствуют развитию патогенных микроорганизмов и захватывают рецепторы, предотвращая адгезию бактерий к слизистой оболочке, активизируют иммунную систему, синтезируют витамины и переводят микроэлементы в более доступные протеиназные формы, улучшая снабжение организма микронутриентами.

«Левисел SВ» можно применять совместно с традиционными антибиотиками, так как он действует с ними синергически, значительно повышая терапевтический эффект. Препарат нормализует работу пищеварительного тракта свиней, профилактирует запоры и улучшает поедаемость корма. У свиноматок, получающих «Левисел SВ», опорос протекает быстрее, а поросята обладают высокой жизнеспособностью.

Дрожжи стимулируют потребление корма лактирующими свиноматками, улучшая молочную продуктивность. S cerevisiae boulardii санируют их желудочно-кишечный тракт, препятствуя заражению молодняка патогенными бактериями в первые часы жизни. Поросята получают пробиотик, поедая фекалии свиноматки, через ЖКТ которой препарат проходит в неизменном вице. В результате значительно снижается частота и тяжесть случаев диареи, повышается сохранность и вес гнезда при отъеме.

Введение «Левисела SB» свиноматкам в корм для нормализации микрофлоры кишечника нашло широкое применение на фермах ведущих свиноводческих стран Европы. Основываясь на обширном опыте использования препарата в хозяйствах и его многочисленных испытаниях, можно утверждать, что «Левисел SВ» эффективен в 90% случаев.

Успех обеспечивает введение препарата в корм как в период лактации, так и в период супоросности с дополнительным индивидуальным скармливанием в маточниках перед опоросом. «Левисел SB» устраняет колики и дискомфорт, связанные с повышенным количеством газов и бактериальных токсинов, образующихся при нарушениях ферментации в кишечнике супоросных свиноматок. Их состояние значительно улучшается, что отражается на поведении и аппетите. Животные становятся менее агрессивными и быстрее восстанавливаются после опороса, время которого сокращается. Сам опорос протекает легче, уменьшается число свиноматок, требующих при этом особого внимания. Животные меньше устают, снижается количество мертворожденных поросят, повышается их жизнеспособность и, соответственно, потребление молозива, что приводит к лучшей сохранности как на третий день жизни, так и к отъему. Поросята рождаются однородными и c обладают высокой энергией роста.

Кроме того, устраняя запоры, «Левисел SB» повышает потребление и улучшает усвоение корма свиноматкой в период лактации. Больший приток питательных веществ увеличивает молочную продуктивность, гарантируя оптимальные среднесуточные привесы поросят. Обеспечивая свиноматкам равномерное потребление корма в течение всей лактации, «Левисел SB» позволяет добиться их лучшей кондиции при отъеме и высоких показателей воспроизводства.

Препарат создан с учетом требований современного отечественного I комбикормового производства. Его микрокапсулированные дрожжевые клетки обладают хорошей стабильностью при хранении и устойчивы к высокотемпературным процессам приготовления кормов, включая гранулирование и экструдирование.

Масштабный производственный опыт по применению «Левисела SB+» проведен на свинокомплексе 000 «РАМФУД-Поволжье». Основной целью исследования стала оценка воздействия дрожжевого пробиотика на производственные показатели подсосных поросят, а также статус здоровья поголовья и его сохранность. r Для опыта отобрали 1120 супоросных свиноматок, скомплектовав из них контрольную и опытную группу по 560 голов в каждой.

Опытная группа получала основ ной рацион (СК-2) с добавлением с пробиотика «Левисел SB+», который вводили на комбикормовом заводе в дозировке 1 кг/т корма. Чтобы усилить положительный эффект от применения препарата в самый сложный период производственного цикла свиноматки, которым, без сомнения, является опорос и подсосный период, животные получали по 10 г «Левисела SB+» дополнительно на голову в сутки. Индивидуальное скармливание пробиотика начиналось за три дня до опороса и продолжалось до третьего дня после опороса. Результаты проведенных исследований представлены в таблице 2.

За период испытаний сохранность поросят в опытной группе составила 90%, что на 1,3% выше, чем в контрольной. Количество случаев диареи снизилось на 43,4%, соответственно, сократились и затраты на медикаментозное лечение. В итоге применение пробиотика «Левисел SB+» позволило получить среднесуточный прирост 236 г, что на 1,9% выше контрольного показателя.

Результаты эксперимента позволяют считать «Левисел SB+» природным стимулятором роста. Мобилизуя защитные силы организма, он способствует максимальной реализации потенциала продуктивности свиней.

Скачать
ЛЕВИСЕЛ SB ПЛЮС

Можно ли изменить кишечные бактерии?

Николь Берк и Райан Миллер, владельцы, Golden Well Apiaries, New Haven, VT.

Марк Суэйн, доктор медицины, гастроэнтеролог, Канадский университет Калгари, и.о. директора Группы исследований иммунитета и желудочно-кишечного тракта.

Пурна К. Кашьяп, доктор медицины, гастроэнтеролог и исследователь, Центр индивидуальной медицины клиники Мэйо.

Джек Гилберт, доктор медицины, профессор, Центр микробиома, Чикагский университет.

Мэри Эллен Сандерс, доктор философии, президент-основатель Международной научной ассоциации пробиотиков и пребиотиков.

Мари-Клер Арриета, доктор философии, доцент Университета Калгари; соавтор книги Let Them Eat Dirt .

Линдси Мейер, специалист по СМИ, FDA.

Патрисия Л. Хибберд, доктор медицинских наук, председатель и профессор кафедры глобального здравоохранения Школы общественного здравоохранения Бостонского университета.

Майкл Дж. Нойвирт, старший директор по связям с общественностью, Danone и White Wave.

Национальный центр дополнительного и комплексного здоровья NIH: «Пробиотики в глубине».

Businesswire: «Глобальный рынок пробиотиков будет расти со среднегодовым темпом роста 7,0% в течение 2016–2022 годов: рост использования пробиотических продуктов в пищевой промышленности и производстве напитков - исследования и рынки».

FDA: «FDA разрабатывает улучшенную методологию определения чистоты пробиотических продуктов.”

CDC:« Сальмонелла ».

Клиническое руководство по пробиотическим продуктам в США, издание 2017 г.

Клиническое руководство по пробиотическим продуктам в Канаде, издание 2017 г.

Альянс по обучению пробиотикам.

Всемирная гастроэнтерологическая организация: «Глобальное руководство по пробиотикам и пребиотикам».

Пусть едят грязь .

Activia: «20 лет исследований здоровья пищеварительной системы.»

YouTube:« Проект «Микробиом»: пробиотики ».

Терапевтическая продвинутая гастроэнтерология : «Пробиотики в профилактике антибиотико-ассоциированной диареи и инфекции Clostridium difficile».

TCTMD: «Диета, упражнения и кишечные бактерии играют разные, перекрывающиеся роли в развитии кардиометаболических заболеваний».

Frontiers Public Health : «Рециркуляция Мечникова: пробиотики, кишечный микробиом и поиски долгой жизни.”

Патогены и болезни: « Пробиотик Escherichia coli штамм Nissle 1917 препятствует инвазии кишечных эпителиальных клеток человека различными энтероинвазивными бактериальными патогенами ».

Журналы BMJ: «Поддержание ремиссии язвенного колита с помощью пробиотика Escherichia coli Nissle 1917 так же эффективно, как и стандартного месалазина».

PLOS One : «Пробиотик Escherichia coli Nissle 1917 подавляет протекающий кишечник за счет улучшения целостности слизистой оболочки», « E.coli Nissle 1917 влияет на адгезию Salmonella к эпителиальным клеткам кишечника свиней ».

Пищевая фармакология и терапия: «Ингибирующее действие пробиотического штамма Escherichia coli Nissle 1917 на адгезию и инвазию кишечных эпителиальных клеток адгезивно-инвазивными штаммами E. coli, выделенными от пациентов с болезнью Крона».

Воспалительные заболевания кишечника: «Клиническое использование кишечной палочки Nissle 1917 при воспалительных заболеваниях кишечника.»

Инфекционные заболевания: « Нормативный надзор и безопасность использования пробиотиков ».

Границы | Микробиота куриного кишечника: важность и технология обнаружения

Введение

Целостность желудочно-кишечного тракта (ЖКТ) и кишечного микробного сообщества играет жизненно важную роль в усвоении пищи, развитии иммунитета и устойчивости к болезням. Изменения в микробном сообществе ЖКТ могут отрицательно сказаться на эффективности корма, продуктивности и здоровье цыплят (1–3).Понимание роли микробиоты GI курицы и понимание текущих методов, используемых в исследованиях микробиома, имеет важное значение для улучшения микробиома GI птицы. Исторически сложилось так, что методы селективного культивирования использовались для выявления и характеристики микробного разнообразия кишечника птиц. В последнее десятилетие использование бактериального секвенирования гена 16S рибосомальной РНК (рРНК) значительно улучшило наши представления о составе и разнообразии микробиоты желудочно-кишечного тракта цыплят. Современные подходы к высокопроизводительному секвенированию позволяют быстро получить полную перепись бактериального сообщества и являются мощным инструментом, который позволил по-новому взглянуть на биологическую и экологическую роль микробиоты GI.Этот обзор направлен на обобщение функции кишечника птиц, а также факторов, влияющих на разнообразие микробиоты желудочно-кишечного тракта цыплят. Кроме того, мы также сравнили и проанализировали прошлые и текущие подходы, используемые в микробиологических исследованиях куриного кишечника.

Роль микробиоты желудочно-кишечного тракта цыплят

Желудочно-кишечные отделы кур плотно заселены сложными микробными сообществами (бактерии, грибы, археи, простейшие и вирусы), в которых преобладают бактерии (4).Взаимодействия между хозяином и бактериальным микробиомом ЖКТ курицы были тщательно изучены и проанализированы многими исследовательскими группами (5–9), и теперь считается, что они играют важную роль в питании, физиологии и развитии кишечника птиц (10, 11).

Микробиота кишечника может образовывать защитный барьер, прикрепляясь к эпителиальным стенкам энтероцита и, таким образом, уменьшая возможность колонизации патогенных бактерий (12). Эти бактерии производят витамины (например, витамин K и группы витаминов B), короткоцепочечные жирные кислоты (уксусная кислота, масляная кислота и пропионовая кислота), органические кислоты (например,g., молочная кислота) и антимикробные соединения (например, бактериоцины), низшие триглицериды и вызывают непатогенные иммунные ответы, которые обеспечивают как питание, так и защиту животного (2, 12–14). С другой стороны, микробиом желудочно-кишечного тракта также может быть источником бактериальных патогенов, таких как Salmonella и Campylobacter , которые могут распространяться среди людей или выступать в качестве пула устойчивости к антибиотикам и передачи и, следовательно, могут представлять серьезную угрозу для здоровья населения. (5, 8, 15).

Нормальное кишечное микробное сообщество имеет преимущества и недостатки для хозяина (1, 13). Основными преимуществами комменсальной микробиоты являются конкурентное исключение патогенов или неместных микробов (13), иммуностимуляция и программирование, а также вклад в питание хозяина. В более ранних отчетах было установлено, что животные, выращиваемые традиционным способом, гораздо менее восприимчивы к патогенам по сравнению с животными без микробов (16). Кроме того, комменсальная микробиота может стимулировать развитие иммунной системы, включая слизистый слой, эпителиальный монослой, иммунные клетки кишечника (например,g., цитотоксические и хелперные Т-клетки, иммуноглобулин-продуцирующие клетки и фагоцитарные клетки) и собственную пластинку (13, 17, 18). Эти ткани создают барьеры между хозяином и микробами и борются с нежелательными кишечными микроорганизмами. В дистальных отделах кишечника (т. Е. Слепых и толстых кишках) микробиота также производит энергию и питательные вещества, такие как витамины, аминокислоты и короткоцепочечные жирные кислоты (SCFA) из непереваренного корма, которые в конечном итоге становятся доступными для хозяина (1, 13 ). Эти SCFA обладают бактериостатическими свойствами, которые способны устранять патогены пищевого происхождения, такие как Salmonella spp.(19). SCFA также являются источником энергии для животных и могут дополнительно стимулировать пролиферацию эпителиальных клеток кишечника, тем самым увеличивая поверхность всасывания в желудочно-кишечном тракте (13). Также было установлено, что продукция SCFA снижает pH толстой кишки, что ингибирует превращение желчи во вторичные продукты желчи (20). Кроме того, микробиота кишечника также способствует метаболизму азотистых соединений хозяина. Например, бактерии слепой кишки могут преобразовывать мочевую кислоту в аммиак, который впоследствии поглощается птицей и в дальнейшем используется для производства аминокислот, таких как глутамин (21).Кроме того, часть азота из рациона включается в бактериальный клеточный белок, и, следовательно, сами бактерии могут быть источником белков / аминокислот (22).

Напротив, комменсальная микробиота также требует затрат для хозяина. В проксимальном отделе кишечника (желудок и тонкий кишечник) микробы конкурируют с хозяином за энергию и белок. Как в проксимальном, так и в дистальном отделах кишечника микробы продуцируют токсичные метаболиты (например, катаболиты аминокислот) и катаболизируют желчные кислоты, что может подавлять рост и снижать усвояемость жира птиц соответственно (1).В присутствии микробиоты слизистый слой кишечника увеличивает секрецию муцина и скорость оборота эпителиальных клеток, тем самым поддерживая смазку желудочно-кишечного тракта, предотвращая проникновение микроорганизмов в кишечные эпителиальные клетки хозяина. Кишечная иммунная система также более развита и секретирует IgA, который специфически связывается с бактериальными эпитопами, что помогает регулировать состав бактерий в кишечнике (23, 24). Хотя эти процессы в целом полезны, они все же увеличивают потребность хозяина в энергии и белке и, следовательно, влияют на показатели роста птиц.

Нарушение баланса кишечной микробиоты часто называют дисбактериозом. Дисбиоз можно определить как качественный и / или количественный дисбаланс нормальной микробиоты в тонком кишечнике, который может привести к последовательной реакции в ЖКТ, включая снижение барьерной функции кишечника (например, истончение стенки кишечника) и плохую усвояемость питательных веществ, и, следовательно, , увеличивая риск бактериальной транслокации и воспалительных реакций (25). Как неинфекционные, так и инфекционные стрессоры могут привести к дисбактериозу.К неинфекционным факторам относятся стрессоры окружающей среды, дисбаланс питания, диетические изменения, микотоксины, плохое управление, ферментативная дисфункция или генетика хозяина (25). Инфекционные факторы включают вирусную или бактериальную инфекцию, кокцидиоз или токсические метаболиты, продуцируемые вредными микроорганизмами, такими как Clostridium perfringens .

Микробиота желудочно-кишечного тракта может быть далее классифицирована как микробиота просвета и микробиота слизистой оболочки (2). Состав микробиоты просвета определяется доступными питательными веществами, наличием антимикробного вещества и скоростью прохождения корма.На состав прикрепленной к слизистой оболочке микробиоты влияют несколько факторов хозяина, такие как экспрессия специфических участков адгезии на мембране энтероцитов, секреция секреторных иммуноглобулинов и скорость продуцирования слизи. Микробиота просвета и микробиота слизистой оболочки, конечно, также влияют друг на друга (2), и поэтому важно понимать, что диета может изменять как микробиоту просвета, так и прикрепленную к слизистой оболочке, чтобы влиять на здоровье кишечника. Насколько нам известно, на сегодняшний день нет исследований, сравнивающих таксономический состав или метаболические функции этих двух местообитаний микробов.Однако было бы интересно изучить и проанализировать различия между бактериальными сообществами слизистой оболочки и просвета на разных участках ЖКТ. Кроме того, изучение бактериального сообщества, связанного со слизистой, будет важным для понимания реакции слизистой оболочки хозяина, поскольку любые изменения иммунитета слизистой оболочки могут иметь серьезные последствия для здоровья птицы (26).

Разнообразие микробиоты куриного кишечника

В желудочно-кишечном тракте курицы обитает разнообразное бактериальное сообщество, в котором каждая бактерия адаптирована к своей экологической нише и синергетически живет с другими видами бактерий в том же сообществе.Было показано, что состав и функции этих сообществ варьируются в зависимости от возраста птиц, местоположения в желудочно-кишечном тракте и компонентов рациона (6, 18, 27–29).

Возраст птицы

Возраст птиц - один из наиболее важных факторов, влияющих на бактериальный состав ЖКТ, плотность клеток и метаболическую функцию. Значительные изменения в таксономическом составе микробиоты кишечника были изучены с использованием методов отпечатков пальцев ДНК (30) и высокопроизводительного секвенирования (31) и хорошо изучены многими исследовательскими группами (28, 32–34).Ballou et al. (35) и наши недавно опубликованные данные (5) показывают, что у цыплят-бройлеров после вылупления через 1 день уже есть микробное сообщество в их ЖКТ. Также происходят сукцессионные изменения в составе микробиома ЖКТ, связанные с заменой и установлением более стабильных бактериальных таксонов по мере того, как птица становится старше (30, 36). Лу и др. (30) обнаружили, что в ЖКТ цыплят в возрасте 3 дней содержалось L. delbrueckii, C. perfringens и Campylobacter coli , тогда как в возрасте от 7 до 21 дня - L.acidophilus, Enterococcus и Streptococcus были более распространены. В возрасте 28 и 49 дней в желудочно-кишечном тракте содержится L. crispatus , но состав значительно отличается от других возрастов (30). В другой работе сукцессионные изменения микробного сообщества кишечника, измеренные с помощью технологии HT-NGS, показали, что относительная численность Clostridium была выше с возрастом птицы, тогда как количество лактобацилл было низким на протяжении всего цикла роста. Эта вариабельность результатов может быть связана с типами образцов (фекалии vs.слепая кишка) и / или обычные микробиологические и молекулярные методы, которые имеют ограниченный охват и точность по сравнению с высокопроизводительными платформами NGS, которые предлагают более широкий охват и глубину определения микробного сообщества. Технологии высокопроизводительного секвенирования, такие как целевое секвенирование ампликонов и метагеномное секвенирование методом дробовика, стали более распространенными для анализа микробного состава и функций кишечника на протяжении всей жизни бройлеров, но мы все еще находимся на начальной стадии анализа, и есть нарушение в знание морфологического развития хозяина и функциональных свойств кишечного микробиома по мере старения птицы.

Желудочно-кишечный тракт

Желудочно-кишечный тракт цыпленка включает зерно, преджелудок, мускульный желудок, двенадцатиперстную кишку, тощую кишку, подвздошную кишку, слепую кишку, толстую кишку и клоаку (32). Каждый отдел желудочно-кишечного тракта выполняет различные метаболические функции, которые формируют микробное сообщество (таблица 1), поэтому важно учитывать место отбора проб и дизайн исследования. Куриный урожай содержит от 10 8 до 10 9 КОЕ / г бактерий, среди которых обычно преобладают лактобациллы (28, 37).Однако большие различия в микробном составе у отдельных бройлеров, получавших одинаковый рацион, наблюдались Choi et al. (44) из-за разницы во времени между кормлением и взятием проб. В желудке концентрация бактерий такая же, как и в зерновых культурах, но активность бактериального брожения низкая, главным образом из-за низкого pH. Большинство бактерий в желудке - это лактобациллы, энтерококки, лактозонегативные энтеробактерии и колиформные бактерии (28). Среди сегментов тонкого кишечника плотность бактерий самая низкая в двенадцатиперстной кишке из-за короткого времени прохождения и разбавления пищеварительного тракта секретируемой желчью (45).Бактериальное сообщество двенадцатиперстной кишки в основном состоит из клостридий, стрептококков, энтеробактерий и лактобацилл (46). Микробиота подвздошной кишки наиболее изучена среди сегментов тонкой кишки. Лу и др. (30) оценили бактериальное сообщество подвздошной кишки путем изучения последовательностей гена 16S рРНК и обнаружили Lactobacillus в качестве основной группы (70%), за которой следуют члены семейства Clostridiaceae (11%), Streptococcus (6,5%) и . Enterococcus (6,5%) (30). В подтверждение, наша недавняя статья также показала, что лактобациллы являются преобладающим родом в подвздошной кишке (5).По сравнению с подвздошной кишкой слепая кишка содержит более разнообразное, богатое и стабильное микробное сообщество, включая анаэробы (47, 48). Oakley et al. (18) задокументировали значительные изменения в микробных сообществах слепой кишки от дня вылупления до 6-недельного возраста у коммерческих бройлеров (18, 27), а также значительные различия в образцах слепой кишки и фекалиях от одного человека (27). Обычно богатство и разнообразие слепой кишки увеличиваются в течение этих 6 недель, и таксономический состав сообщества быстро меняется с Proteobacteria, Bacteroides и Firmicutes на почти полностью Firmicutes к 3-недельному возрасту (18, 27).Однако Kumar et al. (5) обнаружили, что Firmicutes были наиболее распространенным филумом как в слепой кишке, так и в подвздошной кишке во всех возрастах (день от 0 до дня 42), за исключением d 42 в слепой кишке, где было много Bacteroidetes. Различия в бактериальном составе можно ожидать из-за различий в протоколе экстракции нуклеиновых кислот, праймерах, подходе к секвенированию, факторах окружающей среды, диетическом лечении / составе, породе и географических условиях. Помимо типов выборок, для правильного дизайна исследования также необходим адекватный размер выборки.Более высокие индивидуальные различия в типах образцов (образцы культур) приводят к большему размеру образца по сравнению с образцами слепой кишки для выявления потенциальных различий (49).

Таблица 1 . Пространственное распределение наиболее распространенных и многочисленных таксонов бактерий (тип, отряд (o), семейство (f), род) в желудочно-кишечном тракте цыплят независимо от возраста, диеты и различий в методике.

Также известно, что подходы к переработке кормов, компоненты кормов и добавки влияют на микробное сообщество кишечника.Knarreborg et al. (50) заявили, что сусло снижает количество Enterococcus spp. и колиформ, но увеличивается Lactobacillus spp. и C. perfringens в подвздошной кишке бройлеров по сравнению с гранулированным кормом (50). Кукуруза способствует низкому проценту G + C-клостридий, энтерококков и лактобацилл, тогда как пшеница поддерживает более высокий процент G + C-бифидобактерий (29). Kumar et al. (5) сообщили о низкой численности у Firmicutes и высокой численности у Bacteroidetes с 0 по 42 день, когда птицы были переведены с стартового рациона на откормочный, и утверждали, что представители типа Bacteroidetes жизненно важны для ферментации крахмала до простых сахаров.Кроме того, добавки к корму, такие как ферментируемые сахара (пребиотики), также могут влиять на состав и разнообразие микробиоты кишечника цыпленка.

Пребиотики

Было показано, что использование пребиотиков в качестве модуляторов питания оказывает положительное влияние на некоторые таксоны бактерий в толстой кишке (51). Например, фруктоолигосахариды (FOS) и галактоолигосахариды (GOS) увеличили популяцию Bifidobacterium и Lactobacillus (52, 53). Исследования in vitro показали, что фекальные суспензии, инкубированные с олигофруктозой и инулином, вызвали увеличение популяций бифидобактерий в толстой кишке человека, тогда как потенциальных патогенов, таких как Escherichia coli и Clostridium spp. поддерживались на более низких уровнях (54). Большинство штаммов бифидобактерий (например, B. fiagilk, B. thetaiotaomicron , B . Vulgatus, B. dktasonk и B. ovatus ), за исключением B.bifidum , может использовать ФОС в качестве стимулятора роста и ферментации (55). Эти бактерии секретируют фермент ß-фруктозидазу, который может легко расщеплять и ферментировать ФОС. Однако такие микроорганизмы, как E. coli и C. perfringens , не могут использовать ФОС в качестве источника ферментативных углеводов. Крысы, получавшие диетический FOS, показали временное увеличение количества бактерий, продуцирующих молочную кислоту, и долгосрочное повышение уровня масляной кислоты слепой кишки (56). Диетическое включение ФОС уменьшилось на C.perfringens и E. coli и увеличили разнообразие Lactobacillus в ЖКТ бройлеров (57). Паттерсон и др. (58) оценили влияние олигосахаридов термического кетоза на микробные популяции слепой кишки цыплят-бройлеров. Результаты показали, что концентрации бифидобактерий слепой кишки и лактобактерий увеличивались в 24 и 7 раз, соответственно, в рационе с добавлением кетоза по сравнению с контролем. Предполагается, что другой тип пребиотиков, манноолигосахариды (МОС), имеет другие механизмы действия (58).Они могут (1) связываться с потенциальными патогенными грамотрицательными бактериями (например, E. coli и Salmonella ), которые обладают фимбриями 1 типа (лектин, чувствительный к маннозе), для предотвращения прикрепления патогенов к кишечнику и их дислокации. wall, (2) обладают иммуномодулирующим действием, основанным на свойствах антигенности компонентов маннана и глюкана, (3) модулируют морфологию кишечника и (4) усиливают экспрессию муцина и снижают скорость оборота энтероцитов (59). Воздействие пребиотиков на нижний отдел желудочно-кишечного тракта включает: (1) использование в качестве пищи и источников ферментации для микробиоты слепой и толстой кишки, (2) производство конечных продуктов ферментации (например,g., SCFAs), (3) стимуляция сахаролитической ферментации, (4) закисление содержимого толстой кишки, (5) гиперплазия слепой кишки и эпителия толстой кишки, (6) стимуляция секреции гормональных пептидов толстой кишки и (7) ускорение цеко-анального транзита (51).

Помимо возраста, расположения ЖКТ и пребиотиков, порода и пол птицы также могут иметь большое влияние на кишечную микробиоту (34). Кроме того, хорошо задокументировано, что факторы окружающей среды (уровень биобезопасности, условия содержания, подстилка, доступ к корму и климат) также могут существенно влиять на бактериальный состав кишечника.Следовательно, интерпретация данных и результаты исследования во многом зависят от дизайна исследования. Передовые методы отчетности об исследованиях включают в себя предоставление подробной информации о факторах хозяина и окружающей среды, которые могут позволить исследователям проводить метаанализ для лучшего понимания факторов питания, микробиома и окружающей среды, которые можно модулировать для улучшения продуктивности и здоровья птицы.

Открытие микробиоты куриного кишечника молекулярными методами

Классические методы на основе культивирования исторически широко использовались для изучения микробиоты кишечника цыплят.Однако эти методы очень селективны по отношению к культивируемым бактериям в определенных условиях (60). Большинство бактерий остаются некультивированными (29). Более 30 лет назад термин «большая аномалия подсчета чашек» был придуман для отражения лабораторных расчетов, согласно которым можно культивировать очень небольшое количество (0,1–1%) микробных таксонов, присутствующих в данном образце (61). Аналогичным образом, более 10 лет назад было замечено, что из 52 микробных типов, признанных в то время, только половина из них имела хотя бы одного культивируемого представителя, что подтверждает описание «некультивируемого большинства» (62).Поэтому богатство (количество видов) и разнообразие (количество видов, взвешенное по их относительной численности) кишечных бактерий были недооценены, а наши знания о микробиоте кишечника остаются неполными (63).

Развитие молекулярной биотехнологии предложило новые инструменты для изучения состава, разнообразия, прогнозируемой функции и взаимодействия кишечной микробиоты в различных отделах желудочно-кишечного тракта. В настоящее время доступно множество молекулярных методов, каждый из которых имеет свои сильные и слабые стороны.Емкость образцов, применение и ограничения некоторых из наиболее распространенных молекулярных методов, которые можно использовать для изучения микробной экологии ЖКТ цыплят, перечислены в таблице 2. Среди этих методов высокопроизводительное секвенирование ампликонов гена 16S рРНК быстро стало методом выбор. Хотя этот метод широко использовался в других областях исследований, первый отчет с использованием высокопроизводительного секвенирования генов 16S рРНК для изучения популяции микробных сообществ и их взаимодействия в кишечнике цыплят был опубликован в 2013 году (64).

Таблица 2 . Молекулярные подходы на основе 16S рРНК для изучения микробной экологии в кишечнике цыплят (64–67).

Молекула 16S рРНК представляет собой небольшую субъединицу рибосомы, которая обладает областями сходства последовательностей, которые являются высококонсервативными для всех бактерий. Для амплификации этих генов микробная ДНК извлекается из образцов фекалий или перевариваемых веществ, а праймеры широкого диапазона, нацеленные на консервативные области гена 16S рРНК, используются для амплификации полимеразной цепной реакции (ПЦР) (29).Секвенирование этих амплифицированных продуктов (ампликонов) позволяет различать бактерии, как правило, на уровне рода или вида (68, 65), а относительная численность каждой последовательности отражает относительную численность этой бактерии в исходном образце. Таким образом, секвенирование генов 16S рРНК обеспечивает истинную перепись бактериального сообщества путем определения типов бактерий, присутствующих в образце, и их относительной численности. Из-за большого богатства и разнообразия кишечных бактериальных сообществ только за последние несколько лет технология секвенирования ДНК достигла такой степени, что теперь мы можем полностью провести перепись этих сложных сообществ.Начиная с 2008 года технический прогресс в секвенировании позволил собрать на несколько порядков больше последовательностей, чем было возможно ранее - в одном исследовании авторы поместили столько последовательностей 16S рРНК в базу данных GenBank, сколько исторически было сгенерировано до этого момента ( 69). Благодаря этим глубоким методическим достижениям и огромным новым наборам данных теперь можно легко и точно провести перепись образца кишечника, чтобы определить, например, как микробиом реагирует на различные кормовые добавки, условия содержания или болезненные состояния (Рисунок 1). .

Рисунок 1 . Стандартная процедура от сбора образцов до анализа секвенирования в кишечнике птицы.

Высокопроизводительное секвенирование или секвенирование следующего поколения (NGS) - мощный инструмент для исследования биологической и экологической роли кишечной микробиоты (64). NGS стал удобным, быстрым, точным и недорогим методом геномных исследований (70, 66). Современные платформы NGS предлагают высокую пропускную способность, быстрое время выполнения работ и низкие затраты. Среди этих платформ инструменты Illumina HiSeq и MiSeq - две из наиболее часто используемых систем в недавних исследованиях микробиома куриного кишечника и метагеномных исследованиях.Несмотря на множество преимуществ, эти платформы страдают от ограничений, включая сборку для короткого чтения и высокую стоимость (71). Платформы секвенирования третьего поколения, такие как секвенирование одиночных молекул в реальном времени (SMRT) и нанопор, требуют меньше времени на подготовку ДНК (без ПЦР) и являются экономически эффективными (71). Поскольку эти платформы продолжают развиваться, их внедрение, несомненно, приведет к новому пониманию микробиома GI птицы.

После секвенирования для биоинформатического анализа данных последовательности требуются платформы с открытым исходным кодом, такие как QIIME или mothur, которые используют общедоступные базы данных (GreenGenes, Ribosomal Database Project и SILVA 72–76 для выполнения таксономического назначения.Прогнозы метаболических функций, основанные на таксономической идентичности последовательностей гена 16S рРНК, могут быть дополнительно получены с использованием таких алгоритмов, как PICRUSt и Tax4Fun 77, 78. Для каталогизации функций генов или анализа отдельных геномов, метагеномный или метатранскриптомный подходы (в которых гены или транскрипты соответственно секвенируются напрямую без ПЦР) могут использоваться для получения информации о разнообразии сообщества, структуре и метаболических функциях или экспрессии генов (79). Биоинформатический анализ таких наборов данных является более сложным, чем данные ампликона 16S, и обычно включает сборщик последовательностей, такой как Velvet (рабочая среда CLC, Newbler версия 3.0, Biospace) или MG-RAST. Бактериальные таксоны и функциональные группы могут быть назначены на основе инструмента поиска базового локального сопоставления (BLAST), а функции генов могут быть проанализированы с использованием либо Киотской энциклопедии генов и геномов (KEGG), либо кластера ортологичных генов (COG). В микробиоме кишечника цыпленка метагеномика использовалась для изучения функций слепой кишки, ответа кишечника на воздействие патогена, корреляции между микробным ответом и параметрами производительности, сравнения жирных и постных бройлерных линий, описания вирулома и генов устойчивости к антибиотикам (80).Некоторые из основанных на NGS исследований, изучающих состав микробного сообщества кишечника цыпленка и его функции в отношении диетических реакций / лечения антибиотиками, представлены в таблице 3. Однако все эти исследования трудно сравнивать из-за различий в используемых платформах NGS, породе, типе образца. , метод отбора проб и т. д. Следовательно, для изучения микробного сообщества кишечника цыпленка необходим стандартный протокол, доступный для микробиома человека, чтобы получить сопоставимые результаты. В настоящее время большинство метагеномных подходов к изучению ЖКТ курицы по-прежнему недоступны для большинства исследователей и ветеринаров.

Таблица 3 . : Различные подходы omics, применяемые для понимания сообщества и функций кишечных микробов.

Чтобы обойти некоторые ограничения анализа на основе последовательностей, недавно были использованы протеомные методы для определения метаболических и функциональных свойств микробиома (81, 82). Транскриптомика измеряет транскрипцию гена in situ , обеспечивая точное отражение физиологических функций, даже если при отборе образцов требуется особая осторожность (71).Поскольку существуют ограниченные коллекции культур для штаммов домашней птицы, увеличение бактериальных культур и надлежащая каталогизация их биохимических и генетических свойств будет способствовать применению протеомики и других «омических» подходов.

Заключение

В последние годы был достигнут значительный прогресс в понимании таксономического состава микробиома GI и его вклада в здоровье кишечника. В будущих исследованиях важно применять многопрофильные подходы, чтобы лучше понять роль микробиома в питании, здоровье, болезнях и продуктивности.Прогресс в этой области поможет нам лучше понять, как управлять микробиотой кишечника на основе изменений окружающей среды, диеты и физиологии птиц, и будет способствовать дальнейшему углублению нашего понимания модификации метаболических путей, связанных с микробиотой, тем самым открывая новые возможности для улучшение общего состояния здоровья птицы.

Взносы авторов

Рукопись обзора написана

YS и SK. Б.О. проверил литературу и рукопись и дал критические предложения и комментарии.WK выбрал тему обзора, изучил литературу и предоставил критический обзор и предложения / комментарии.

Заявление о конфликте интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

Список литературы

2. Джериссен С.Х., Льюис Ф., Ван дер Клис Дж.Д., Мроз З., Ребел Дж. М., Тер Хюрне А.А. Параметры и методы для определения здоровья кишечника птицы на основе иммунитета, целостности и функциональности. Curr Issues Intest Microbiol. (2002) 3: 1–14.

PubMed Аннотация | Google Scholar

5. Кумар С., Чен С., Индугу Н., Верланг Г.О., Сингх М., Ким В.К. и др. Влияние отмены антибиотиков из кормов на микробную динамику кишечника цыплят, иммунитет, показатели роста и распространенность патогенов пищевого происхождения. PloS ONE (2018) 13: e01

. DOI: 10.1371 / journal.pone.01

PubMed Аннотация | CrossRef Полный текст | Google Scholar

7. Danzeisen JL, Kim HB, Isaacson RE, Tu ZJ, Johnson TJ.Модуляции микробиома и метагенома слепой кишки цыпленка в ответ на лечение антикокцидиалами и стимуляторами роста. PLoS ONE (2011) 6: e27949. DOI: 10.1371 / journal.pone.0027949

PubMed Аннотация | CrossRef Полный текст | Google Scholar

8. Манкабелли Л., Феррарио С., Милани С., Мангифеста М., Туррони Ф., Дюранти С. и др. Изучение биоразнообразия кишечной микробиоты цыплят-бройлеров. Environ Microbiol. (2016) 18: 4727–4738. DOI: 10.1111 / 1462-2920.13363

PubMed Аннотация | CrossRef Полный текст | Google Scholar

9. Хегде Н.В., Кариявасам С., Деброй С. Сравнение генов устойчивости к противомикробным препаратам в микробиоме куриного кишечника, выращенном на органической и традиционной диете. Veter Anim Sci. (2016) 1: 9–16. DOI: 10.1016 / j.vas.2016.07.001

CrossRef Полный текст | Google Scholar

11. Герритсен Дж., Смидт Х., Райкерс Г.Т., де Вос ВМ. Кишечная микробиота в здоровье и болезнях человека: влияние пробиотиков. Genes Nutrit. (2011) 6: 209–40. DOI: 10.1007 / s12263-011-0229-7

PubMed Аннотация | CrossRef Полный текст | Google Scholar

14. Ападжалахти Дж. Сравнительная микрофлора кишечника, метаболические проблемы и потенциальные возможности. J Appl Poult Res. (2005) 14: 444–53. DOI: 10.1093 / japr / 14.2.444

CrossRef Полный текст | Google Scholar

15. Чжоу В., Ван И, Лин Дж. Функциональное клонирование и характеристика генов устойчивости к антибиотикам из микробиома кишечника цыпленка. Appl Environ Microbiol. (2012) 78: 3028–32. DOI: 10.1128 / AEM.06920-11

PubMed Аннотация | CrossRef Полный текст | Google Scholar

16. Купман Дж. П., Кеннис Х. М., Маллинк JWMA, Принс Р. А., Стадхаудерс А. М., Бур HD и др. «Нормализация» стерильных мышей анаэробно культивированной флорой слепой кишки «нормальных» мышей. Lab Anim (1984) 18: 188–94. DOI: 10.1258 / 0023677847808

  • PubMed Аннотация | CrossRef Полный текст | Google Scholar

    17.Shakouri MD, Iji PA, Mikkelsen LL, Cowieson AJ. Функция кишечника и микрофлора кишечника цыплят-бройлеров под влиянием зерен злаков и добавок микробных ферментов. J Anim Physiol Anim Nutrit. (2009) 93: 647–58. DOI: 10.1111 / j.1439-0396.2008.00852.x

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    18. Окли Б. Б., Лиллехой Х. С., Когут М. Х., Ким В. К., Маурер Дж. Дж., Педросо А. и др. Микробиом желудочно-кишечного тракта курицы. FEMS Microbiol Lett. (2014) 360: 100–12. DOI: 10.1111 / 1574-6968.12608

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    20. Christl SU, Bartram HP, Paul A, Kelber E, Scheppach W., Kasper H. Метаболизм желчных кислот кишечными бактериями в непрерывной культуре: влияние крахмала и pH. Ann Nutrit Metabol. (1997) 41: 45–51. DOI: 10.1159 / 000177977

    CrossRef Полный текст | Google Scholar

    21. Vispo C, Karasov WH. Взаимодействие микробов птичьего кишечника и их хозяина: неуловимый симбиоз.В: Gastrointestinal Microbiology Mackie R, White B, editors. Нью-Йорк, штат Нью-Йорк: Спрингер. (1997). п. 116–55.

    Google Scholar

    23. Митчелл М.А., Морето М. Абсорбционная функция тонкой кишки: Адаптации, отвечающие требованиям. В: Perry GC, редактор. Абсорбционная функция тонкого кишечника: адаптации, отвечающие требованиям . Оксфорд: CABI Publishing (2006). п. 43–64.

    Google Scholar

    25. Тейрлинк Э., Гуссем МДЭ, Дьюульф Дж., Хезбрук Ф., Дукатель Р., Ван Иммерсил Ф.Морфометрическая оценка «дисбактериоза» у бройлеров. Патология птиц (2011) 40: 139–44. DOI: 10.1080 / 03079457.2010.543414

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    26. Борда-Молина Д., Витал М., Зоммерфельд В., Родехуцкорд М., Камаринья-Сильва А. Анализ микробиоты кишечника бройлеров, получающих рацион с фосфором, кальцием и фитазой. Front Microbiol. (2016) 7: 2033. DOI: 10.3389 / fmicb.2016.02033

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    27.Когут MH, Окли BB. Пространственные и временные изменения в микробиомах слепой кишки и фекалий цыплят-бройлеров и корреляции бактериальных таксонов с экспрессией генов цитокинов. Front Veter Sci. (2016) 3:11. DOI: 10.3389 / fvets.2016.00011

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    28. Рехман Х.Ю., Вахьен В., Авад В.А., Зентек Дж. Аборигенные бактерии и бактериальные продукты метаболизма в желудочно-кишечном тракте цыплят-бройлеров. Arch Anim Nutrit. (2007) 61: 319–35.DOI: 10.1080 / 174503

    556817

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    29. Апаялахти Дж., Кеттунен А., Грэм Х. Характеристики микробных сообществ желудочно-кишечного тракта, с особым упором на курицу. Worlds Poult Sci J. (2004) 60: 223–32. DOI: 10.1079 / WPS20040017

    CrossRef Полный текст | Google Scholar

    30. Лу Дж., Идрис Ю., Хармон Б., Хофакр С., Маурер Дж. Дж., Ли MD. Разнообразие и преемственность кишечного бактериального сообщества созревающих цыплят-бройлеров. Appl Environ Microbiol. (2003) 69: 6816–24. DOI: 10.1128 / AEM.69.11.6816-6824.2003

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    31. Шауфи М.А., Сио С.К., Чонг К.В., Ган Х.М., Хо Ю.В. Расшифровка микробной динамики кишечника цыплят на основе высокопроизводительного анализа метагеномики 16S рРНК. Gut Pathol. (2015) 7: 4. DOI: 10.1186 / s13099-015-0051-7

    CrossRef Полный текст | Google Scholar

    32. Йоман С.Дж., Чиа Н., Джеральдо П., Сипос М., Голденфельд Н.Д., Уайт Б.А.Микробиом желудочно-кишечного тракта курицы. Anim Health Res Rev. (2012) 13: 89–99. DOI: 10.1017 / S1466252312000138

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    33. Стэнли Д., Хьюз Р.Дж., Мур Р.Дж. Микробиота желудочно-кишечного тракта кур: влияние на здоровье, продуктивность и болезни. Appl Microbiol Biotechnol. (2014) 98: 4301–10. DOI: 10.1007 / s00253-014-5646-2

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    34.Kers JG, Velkers FC, Fischer EAJ, Hermes GDA, Stegeman JA, Smidt H. Хозяин и факторы окружающей среды, влияющие на микробиоту кишечника кур. Front Microbiol. (2018) 9: 235 DOI: 10.3389 / fmicb.2018.00235

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    35. Баллоу А.Л., Али Р.А., Мендоза М.А., Эллис Дж. К., Хассан Х. М., Крум В. Дж. И др. Развитие микробиома цыплят: как раннее воздействие влияет на будущее микробное разнообразие. Front Veter Sci. (2016) 3: 2.DOI: 10.3389 / fvets.2016.00002

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    36. Црханова М, Градецка Х, Фалдынова М, Матулова М, Гавличкова Х., Сисак Ф. и др. Иммунный ответ кишечника цыплят на естественную колонизацию кишечной микрофлорой и на инфекцию Salmonella enterica serovar enteritidis. Infect Immun. (2011) 79: 2755–63. DOI: 10.1128 / IAI.01375-10

    PubMed Аннотация | CrossRef Полный текст

    37. Гонг Дж., Си У., Форстер Р.Дж., Хуанг Р., Ю Х, Инь И и др.Основанный на гене 16s рРНК анализ бактериального сообщества и филогении слизистой оболочки желудочно-кишечного тракта курицы: от сельскохозяйственных культур до слепой кишки. FEMS Microbiol Ecol. (2007) 59: 147–57. DOI: 10.1111 / j.1574-6941.2006.00193.x

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    39. Siegerstetter S-C, Schmitz-Esser S, Magowan E, Wetzels SU, Zebeli Q, Lawlor PG, et al. Профили кишечной микробиоты, связанные с низким и высоким остаточным потреблением корма цыплятами в двух географических регионах. PLoS ONE (2017) 12: e0187766. DOI: 10.1371 / journal.pone.0187766

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    40. Лампкинс Б.С., Батал А.Б., Ли М.Д. Оценка бактериального сообщества и развития кишечника различных генетических линий кур. Poult Sci. (2010) 89: 1614–21. DOI: 10.3382 / пс.2010-00747

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    41. Ку А., Брюлк Дж. М., Уилсон М. К., Ло Б. Ф., Теорет Дж. Р., Джоенс Л. А. и др.Сравнительная метагеномика выявляет специфические метавируломы хозяина и элементы горизонтального переноса генов в микробиоме слепой кишки цыпленка. PLoS ONE (2008) 3: e2945. DOI: 10.1371 / journal.pone.0002945

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    42. Сержант М.Дж., Константиниду К., Коган Т.А., Бедфорд М.Р., Пенн К.В., Паллен М.Дж. Обширное микробное и функциональное разнообразие микробиома слепой кишки цыпленка. PLoS ONE (2014) 9: e. DOI: 10,1371 / журнал.pone.00

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    43. Саенгкердсуб С., Эррера П., Вудворд К.Л., Андерсон Р.С., Нисбет Д.Д., Рике С.К. Идентификация и количественная оценка метаногенных архей в слепой кишке взрослой курицы. Appl Environ Microbiol. (2007) 73: 353–6. DOI: 10.1128 / AEM.01931-06

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    44. Чой Дж. Х., Ким Дж. Б., Ча Си Джей. Пространственная неоднородность и стабильность бактериального сообщества пищеварительного тракта цыплят-бройлеров. Poult Sci. (2014) 93: 1942–50. DOI: 10.3382 / ps.2014-03974

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    45. Шапиро СК, Сарлес ВБ. Микроорганизмы пищеварительного тракта нормальных цыплят. J Bacteriol. (1949) 58: 531–44.

    PubMed Аннотация | Google Scholar

    47. Salanitro JP, Blake IG, Muirhead PA. Исследования микрофлоры слепой кишки коммерческих цыплят-бройлеров. Appl Microbiol. (1974) 28: 439–47.

    PubMed Аннотация | Google Scholar

    48. Виденская П., Сисак Ф., Гавличкова Х., Фалдынова М., Рыхлик И. Влияние инфекции serovar enteritidis Salmonella enterica на состав микробиоты слепой кишки цыплят. BMC Veter Res. (2013) 9: 140. DOI: 10.1186 / 1746-6148-9-140

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    49. Лагкувардос И., Оверманн Дж., Клавель Т. Культивированные микробы составляют значительную часть кишечной микробиоты человека и мыши. Gut Microb. (2017) 8: 493–503. DOI: 10.1080 / 194

    .2017.1320468

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    50. Knarreborg A, Simon MA, Engberg RM, Jensen BB, Tannock GW. Влияние диетического источника жира и субтерапевтических уровней антибиотика на бактериальное сообщество подвздошной кишки цыплят-бройлеров в разном возрасте. Appl Environ Microbiol. (2002) 68: 5918–24. DOI: 10.1128 / AEM.68.12.5918-5924.2002

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    51.Gaggia F, Mattarelli P, Biavati B. Пробиотики и пребиотики в кормлении животных для безопасного производства пищевых продуктов. Inter J Food Microbiol. (2010) 141: S15–28. DOI: 10.1016 / j.ijfoodmicro.2010.02.031

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    52. Юнг SJ, Houde R, Baurhoo B, Zhao X, Lee BH. Влияние галактоолигосахаридов и пробиотического штамма на основе Bifidobacteria lactis на показатели роста и фекальную микрофлору цыплят-бройлеров. Poult Sci. (2008) 87: 1694–9. DOI: 10.3382 / пс.2007-00489

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    53. Сюй Ц.Р., Ху Ч., Ся М.С., Чжан XA, Ван М.К. Влияние диетических фруктоолигосахаридов на активность пищеварительных ферментов, микрофлору кишечника и морфологию самцов бройлеров. Poult Sci. (2003) 82: 1030–6. DOI: 10.1093 / пс / 82.6.1030

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    54. Nywang X, Gibson GR. Эффекты ферментации олигофруктозы и инулина in vitro бактериями, растущими в толстом кишечнике человека. J Appl Bacteriol. (1993) 75: 373–80. DOI: 10.1111 / j.1365-2672.1993.tb02790.x

    CrossRef Полный текст | Google Scholar

    56. Ле Блей Г., Мишель С., Блоттьер Х. М., Шербут С. Длительное употребление фруктоолигосахаридов вызывает кратковременное увеличение количества бактерий, продуцирующих молочную кислоту, и стойкое увеличение бутирата слепой кишки у крыс. J Nutrit. (1999) 129: 2231–35.

    PubMed Аннотация | Google Scholar

    57. Ким HJ, Eom SJ, Park SJ, Cha CJ, Kim GB. Lactobacillus alvi sp. nov., выделенный из пищеварительного тракта курицы. FEMS Microbiol Lett. (2011) 323: 83–7. DOI: 10.1111 / j.1574-6968.2011.02361.x

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    58. Паттерсон Дж. А., Орбан Дж. И., Саттон А. Л., Ричардс Г. Н.. Селективное обогащение бифидобактерий в кишечном тракте бройлеров термически продуцируемым кетозом и влияние на продуктивность бройлеров. Poult Sci. (1997) 76: 497–500. DOI: 10.1093 / пс / 76.3.497

    CrossRef Полный текст | Google Scholar

    59. Ян Ю, Иджи П.А., Чокт М. Диетическая модуляция микрофлоры кишечника у цыплят-бройлеров: обзор роли шести видов альтернатив кормящим антибиотикам. World Poult Sci J. (2009) 65:97. DOI: 10.1017 / S004393390

    87

    CrossRef Полный текст | Google Scholar

    60. Hugenholtz P, Goebel BM, Pace NR. Влияние культурно-независимых исследований на формирующееся филогенетическое представление о бактериальном разнообразии. J Bacteriol. (1998) 180: 4765–74.

    PubMed Аннотация | Google Scholar

    61. Стейли Дж. Т., Конопка А. Измерение активности нефотосинтезирующих микроорганизмов in situ в водных и наземных средах обитания. Ann Rev Microbiol. (1985) 39: 321–46. DOI: 10.1146 / annurev.mi.39.100185.001541

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    63. Гонг Дж., Форстер Р. Дж., Ю Х., Чемберс Дж. Р., Уиткрофт Р., Сабур П. М. и др. Молекулярный анализ бактериальных популяций в подвздошной кишке цыплят-бройлеров и сравнение с бактериями в слепой кишке. FEMS Microbiol Ecol. (2002) 41: 171–9. DOI: 10.1111 / j.1574-6941.2002.tb00978.x

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    64. Диас-Санчес С., Ханнинг И., Пендлтон С., Д'суза Д. Секвенирование следующего поколения: будущее молекулярной генетики в птицеводстве и безопасности пищевых продуктов. Poult Sci. (2013) 92: 562–72. DOI: 10.3382 / ps.2012-02741

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    65. Flint HJ, Leitch ECM, Duncan SH, Walker AW, Patterson AJ, Rincon MT, et al.Молекулярные подходы к анализу микробных экосистем желудочно-кишечного тракта. В: Perry GC, редактор. Молекулярные подходы к анализу микробных экосистем желудочно-кишечного тракта . Оксфорд: CABI Publishing (2006). п. 107–23.

    Google Scholar

    66. Парк С.Х., Ханнинг И., Перрота А., Бенч Б.Дж., Альм Е., Рике С.К. Изменение экологии желудочно-кишечного тракта у альтернативно выращиваемой домашней птицы и возможность молекулярной и метаболомической оценки. Poult Sci. (2013) 92: 546–61.DOI: 10.3382 / ps.2012-02734

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    67. Кумар С., Дагар С.С., Моханти А.К., Сирохи С.К., Пуния М., Кухад Р.К. и др. Подсчет метаногенов с акцентом на флуоресцентную гибридизацию in situ. Naturwissenschaften (2011) 98: 457–72. DOI: 10.1007 / s00114-011-0791-2

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    69. Хамади М., Уокер Дж. Дж., Харрис Дж. К., Голд Н. Дж., Найт Р. Праймеры со штрих-кодом, исправляющие ошибки, для пиросеквенирования сотен образцов в мультиплексном режиме. Nat Methods (2008) 5: 235–7. DOI: 10.1038 / nmeth.1184

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    71. Кумар С., Питта Д.В. Революция в микробиологии рубца. В: Пуния А.К., Сингх Р., Камра Д.Н., редакторы . Микробиология рубца: от эволюции к революции. Нью-Дели: Спрингер (2015). п. 357–79.

    Google Scholar

    72. Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK, et al. QIIME позволяет анализировать данные секвенирования сообщества с высокой пропускной способностью. Nat Methods (2010) 7: 335–6. DOI: 10.1038 / nmeth.f.303

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    73. Schloss PD, Westcott SL, Ryabin T, Hall JR, Hartmann M, Hollister EB, et al. Представляем mothur: программное обеспечение с открытым исходным кодом, независимое от платформы, поддерживаемое сообществом, для описания и сравнения сообществ микробов. Appl Environ Microbiol. (2009) 75: 7537–41. DOI: 10.1128 / AEM.01541-09

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    74.ДеСантис Т.З., Хугенгольц П., Ларсен Н., Рохас М., Броди Е.Л., Келлер К. и др. Greengenes, проверенная химерами база данных генов 16S рРНК и рабочая среда, совместимая с ARB. Appl Environ Microbiol. (2006) 72: 5069–72. DOI: 10.1128 / AEM.03006-05

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    75. Дюрсо Л.М., Хархай Г.П., Смит Т.П., Боно Дж.Л., Десантис Т.З., Хархай Д.М. и др. Различия между животными в микробном разнообразии фекалий мясного скота. Appl Environ Microbiol. (2010) 76: 4858–62. DOI: 10.1128 / AEM.00207-10

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    76. Прюсс Е., Кваст С., Книттель К., Фукс Б.М., Людвиг В., Пеплис Дж. И др. SILVA: всеобъемлющий онлайн-ресурс для проверенных и согласованных данных о последовательностях рибосомных РНК, совместимых с ARB. Nucleic Acids Res. (2007) 35: 7188–96. DOI: 10.1093 / nar / gkm864

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    77. Лангиль М.Г., Заневельд Дж., Капорасо Дж. Дж., Макдональд Д., Найтс Д., Рейес Дж. А. и др.Прогнозирующее функциональное профилирование микробных сообществ с использованием последовательностей маркерного гена 16S рРНК. Nat Biotechnol. (2013) 31: 814–21. DOI: 10.1038 / NBT.2676

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    78. Abhauer KP, Wemheuer B, Daniel R, Meinicke P. Tax4Fun: прогнозирование функциональных профилей на основе данных метагеномной 16S рРНК. Биоинформатика (2015) 31: 2882–4. DOI: 10.1093 / биоинформатика / btv287

    CrossRef Полный текст | Google Scholar

    79.Zinicola M, Higgins H, Lima S, Machado V, Guard C, Bicalho R Shotgun Метагеномное секвенирование выявляет функциональные гены и микробиом, связанные с пальцевым дерматитом крупного рогатого скота. PLoS ONE (2015) 10: e0133674. DOI: 10.1371 / journal.pone.0133674

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    80. Борда-Молина Д., Зейферт Дж., Камаринья-Силва А. Современные перспективы желудочно-кишечного тракта цыпленка и его микробиома. Comput Struct Biotechnol J. (2018) 16: 131–9.DOI: 10.1016 / j.csbj.2018.03.002

    CrossRef Полный текст | Google Scholar

    81. Тан Й., Андервуд А., Гилберт А., Вудворд М. Дж., Петровска Л. Метапротеомический анализ показывает процесс адаптации микробиоты кишечника цыпленка. Appl Environ Microbiol. (2014) 80: 478–85. DOI: 10.1128 / AEM.02472-13

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    82. Тилокка Б., Витциг М., Родехуцкорд М., Зейферт Дж. Вариации доступности фосфора, вызывающие изменения функций микробиома в желудочно-кишечном тракте цыплят. PLoS ONE (2016) 11: e0164735. DOI: 10.1371 / journal.pone.0164735

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    83. Сингх К.М., Шах Т.М., Редди Б., Дешпанде С., Ранг Д.Н. и Джоши К.Г. Таксономическая и геноцентрическая метагеномика фекального микробиома бройлеров с низким и высоким коэффициентом конверсии корма. J Appl Genet. (2014) 55: 145–54. DOI: 10.1007 / s13353-013-0179-4

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    84.Поланский О., Секелова З., Фалдынова М., Себкова А., Сисак Ф., Рычлик И. Важные метаболические пути и биологические процессы, выражаемые микробиотой слепой кишки цыплят. Appl Environ Microbiol. (2016) 82: 1569–76. DOI: 10.1128 / AEM.03473-15

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    85. Ма Л, Ся Й, Ли Б., Ян Й, Ли Л.Г., Тидже Дж. М. и др. Метагеномная сборка выявляет хозяев генов устойчивости к антибиотикам и общего резистома в фекалиях свиней, кур и человека. Environ Sci Technol. (2016) 50: 420–7. DOI: 10.1021 / acs.est.5b03522

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    86. Панпан Т., Сюэ Дж., Личжи С., Цзюнь Л., Личжи Х, Линвэй З. и др. Метагеномный анализ генов устойчивости к антибиотикам в фекальной микробиоте цыплят. Agri Gene (2017) 5: 1–6. DOI: 10.1016 / j.aggene.2017.06.001

    CrossRef Полный текст | Google Scholar

    87. Xiong W., Wang Y, Sun Y, Ma L, Zeng Q, Jiang X, et al.Опосредованные антибиотиками изменения в фекальном микробиоме цыплят-бройлеров определяют частоту возникновения генов устойчивости к антибиотикам. Микробиом (2018) 6:34. DOI: 10.1186 / s40168-018-0419-2

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    88. Zhao L, Wang G, Siegel P, He C, Wang H, Zhao W. и др. Количественный генетический фон хозяина влияет на микробиомы кишечника цыплят. Научный доклад (2013) 3: 1163. DOI: 10.1038 / srep01163

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    89.Мэн Х., Чжан Ю., Чжао Л., Чжао В., Хе С., Хонакер С.Ф. и др. Выбор массы тела влияет на количественные генетические коррелированные ответы кишечной микробиоты. PLoS ONE (2014) 9: e89862. DOI: 10.1371 / journal.pone.0089862

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    90. Парк С.Х., Ли С.И., Рике С.К. Популяции микробов в слепых кишках цыплят с голой шеей, выращенных на пастбищах, которых кормили коммерческими пребиотиками клеточных стенок дрожжей с помощью платформы Illumina MiSeq. PLoS ONE (2016) 11: e0151944.DOI: 10.1371 / journal.pone.0151944

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    91. Hou Q, Kwok L-Y, Zheng Y, Wang L, Guo Z, Zhang J, Huang W. и др. Дифференциальная фекальная микробиота сохраняется в линиях цыплят-бройлеров, различающихся по признакам упитанности. Научный доклад (2016) 6: 37376. DOI: 10.1038 / srep37376

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    92. Дин Дж., Чжао Л., Ван Л., Чжао В., Чжай З., Ленг Л. и др.Ожирение, вызванное дивергентным отбором, изменяет состав и функциональные пути микробиоты кишечника цыплят. Genet Select Evolut. (2016) 48:93. DOI: 10.1186 / s12711-016-0270-5

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    93. Ранджиткар С., Энгберг Р.М. Влияние кормления силосом кукурузы с гофрированными зернами на рост и колонизацию кишечника бройлеров Campylobacter jejuni . Avian Pathol. (2016) 45: 253–60.DOI: 10.1080 / 03079457.2016.1146821

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    94. Джонсон Т.Дж., Юманс Б.П., Нолл С., Кардона С., Эванс Н.П., Карнезос Т.П. и др. Постоянная и предсказуемая бактериальная микробиота цыплят-бройлеров при производстве без антибиотиков демонстрирует сильную корреляцию с производительностью. Appl Environment Microbiol. (2018) 84: e00362–18. DOI: 10.1128 / AEM.00362-18

    CrossRef Полный текст | Google Scholar

    Развитие кишечной микробиоты ребенка

    Abstract

    Почти сразу после рождения человека возникает новая микробная экосистема, которая находится в желудочно-кишечном тракте этого человека.Хотя это универсальная и неотъемлемая часть биологии человека, временное развитие этого процесса, источники микробов, составляющих экосистему, как и почему они варьируются от одного младенца к другому, и как состав этой экосистемы влияет на человека. физиология, развитие и болезнь все еще плохо изучены. В качестве шага к систематическому исследованию этих вопросов мы разработали микроматрицу для обнаружения и количественного определения последовательностей генов малых субъединиц рибосомной РНК (SSU рРНК) большинства известных в настоящее время видов и таксономических групп бактерий.Мы использовали этот микрочип вместе с секвенированием клонированных библиотек рДНК SSU, амплифицированных с помощью ПЦР, для профилирования микробных сообществ в среднем по 26 образцам стула от 14 здоровых доношенных новорожденных, включая пару дизиготных близнецов, начиная с первый стул после рождения и продолжающийся через определенные промежутки времени в течение первого года жизни. Чтобы исследовать возможное происхождение детской микробиоты, мы также составили профили вагинальных образцов и молока от большинства матерей, а также образцов кала от всех матерей, большинства отцов и двух братьев и сестер.Состав и временные паттерны микробных сообществ широко варьировались от ребенка к ребенку. Несмотря на значительные временные различия, отличительные черты микробного сообщества каждого ребенка можно было распознать в течение нескольких недель или месяцев. Поразительно параллельные временные паттерны близнецов предполагают, что случайные воздействия окружающей среды играют важную роль в определении отличительных характеристик микробного сообщества у каждого ребенка. К концу первого года жизни идиосинкразические микробные экосистемы у каждого ребенка, хотя и различны, сходились к профилю, характерному для желудочно-кишечного тракта взрослого человека.

    Сведения об авторе

    Уже почти столетие было признано, что люди населены удивительно плотной и разнообразной микробной экосистемой, но мы только начинаем понимать и ценить многие роли, которые эти микробы играют в здоровье и развитии человека. Знание состава этой экосистемы - решающий шаг к пониманию ее роли. В этом исследовании мы разработали и применили подход на основе микрочипов рибосомальной ДНК для отслеживания развития кишечной флоры у 14 здоровых доношенных детей в течение первого года жизни.Мы обнаружили, что состав и временные паттерны микробных сообществ широко варьировались от ребенка к ребенку, поддерживая более широкое определение здоровой колонизации, чем считалось ранее. К одному году младенцы сохранили свою уникальность, но приблизились к профилю, характерному для желудочно-кишечного тракта взрослого человека. Состав и временные модели развития кишечной микробиоты у пары разнояйцевых близнецов были поразительно похожи, что позволяет предположить, что генетические факторы и факторы окружающей среды формируют нашу кишечную микробиоту воспроизводимым образом.

    Образец цитирования: Палмер С., Бик Е.М., ДиДжиулио Д.Б., Релман Д.А., Браун П.О. (2007) Развитие кишечной микробиоты у младенцев человека. PLoS Biol 5 (7): e177. https://doi.org/10.1371/journal.pbio.0050177

    Академический редактор: Иджун Руан, Институт генома Сингапура, Сингапур

    Поступила: 22 января 2007 г .; Принята к печати: 4 мая 2007 г .; Опубликован: 26 июня 2007 г.

    Это статья в открытом доступе, распространяемая в соответствии с положениями декларации Creative Commons Public Domain, которая предусматривает, что после размещения в общественном достоянии эта работа может быть свободно воспроизведена, распространена, передана, модифицированы, созданы на основе или иным образом использованы кем-либо в любых законных целях.

    Финансирование: Эта работа финансировалась Фондом Хорна и Медицинским институтом Говарда Хьюза.

    Конкурирующие интересы: ПОБ - исследователь Медицинского института Говарда Хьюза.

    Сокращения: GI, желудочно-кишечный; нт, нуклеотид; ОТУ, оперативная таксономическая единица; prokMSA, выравнивание множественных прокариотических последовательностей; КПЦР, количественная ПЦР; рДНК, рибосомная ДНК; рРНК, рибосомальная РНК; СГУ, г. малая единица

    Введение

    Тело взрослого человека обычно содержит в десять раз больше микробных клеток, чем человеческих клеток, в основном из-за чрезвычайно высокой плотности микробов, обнаруженных в кишечном тракте человека (обычно 10 11 –10 12 микробов / мл просвета. содержание).Эта микробная экосистема выполняет множество важных функций для своего хозяина-человека, включая защиту от патогенов, обработку питательных веществ, стимуляцию ангиогенеза и регулирование накопления жира в организме хозяина [1–7]. Понятно, что этот список еще не полный; по мере расширения этой области исследований мы постоянно открываем для себя новые роли и отношения. Исследования на мышах-гнотобиотах были особенно полезными, демонстрируя важную роль микробиоты желудочно-кишечного тракта (ЖКТ) в нормальном развитии кишечника [2,5].Кроме того, многие заболевания как у взрослых, так и у младенцев имеют известную или предполагаемую связь с микробиотой желудочно-кишечного тракта, включая рак желудка [8], лимфому лимфоидной ткани, ассоциированную со слизистой оболочкой [9], воспалительное заболевание кишечника [10,11] и некротический энтероколит [ 12,13].

    Состав микробиоты ЖКТ взрослых был интенсивно изучен с использованием как культивирования, так и, в последнее время, методов на основе последовательности малых субъединиц (SSU) рибосомной ДНК (рДНК), не зависящих от культуры [14]. Одна только экосистема толстой кишки человека насчитывает более 400 видов бактерий, принадлежащих к ограниченному числу широких таксономических подразделений [15].Было обнаружено, что представители анаэробных родов Bacteroides, Eubacterium, Clostridium, Ruminococcus, и Faecalibacterium обычно составляют подавляющее большинство микробного сообщества кишечника взрослых людей. Тем не менее кишечник каждого взрослого человека, по-видимому, имеет уникальное микробное сообщество со структурой, которая остается стабильной в течение нескольких месяцев [3,15,16].

    Напротив, микробиота желудочно-кишечного тракта младенцев более изменчива по своему составу и менее стабильна с течением времени. На первом году жизни кишечный тракт младенца прогрессирует от бесплодия до чрезвычайно плотной колонизации, заканчиваясь смесью микробов, которая в целом очень похожа на ту, что обнаруживается в кишечнике взрослого [17].Хотя начальная и конечная точки этого временного отрезка хорошо определены, путь между этими точками плохо понят. В литературе имеются противоречивые сообщения о составе микробиоты ЖКТ новорожденных и факторах, которые ее формируют. В нескольких исследованиях сообщалось, что бифидобактерии почти всегда доминируют в микробиоте ЖКТ грудных детей в возрасте нескольких недель [17–20], в то время как другие обнаружили, что они встречаются только у небольшой части младенцев или не являются преобладающими численно [21, 22].Влияние диеты на состав микробиоты желудочно-кишечного тракта младенцев также является спорным - многочисленные исследования показали более низкую численность Bifidobacteria и более высокую численность аэробных бактерий в микробиоте желудочно-кишечного тракта младенцев на искусственном вскармливании по сравнению с младенцами на грудном вскармливании [ 20,21,23–25], однако в других отчетах такой разницы не обнаружено [26,27]. Способ доставки часто упоминается как один из ключевых факторов, формирующих микробиоту младенца [18,28,29]. Сообщалось, что микробиота желудочно-кишечного тракта младенцев, рожденных с помощью кесарева сечения, отличается от микробиоты младенцев, рожденных естественным путем, как по времени колонизации, так и по составу [18,30–32], а в некоторых случаях имеются явные следы материнского микробиота влагалища в микробиоте желудочно-кишечного тракта новорожденных [33], однако относительная важность способа доставки для микробиоты желудочно-кишечного тракта неясна.Из-за увеличения частоты проблем с желудочно-кишечным трактом у недоношенных детей, влияние гестационного возраста также широко изучалось. Эти исследования неизменно показывают, что микробиота госпитализированных недоношенных детей отличается от микробиоты здоровых доношенных детей [32,34–36]. Попытки связать определенные микробы с возникновением некротического энтероколита, состояния с подозрением на бактериальную этиологию, которое является важной причиной заболеваемости и смертности недоношенных детей, дали неоднозначные результаты [32,36].Очевидно, что еще многое предстоит узнать о происхождении и развитии микробиоты желудочно-кишечного тракта младенцев и ее влиянии на здоровье и болезни.

    Мы сосредоточили наше исследование на описании ряда профилей, составляющих здоровую микробиоту желудочно-кишечного тракта младенцев, в надежде обнаружить темы, которые управляют ее развитием, а также предоставить подробный справочник и прочную основу для последующих исследований, посвященных изучению факторов, влияющих на Микробиота ЖКТ. В нашем исследовании участвовали 14 здоровых доношенных детей, рожденных от 13 здоровых матерей (включая одну группу разнояйцевых близнецов) (Таблица 1).Образцы стула собирали в соответствии с установленным графиком, начиная с первого стула после рождения: образцы собирали сначала ежедневно, а затем с уменьшающейся частотой в течение 1 года, с дополнительным отбором образцов вокруг ключевых событий (например, введение твердой пищи и введение антибиотиков), что дает в среднем 26 образцов стула на каждого ребенка (Таблица 2). Кроме того, у родителей, братьев и сестер были взяты образцы стула, а у матерей - вагинальные мазки и грудное молоко.Мы проанализировали микробиоту каждого из этих образцов с использованием недавно разработанной микроматрицы рДНК SSU, предназначенной для почти полного охвата известных видов рДНК SSU. Подмножество этих образцов было также проанализировано секвенированием библиотеки клонов рДНК SSU с целью калибровки и проверки наших результатов на микрочипах.

    Результаты

    Сравнение профилей бактериальной популяции на основе микрочипов и последовательностей

    Чтобы изучить состав нашего набора образцов и обеспечить основу для количественной калибровки результатов микрочипов, мы создали контрольный пул, объединив равные количества амплифицированной рДНК SSU из каждого образца, способного амплифицироваться с помощью ПЦР (за исключением образцов, собранных, когда младенцы были ≥1 года).Мы получили 3 458 высококачественных последовательностей клонов из библиотеки, созданной из этого пула, и таксономически присвоили каждой последовательности с помощью классификатора проекта базы данных рибосом [37]. Таксономическое распределение этих последовательностей суммировано в Таблице 3.

    Чтобы оценить эффективность нашего нового дизайна микрочипа относительно секвенирования рДНК SSU, мы секвенировали рДНК SSU, амплифицированные из каждого из 12 индивидуальных биологических образцов, полученных в этом исследовании, выбранных по их разнообразным профилям с помощью анализа микрочипов 16S рДНК.Этот набор исследований включал ДНК, выделенную из восьми детских стула, двух материнских стула, одного вагинального мазка и одного образца грудного молока. Для каждого из этих образцов мы амплифицировали последовательности рДНК SSU с использованием тех же праймеров ПЦР, которые использовались в анализе микрочипов, затем клонировали и секвенировали несколько сотен (среднее значение = 342) амплифицированных продуктов для всего 4100 последовательностей.

    Мы сосредоточили наше сравнение на уровнях 2, 3 и 4 иерархии прокариотического множественного выравнивания последовательностей (prokMSA), которые очень приблизительно соответствуют уровням типа, класса и порядка в классической таксономической иерархии.На этих более широких уровнях ожидается, что большинство последовательностей будут иметь гомологию по крайней мере с одним зондом в нашем текущем дизайне микроматрицы, и последовательности рДНК, как правило, могут быть однозначно классифицированы. Оценки относительной численности на основе микрочипов были получены для 2149 видов и таксономических групп путем объединения данных от всех зондов, которые представляли любое подмножество рассматриваемого класса, как полностью описано в разделе «Материалы и методы». Оценки на основе последовательностей были получены путем таксономической классификации каждой последовательности путем присвоения кода операционной таксономической единицы (OTU) prokMSA наилучшего соответствия BLAST в базе данных prokMSA 2004 года из 86 453 последовательностей гена рибосомной РНК (рРНК) SSU [38] (наборы данных S1 и S2 ).Хотя относительную численность бактериального вида нельзя точно определить из его пропорционального представительства в пуле амплифицированных последовательностей рДНК, мы ожидаем, что такие оценки должны быть точными в пределах порядка величины и обычно в пределах нескольких раз [39–41], на основе предыдущих исследований, в которых сравнивали уровни численности, оцененные на основе секвенирования ампликонов рДНК SSU, с подсчетами, основанными на гибридизации in situ.

    В целом результаты микроматрицы были очень похожи на результаты, полученные путем секвенирования, как качественно, так и количественно.На рисунке 1А показано сравнение профилей сообществ каждого из 12 образцов, полученных в результате нашего анализа микрочипов и путем секвенирования, для каждой таксономической группы на уровне 2 таксономического дерева prokMSA. Обратите внимание, что уровни (например, уровень 2) в таксономии prokMSA не имеют последовательного соответствия уровням (например, типу) в классической таксономической иерархии, и, таким образом, некоторые из традиционных имен, связанных с группами уровня 2 prokMSA, могут выглядеть несколько несочетаемый. Как анализ последовательностей, так и анализ микрочипов показали, что в образцах преобладает ограниченное количество таксономических групп - 99% из 4100 последовательностей охватываются всего тремя из 22 подразделений prokMSA уровня 2: 2.15 (Flexibacter-Cytophaga-Bacteroides), 2,28 (Proteobacteria) и 2,30 (грамположительные бактерии [включая Firmicutes и Actinobacteria]), а оставшийся 1% принадлежал к группам 2,10 (Prosthecobacter), 2,29 (Fusobacteria) , или 2,21 (цианобактерии и хлоропласты). Как показано на рис. 1B и 1C, профили популяции, полученные с помощью микроматрицы и анализа секвенирования, также были количественно схожи - корреляция Пирсона оценок относительной численности на основе микрочипов и секвенирования для 12 образцов была равна 0.97 на таксономическом уровне 2 prokMSA (рис. 1В), 0,89 на уровне 3 (рис. 1С) и 0,80 на уровне 4 (неопубликованные данные).

    Рис. 1. Сравнение профилей сообществ на основе микрочипов и секвенирования

    Полученные с помощью микрочипов и результаты секвенирования оценки численности таксономических групп сравниваются для 12 биологических образцов.

    (A) Сравниваются оценки численности для всех таксонов prokMSA уровня 2, измеренные на массиве. Каждый столбец представляет собой один биологический образец, а каждая строка соответствует одной таксономической группе, идентифицируемой (справа от каждой строки) своим числовым кодом prokMSA OTU вместе с примерно соответствующим условным названием группы.

    (B) Сравнение оценок относительной численности на основе последовательностей и микрочипов для таксономических групп уровня 2 в 12 образцах (то же, что и в [A]). Ось x представляет относительную численность, оцененную по частоте клонов из данной таксономической группы, а ось y представляет относительную численность, оцененную с помощью профилирования микроматрицы.

    (C) То же, что (B) для таксономических групп уровня 3.

    https://doi.org/10.1371/journal.pbio.0050177.g001

    Абсолютное количественное определение бактерий

    Мы оценили общую плотность бактерий в каждом образце с помощью количественного анализа ПЦР (КПЦР) в реальном времени, используя широкий набор бактериальных праймеров и зондов (см. «Материалы и методы»). Мы использовали общее количество копий гена рРНК (обычно около пяти на геном [42]) на грамм стула, как было оценено с помощью этого анализа, чтобы приблизиться к общей плотности бактерий. Как показано на рисунке 2, общее количество копий гена рРНК было относительно нестабильным в течение первой недели жизни, а затем сохранялось у большинства младенцев в диапазоне от 10 9 до 10 10 / г стула (сырой вес).Хотя явного влияния метода родоразрешения на время колонизации не наблюдалось, следует отметить, что младенцы 13 и 14 лет (близнецы с дизиготом), которые были единственными младенцами, родившимися с помощью планового кесарева сечения и, следовательно, без разрыва околоплодных вод. мембрана и воздействие микробиоты родовых путей матери во время схваток или родов имели низкое количество бактерий (<10 8 копий гена рРНК / г) до седьмого дня жизни.

    Рис. 2. Изменение общей плотности фекальных бактерий в течение первого года жизни.

    Для каждого образца ребенка численность бактерий оценивалась с помощью TaqMan ПЦР в реальном времени с универсальными бактериальными праймерами. Расчетные копии гена рРНК на грамм фекалий ( x -ось) нанесены на график как функция дней жизни ( x -ось). Обе оси имеют логарифмическую шкалу. Измерения обилия усечены по нижнему краю до значения, соответствующего 95-му процентилю экстракционных (отрицательных) контролей (количество копий, скорректированное на среднюю массу стула). Эпизоды антибактериального или противогрибкового (нистатин) лечения обозначены на временной оси серыми или розовыми полосами соответственно (дополнительную информацию см. В Таблице 1).

    https://doi.org/10.1371/journal.pbio.0050177.g002

    Обзор профилей популяции бактерий на основе микрочипов

    Мы проанализировали бактериальный состав 430 образцов - 363 образца детского стула, 43 образца стула взрослых, 2 образца стула братьев и сестер, 12 образцов грудного молока и 10 материнских вагинальных мазков - путем гибридизации с микрочипом ДНК, разработанным в этом исследовании. Объединив информацию по нескольким зондам (см. Материалы и методы), мы получили оценки относительной численности для 2149 вложенных таксономических групп и видов в каждой из этих выборок (все зонды перечислены в наборе данных S3; все таксоны перечислены в наборе данных S4).Как показано на рисунке 3, разнообразие на уровне филумов в образцах стула, проанализированных в этом исследовании, было чрезвычайно ограниченным. В подавляющем большинстве образцов преобладали всего три из 22 бактериальных групп уровня 2, представленных нашим микрочипом: 2,15 (Flexibacter-Cytophaga-Bacteroides), 2,28 (Proteobacteria) и 2,30 (грамположительные бактерии [Firmicutes и Actinobacteria] ). Вторым важным открытием стала замечательная степень индивидуальных различий в процессе колонизации. Хотя таксоны, населяющие желудочно-кишечный тракт младенца, были ограничены на самых широких уровнях, каждый ребенок отличался сочетанием видов микробов, которые он приобрел и поддерживал, а также точным временным паттерном, в котором эти виды появлялись и исчезали. Bacteroides, , например, доминировали в ранней микробиоте некоторых младенцев, но практически отсутствовали на этой стадии у других младенцев. Третьей поразительной особенностью этого набора данных была относительная стабильность микробных популяций с течением времени - даже на ранних этапах колонизации желудочно-кишечного тракта младенца большинство таксономических групп сохранялось в течение интервалов от недель до месяцев.

    Рисунок 3. Обзор профилей микробных сообществ всех образцов

    Каждый столбец ( n = 430) представляет один биологический образец, а каждая строка ( n = 2149) представляет одну таксономическую группу или вид.Выборки организованы во временном порядке, начиная с рождения слева и любых выборок, полученных от матери или других семей, справа от каждого временного курса. Клинья над столбцами пронумерованы в соответствии с идентификатором ребенка. Строки (таксоны) сортируются по их числовым кодам, так что подгруппы данной группы лежат непосредственно под более общей группой (например, 2.15, затем 2.15.1, затем 2.15.1.1). Символы «>» и «>>» добавляются к названиям помеченных таксономических групп, которые являются подгруппами на уровне 3 или уровне 4, соответственно, помеченной таксономической группы уровня 2.Увеличение темноты в градациях серого соответствует более высокому расчетному относительному содержанию.

    https://doi.org/10.1371/journal.pbio.0050177.g003

    Основными измерениями различий между профилями колонизации различных таксономических групп были время колонизации и временная стабильность. В соответствии с предыдущими исследованиями [28,35,43,44], первыми колонизаторами часто были организмы, которые, как предполагалось, были аэробами (например, Staphylococcus, Streptococcus, и Enterobacteria), тогда как более поздние колонизаторы, как правило, были анаэробами (Eubacteria и Clostridia) . Бактероиды сильно различались от ребенка к ребенку по времени своего первого появления, но в некоторой степени постоянно присутствовали почти у всех младенцев к 1 году. Несколько других таксонов, в том числе Prevotella, Acinetobacter, Desulfovibrio, Veillonella, и Clostridium perfringens, , как правило, появлялись временно, иногда появляясь и исчезая повторно в течение первого года жизни ребенка.

    Сходства и различия между профилями населения

    Мы исследовали сходства и различия в составе всех наших выборок путем иерархической кластеризации 430 выборок на основе их сходства в отношении их профилей численности для набора из 53 таксономических групп prokMSA уровня 4, которые имели как минимум две выборки с относительной оценка численности более 1%.Схема кластеризации, отраженная в дендрограмме в верхней части рисунка 4, выделяет несколько важных особенностей программы колонизации и показывает, что микробиота стула детей в возрасте 1 года и старше заметно отличается от таковой в более раннем возрасте и намного больше. похож на взрослых. До 6 мес. Образцы стула имели тенденцию группироваться по каждому ребенку, что указывает на то, что различия от ребенка к ребенку намного больше, чем изменения в течение недель или месяцев в составе микробиоты любого отдельного ребенка.Было два заметных исключения из этой кластеризации, ориентированной на ребенка. Во-первых, образцы первых нескольких дней жизни часто сгруппированы вдали от остальных образцов данного ребенка, иногда сгруппировавшись с другими очень ранними образцами, а иногда с образцами из других мест (например, ребенок 8-го дня 1 с образцами из влагалища). Во-вторых, образцы от младенцев 13 и 14, которые являются разнояйцевыми близнецами, имели тенденцию смешиваться. На рисунке 4B показаны примеры нескольких описанных выше шаблонов кластеризации.

    Рисунок 4.Кластеризация выборок на основе профилей популяций наиболее распространенных и многочисленных таксонов

    (A) Каждый столбец ( n = 430) представляет один биологический образец, а каждая строка ( n = 52) представляет одну таксономическую группу или вид 4 уровня. для двух или более образцов оценки относительной численности превышали 1%. Представлены все образцы, включая образцы стула от младенцев, родителей и братьев и сестер, а также образцы молока и влагалища. Образцы были сгруппированы с помощью центрированной корреляции Пирсона, так что столбцы, представляющие наиболее похожие образцы, сгруппированы вместе, тогда как таксономические группы (строки) сортируются численно, а не кластеризоваться.Увеличение темноты в градациях серого соответствует более высокому расчетному относительному содержанию. Значения log 2 относительной численности.

    (B) Отобранные кластеры, иллюстрирующие, что (1) профили из образцов стула раннего ребенка группируются по младенцу, (2) образцы стула очень раннего ребенка объединяются с образцами матери и (3) образцы из пары разнояйцевых близнецов группируются вместе и смешиваются.

    https://doi.org/10.1371/journal.pbio.0050177.g004

    Большинство образцов грудного молока и материнского влагалища идеально сгруппированы по анатомическим участкам происхождения.Как и ожидалось, во всех вагинальных образцах, кроме одного, преобладали лактобациллы, включая Staphylococci , Bacteroides, Clostridia и Veillonella среди групп, которые в разной степени присутствовали как составляющие меньшинства. Влагалищный образец от одной из матерей (матери ребенка 11) имел отчетливо иной профиль популяции, в котором преобладали представители группы гамма-протеобактерий. Популяции микробов, обнаруженные в образцах молока, были разнообразными, часто включая смеси кишечных бактерий и виды Bacteroides, Pseudomonas, Haemophilus, Veillonella, и Streptococcus .

    Для более систематического сравнения младенцев мы определили выборку ближайших соседей для каждой выборки, измеренную с помощью корреляции Пирсона оценок относительной численности уровня 4. Используя эту метрику, выборка ближайшего соседа любой данной выборки ребенка обычно была другой выборкой от того же ребенка - средний процент выборки от данного ребенка, для которого наиболее похожая выборка была от того же ребенка, составляла 82%. Рисунок 5 суммирует этот анализ и иллюстрирует интересный вывод о том, что по этому показателю наиболее похожей парой младенцев были младенцы 13 и 14 лет - разнояйцевые близнецы, воспитанные в одной и той же среде - 8 из 23 (35%) ближайших младенцев 13 лет. - образцы соседей были взяты от ребенка 14 (следующей наиболее похожей парой были дети 11 и 14 лет - 17%).

    Рис. 5. Сходство микробиоты у младенцев

    Для каждой пары образцов мы рассчитали образцы ближайшего соседа в соответствии с корреляцией Пирсона профилей относительной численности уровня 4. Затем для каждого ребенка мы вычислили, какой процент выборок ближайших соседей был получен от каждого ребенка. Оттенок серого указывает процент образцов из детского Y (столбец), которые были ближайшими соседями образцов из детского X (строка), так что суммы строк составляют 100%.

    https: // doi.org / 10.1371 / journal.pbio.0050177.g005

    Временные тенденции

    Сходство профилей микробных сообществ в образцах стула младенцев в возрасте 1 года и старше друг с другом и с профилями стула взрослых предполагает, что сообщества желудочно-кишечного тракта младенцев со временем сошлись на обобщенной «взрослой» микробиоте. Мы исследовали этот феномен, вычислив для каждого возрастного интервала среднюю попарную корреляцию Пирсона популяционных профилей всех выборок младенцев, собранных в этом возрасте.Как показано на рис. 6А, этот анализ показал, что с течением времени микробиота младенцев постоянно приближалась к общему профилю. Мы также рассчитали для каждой временной точки среднюю корреляцию выборок младенцев в этот момент времени с обобщенным профилем взрослого (центроид 18 выборок взрослых - девять отцов и девять матерей из этого исследования). Этот анализ, показанный на рисунке 6B, подтвердил, что профиль, к которому сходится микробиота младенцев, аналогичен профилю взрослых, и выявил очевидную тенденцию к перегруппировке популяции, которая происходит примерно через 5 дней после рождения.Примечательно, что микробиота желудочно-кишечного тракта младенцев не была значительно больше похожа на микробиоту их родителей, чем на микробиоту других взрослых, если судить по корреляциям Пирсона их таксономических профилей уровня 4 (средняя корреляция ребенок-родитель 0,55 для внутри семьи по сравнению с 0,62. между семьями для девяти «триад» одновременно полученных образцов от ребенка, матери и отца, полученных в возрасте 1–1,5 года).

    Рис. 6. Временные паттерны среднего попарного сходства профилей микробиоты детского стула

    (A) Сходство между младенцами во времени.Для каждой временной точки, для которой было профилировано не менее шести младенцев, мы вычисляли среднюю попарную корреляцию Пирсона между таксономическими профилями уровня 4 всех младенцев в этот момент времени. Также показана средняя парная корреляция Пирсона между этими профилями у 18 взрослых участников этого исследования (девять мужчин и девять женщин) (пустой кружок обозначен стрелкой).

    (B) Переход к взрослой флоре с течением времени. Для каждой временной точки, для которой был составлен профиль по крайней мере четырех младенцев, мы рассчитали среднюю корреляцию Пирсона между таксономическими профилями уровня 4 всех младенцев в этот момент времени и «общим взрослым» профилем.Общий профиль взрослого - это центроид 18 взрослых (девять мужчин и девять женщин) (родители в этом исследовании).

    https://doi.org/10.1371/journal.pbio.0050177.g006

    Чтобы визуализировать временные закономерности в определенных филогенетических группах, населяющих кишечник младенца, мы составили график относительной численности девяти таксономических групп уровня 4, которые имели средняя относительная численность 1% или более с течением времени у каждого младенца (рис. 7). Этот анализ позволил нам выявить общие темы и интересные различия между профилями колонизации этих младенцев.Во-первых, мы заметили, что «неравномерные» популяции (популяции, в которых преобладает одна таксономическая группа) были обычными в первые несколько недель, но редко в более поздние сроки. Другой примечательной особенностью временной программы многих младенцев было возникновение одного или нескольких резких сдвигов в структуре популяции - такие сдвиги часто стабилизировались в пределах одного интервала выборки. Нам не удалось идентифицировать какой-либо конкретный возраст или сигнальное событие, постоянно связанное с такими переходами, хотя переход к «взрослому» профилю часто сопровождал введение твердой пищи.

    Рис. 7. Временные профили наиболее обильных таксономических групп уровня 3

    Таксономические группы уровня 3 были выбраны для отображения, если их средняя (нормализованная) относительная численность по всем образцам детенышей превышала 1%. Ось x показывает дни с момента рождения и отображается в логарифмической шкале, а ось x показывает оценочную (нормализованную) относительную численность. Для некоторых младенцев значения для первых нескольких дней не отображаются, поскольку общее количество бактерий в образцах стула, собранных в эти дни, было недостаточным для анализа на основе микрочипов.

    https://doi.org/10.1371/journal.pbio.0050177.g007

    Несколько младенцев получали антибиотики либо в неонатальный период (дни 0–28), либо в более поздние месяцы (см. Таблицу 1 и Рисунок 2). Больше подробностей). В некоторых случаях лечение было связано с резким изменением плотности или состава микробиоты желудочно-кишечного тракта. Например, ребенок 8 получил два курса амоксициллина: один в 4 месяца и один в 6 месяцев. В обоих случаях как общая плотность бактерий (Рисунок 2), так и состав сообщества резко изменились (Рисунки 3 и 6).Действительно, у этого ребенка плотность бактерий в образцах кала снизилась настолько во время курсов антибиотиков, что мы не смогли амплифицировать достаточное количество рДНК SSU для анализа микрочипов, поэтому мы могли сравнивать популяции только до и после курса антибиотиков. Однако мы не выявили каких-либо устойчивых последствий лечения антибиотиками.

    Эксперименты по валидации микрочипов

    Результаты как анализа последовательности эталонного пула, так и анализа данных микроматрицы показали, что бифидобактерии были лишь второстепенными компонентами популяции - результат расходится с общепринятым мнением [20,21,26].Праймеры, которые мы использовали для широкой ПЦР-амплификации контрольного пула (источник последовательностей), и образцы для анализа микрочипов были потенциально неоптимальными для амплификации Bifidobacteria [21,26] из-за трех несовпадений в последовательности рДНК Bifidobacterium longum и прямой праймер 8F, использованный в этом исследовании. Обзор 5'-последовательностей полноразмерных генов рДНК SSU показал, что бифидобактерии сильно отличаются от обычно консервативной последовательности праймера 8F. Поэтому мы провели два независимых анализа, чтобы определить, нужно ли и каким образом корректировать количественные оценки бифидобактерий по результатам гибридизации микрочипов.Во-первых, мы количественно оценили относительную эффективность, с которой пара праймеров 8F / 1391R амплифицировала рДНК SSU из двух видов Bifidobacterium longum - Bifidobacterium longum и Bifidobacterium infantis - по сравнению с набором из трех различных распространенных фекальных бактерий - Escherichia coli, Clostridium perfringens, Bacteroides fragilis - все они имеют последовательности рДНК SSU с одним или несколькими несовпадениями с последовательностями праймеров 8F / 1391R ПЦР. Используя ряд стехиометрических смесей хромосомной ДНК, выделенных из этих видов, мы обнаружили, что после 20 циклов (количество циклов, использованных для наших анализов микроматриц и для амплификации контрольного пула перед секвенированием) эффективность амплификации двух видов бифидобактерий ДНК была в 8 раз ниже, чем у трех других видов, все из которых амплифицировались с почти одинаковой эффективностью (неопубликованные данные).Этот результат предполагает, что как результаты секвенирования контрольного пула, так и количественный анализ на основе микрочипов занижали численность группы бифидобактерий в восемь раз. Во-вторых, мы использовали анализ кПЦР в реальном времени с парой праймеров и зондом, оптимизированными для обнаружения бифидобактерий, чтобы получить независимую оценку численности бифидобактерий в каждом образце. Результаты подтвердили вывод микроматричного анализа о том, что бифидобактерии почти всегда были лишь второстепенными составляющими фекальной микробиоты как младенцев, так и взрослых в нашей исследуемой популяции (набор данных S5 и рисунок S1).

    Большинство видов бактерий, идентифицированных в нашем наборе образцов, ранее входили в состав микробиоты желудочно-кишечного тракта человека. Однако был ряд случаев, в которых результаты микроматрицы указывали на присутствие вида или группы бактерий, которые были неожиданными и не представлены в нашем пуле секвенированных эталонов. Мы исследовали несколько из этих случаев с помощью независимых тестов. Для 12 подозрительных видов / таксонов мы использовали родственные группоспецифичные праймеры в ПЦР-анализе, примененном к большинству или всем образцам, в которых подозреваемые виды / таксоны, по-видимому, присутствовали на основании результатов микроматрицы, а также небольшой набор образцов, в которых подозрительные виды не были обнаружены микрочипом.В одном случае, в случае Sutterella wadsworthia, секвенирование видоспецифичного продукта ПЦР подтвердило его присутствие. В семи из 12 случаев ни один из массивов положительных (или отрицательных) образцов не дал амплифицированного продукта при анализе ПЦР. Для четырех оставшихся случаев анализ якобы видоспецифической ПЦР дал амплифицированный продукт ожидаемого размера, но клоны, секвенированные из этого продукта, не соответствовали ожидаемым видам. Мы дополнительно исследовали эти четыре случая путем секвенирования библиотеки клонов, полученной путем амплификации с теми же праймерами широкого диапазона, которые использовались при подготовке к анализу микрочипов.Хотя секвенирование не подтвердило присутствие какого-либо из четырех сомнительных видов / таксонов, оно предоставило убедительные доказательства основного источника ложноположительных сигналов гибридизации. В частности, в трех из четырех случаев мы идентифицировали относительно многочисленные виды, чья последовательность рДНК была достаточно похожа на последовательность зонда, что, вероятно, объясняло наблюдаемый сигнал. В одном случае (Legionella pneumophila), , присутствие которых прогнозировалось приблизительно в 1%, мы не смогли идентифицировать какие-либо виды-кандидаты, которые могли бы объяснить сигнал гибридизации (т.е.е., ни один с лучшими совпадениями BLAST ≥30 баллов) среди нашего набора из 192 последовательностей. Поскольку наша способность обнаруживать виды, присутствующие с частичной численностью 1%, составляла только 85%, остается возможным, что этот вид или другой вид со сходной последовательностью рДНК SSU мог присутствовать в небольшом количестве в подозрительных образцах.

    Обнаружение и количественная оценка грибов и архей

    Наши методы экстракции ДНК и амплификации рДНК были оптимизированы для бактерий и неоптимальны для эукариот и архей, поэтому мы отдельно проверили наличие и численность грибов или архей с помощью анализов кПЦР с широкой специфичностью для соответствующих таксономических групп.На основании нашего анализа количественной ПЦР, грибки периодически обнаруживались в образцах стула при относительно низкой численности (10 4 –10 6 генов рРНК / г сырой массы фекалий), сохраняющихся в течение различной продолжительности у отдельных детей в течение первого года жизни. . У одного из детей в этом исследовании (ребенок 10) была отмечена сыпь от подгузников, а также молочница во рту, которые обычно вызываются грибком (Candida), и лечились противогрибковыми препаратами (нистатин). ). Анализ qPCR обнаружил особенно высокие уровни грибковой рДНК в образцах стула этого ребенка, особенно в тот период, когда были описаны эти результаты.У матери этого ребенка также были заметно высокие уровни грибковых последовательностей рДНК SSU в пренатальном образце вагинального мазка, но не в образце стула «нулевого дня».

    Распространенность архей была значительно ниже и более вариабельна, чем распространенность грибов или бактерий; Анализ qPCR обнаружил гены архейной рРНК (в диапазоне 10 3 –10 6 генов рРНК / г) только у семи младенцев в течение первого года жизни, а у четырех из этих младенцев они были обнаружены только у одного образец.У этих младенцев археи появлялись временно и почти исключительно в первые несколько недель жизни; они были обнаружены только у одного младенца после пятой недели жизни. Ограниченный анализ последовательностей архей, амплифицированных из трех образцов стула матери, которые дали положительный результат на археи (матери 4, 9 и 12), выявил преобладание Methanobrevibacter smithii (идентифицировано 7/8 архейных клонов, включая по крайней мере по одному клону от каждой матери), с одним дополнительным (некультурным) архейным филотипом.Результаты анализа количественной ПЦР грибов и архей включены в набор данных S5 и показаны графически вместе с результатами количественной ПЦР бактерий на Фигуре S2.

    Обсуждение

    Микробная колонизация желудочно-кишечного тракта младенца - примечательный эпизод в жизненном цикле человека. Каждый раз, когда рождается человеческий ребенок, из стерильной среды развивается богатая и динамичная экосистема. В считанные дни микробные иммигранты создают процветающее сообщество, население которого вскоре превосходит численность собственных клеток ребенка.Эволюционно древний симбиоз между желудочно-кишечным трактом человека и его резидентной микробиотой, несомненно, включает в себя разнообразные взаимные взаимодействия между микробиотой и хозяином, что имеет важные последствия для здоровья и физиологии человека. Эти взаимодействия могут иметь полезные пищевые, иммунологические эффекты и эффекты развития или патогенные эффекты для хозяина [2,5,7,18,45].

    Это исследование началось с разработки микрочипа ДНК с почти полным охватом бактериальных таксонов, представленных в доступной базе данных последовательностей генов SSU рРНК.Наш дизайн микроматрицы и экспериментальные методы были основаны на уроках, извлеченных при валидации менее полной микроматрицы SSU рДНК [46]. Эти предыдущие эксперименты позволили нам оптимизировать наши методы для компьютерного прогнозирования поведения гибридизации SSU рДНК и разработать экспериментальный протокол, который максимизировал специфичность гибридизации. Превосходное согласование измерений отдельных таксонов, определенных с использованием нового дизайна микрочипов, по сравнению с результатами секвенирования из соответствующих библиотек клонов рДНК SSU (рисунок 1) предполагает, что эти принципы дизайна верны для этой платформы для множества таксонов и дают нам уверенность в том, что полнота и точность результатов, полученных с помощью нашего нового набора микрочипов.Однако важно отметить, что наши методы проектирования и анализа массивов несовершенны и все еще развиваются. Некоторые из неожиданных видов, которые, по прогнозам микроматрицы, должны присутствовать в одном или нескольких образцах, не могли быть подтверждены секвенированием. В большинстве этих случаев анализ последовательности исследуемых образцов показал, что перекрестная гибридизация на низком уровне высокоразвитых видов была ответственна за ложноположительный прогноз, результат, который будет приниматься во внимание в будущих раундах массива. дизайн и анализ.

    Мы использовали этот микрочип в подробном, систематическом и количественном исследовании бактериальной колонизации желудочно-кишечного тракта новорожденного человека. Мы использовали только что собранные образцы стула в качестве заменителей образцов, взятых из просвета и слизистой оболочки толстой кишки. Хотя, несомненно, существуют различия в популяционных профилях образцов кала и соответствующих слизистых оболочек, в предыдущем исследовании мы обнаружили, что профили, тем не менее, удивительно согласованы - достаточно, чтобы отдельные образцы стула можно было легко сопоставить с образцами биопсии толстой кишки от одного и того же человека на основе на сходство их бактериальных профилей [15,46].Таким образом, мы полагаем, что результаты нашего временного анализа бактериальных популяций в образцах детского стула предоставляют полезное окно для анализа резидентной микробиоты толстой кишки.

    Принимая во внимание важность симбиоза между человеческим хозяином и кишечными комменсалами как для человека-хозяина, так и для микробного колониста, было бы легко представить, что программа микробной колонизации желудочно-кишечного тракта новорожденных развивалась под сильным избирательным давлением, воздействуя на как кишечная ниша, так и ее микробные колонисты должны быть сильно детерминированными и стереотипными.Мы могли ожидать, что весьма ограниченная группа совместно эволюционирующих комменсалов будет исключительно хорошо адаптирована к этой среде и будет последовательно доминировать в процессе колонизации стереотипным образом. Действительно, бактерии, которые мы обнаружили в кале младенцев и взрослых, предположительно отражающие микробиоту толстой кишки, были в значительной степени ограничены лишь небольшой подгруппой бактериального мира - Proteobacteria, Bacteroides, Firmicutes, Actinobacteria и Verrucomicrobia. Тем не менее, к удивлению, мы обнаружили, что в первые дни или месяцы жизни микробиота кишечника младенца и временная структура, в которой она развивается, заметно варьируются от человека к человеку.Казалось бы, хаотичное развитие ранних событий колонизации и сходство бактериального состава некоторых ранних младенческих образцов с грудным молоком или вагинальными мазками позволяет предположить, что бактериальная популяция, которая развивается на начальных стадиях, в значительной степени определяется конкретными бактериями. которому случайно подвергается ребенок. Примечательно, что эти материнские «сигнатуры» не сохранялись бесконечно, о чем свидетельствует наша неспособность найти значительно более высокую корреляцию общих таксономических профилей пар ребенок / родитель из одного и того же домохозяйства по сравнению с разными домохозяйствами.

    Важным исключением из рассказа об индивидуальности и уникальности ранних профилей было поразительное сходство временных профилей разнояйцевых близнецов (младенцев 13 и 14) (Рисунки 4 и 5). Эти близнецы имели как общую среду обитания, так и примерно 50% генетической идентичности, что делает невозможным определение из этого исследования, в какой степени каждая из этих общих черт ответственна за их сходные модели колонизации. Однако данные этого и других исследований свидетельствуют о том, что общая среда является основным фактором.Одним из аргументов в пользу этой точки зрения является отсутствие сопоставимого сходства в микробных сообществах других пар, которые также имеют 50% генетической идентичности, включая мать: ребенок, отец: ребенок и брат / сестра: ребенок (неопубликованные данные), хотя это несходство может отчасти из-за разных стадий их развития. Еще один аргумент в пользу сильного влияния окружающей среды - это случайное временное появление определенных организмов у обоих близнецов - трудно представить, что появление определенного микроба в определенный день может быть генетически запрограммировано.Наш последний аргумент основан на доказательствах из предыдущего исследования, что микробиота генетически эквивалентных семей от скрещивания инбредных мышей была более похожей среди членов одного и того же «домохозяйства» (мать и потомство, живущие в одной клетке), чем между домохозяйствами [1].

    Определение «здоровой» кишечной микробиоты охватывает удивительное разнообразие профилей сообщества в первые 6 месяцев жизни. Хотя в первые месяцы эти микробные сообщества были разнообразными и своеобразными, они постепенно становились все более похожими друг на друга (рис. 6А), приближаясь к общему профилю, подобному взрослому (рис. 6В), характеризующемуся преобладанием Bacteroides и Firmicutes, часто встречающимся Веррукомикробия и очень низкая численность протеобактерий и аэробных грамотрицательных бактерий в целом.Мы предполагаем, что самые ранние события колонизации в значительной степени определяются условно-патогенной колонизацией бактериями, которым ребенок подвергается в окружающей среде. Общие воздействия окружающей среды, вероятно, включают микробиоту влагалища, фекалий или кожи матери, о чем свидетельствует наблюдаемое сходство микробиоты раннего стула у некоторых младенцев с этими образцами, что согласуется с предыдущими доказательствами вертикальной передачи микробов [33,47 , 48]. Таким образом, разнообразие и вариативность отражают соответствующую индивидуальность этих случайных воздействий.Однако со временем преимущество пригодности таксонов, которые обычно доминируют в микробиоте толстой кишки взрослых особей, по-видимому, преодолевает первоначальное преимущество оппортунистов, колонизирующих на ранней стадии и менее приспособленных к кишечной среде. Кроме того, прогрессирующие изменения в кишечной среде, обусловленные внутренними изменениями слизистой оболочки кишечника, переходом на «взрослую» диету и влиянием самой микробиоты [44,49–51], могут требовать все более строгого отбора для наиболее адаптированные бактерии.Таким образом, несмотря на неожиданно хаотичные первые месяцы жизни, становление экосистемы кишечника у младенцев, в конце концов, следует консервативной традиционной программе.

    Трансформация кишечной микробиоты по образцу взрослого неявно включала замену видов, обнаруживаемых у младенцев, но редко у взрослых, видами, характерными для толстой кишки взрослых. Одной из потенциальных движущих сил таких демографических изменений может быть то, что взрослые члены сообщества в конечном итоге доминируют в силу их большей способности устойчиво и необратимо утвердиться после колонизации хозяина.Мы искали доказательства этой дифференциальной «липкости», сравнивая автокорреляцию во времени численности каждого «вида» (см. Материалы и методы). Мы не нашли четких доказательств того, что виды, характерные для взрослой микробиоты, смогли установить более стабильную по своей природе колонизацию, чем виды, характерные для детской микробиоты.

    Мы и другие обнаружили, что индивидуально-специфические характеристики бактериальной микробиоты взрослых стабильны в том смысле, что они остаются более схожими у одного человека с течением времени, чем между отдельными людьми, в течение периода в год или более, и одного из поразительными результатами этого исследования было выявление относительно стабильных, индивидуальных особенностей бактериальной колонизации даже в первые недели и месяцы жизни.Эти наблюдения открыли интересную возможность того, что события оппортунистической колонизации в раннем младенчестве могут играть значительную роль в определении различных характеристик микробиоты одного и того же человека во взрослой жизни. Мы искали доказательства этого, сравнивая внутрииндивидуальные и межиндивидуальные корреляции бактериальных профилей через 1 или 2 мес. И 1 год, и не обнаружили существенной разницы (неопубликованные данные). Таким образом, хотя эти результаты, безусловно, не исключают возможности того, что события ранней колонизации играют важную роль в определении взрослой микробиоты, не похоже, что между ними существует сильная прямая корреляция.

    Наши результаты и выводы значительно отличаются от многих предыдущих отчетов по нескольким аспектам. Одним из заметных расхождений между нашими исследованиями и многими другими была относительно низкая частота и численность бифидобактерий в фекальной микробиоте в любом возрасте от рождения до взрослого возраста. Бифидобактериям уделялось непропорционально большое внимание, отчасти из-за их предполагаемых положительных эффектов, и во многих исследованиях сообщалось (и повторялись обзоры), что в микробиоте грудных детей преобладают бифидобактерии [17–19].Таким образом, мы были удивлены и поначалу скептически относились к очевидной малочисленности бифидобактерий почти во всех наших образцах и предприняли шаги для проверки точности наших результатов. Специфическая кПЦР для бифидобактерий подтвердила вывод, сделанный на основе результатов нашего микроматрицы, что бифидобактерии редко были основными составляющими микробиоты ЖКТ, по крайней мере, в этой исследуемой популяции, и что у большинства младенцев они появлялись только через несколько месяцев после рождения, а затем сохранялись как меньшинство населения.Хотя можно предположить, что существуют географические или демографические различия в распространенности бифидобактерий, мы подозреваем, что акцент на бифидобактерии в исследованиях и обзорах микробиоты желудочно-кишечного тракта младенцев может быть непропорциональным его распространенности, численности и значимости для здоровья.

    Представленные здесь результаты указывают на многочисленные направления будущих исследований. Интересной особенностью динамики бактериальной популяции было появление резких сдвигов, перемежающих интервалы относительной стабильности.За исключением одного случая (лечение антибиотиками ребенка 8 лет), мы не смогли легко определить сильного кандидата в причину наблюдаемых нами сдвигов. Некоторые возможности включают вспышки бактериофагов, которые могут выборочно уничтожить доминирующую таксономическую группу [52]; случайное, условно-патогенное вторжение в метаболическую или анатомическую нишу более приспособленным видом; и тонкие изменения кишечной среды, вызванные развитием или диетой, нарушают физический баланс населения. Другими важными направлениями будущих исследований будут сравнение состава и эволюции микробных сообществ, встречающихся у этих здоровых детей, с сообществами недоношенных или других нездоровых детей, а также изучение влияния антибиотиков, диеты и способов родоразрешения на их развитие и эволюцию. сообщества.Несмотря на то, что здоровые дети в этом исследовании предполагали широкий диапазон профилей микробного сообщества, они были схожи в нескольких отношениях, в первую очередь в основных способствующих типах, в приобретении определенных ключевых типов с течением времени и в относительной стабильности их профилей. со временем. Возможно, что при других состояниях здоровья или болезни мы найдем либо виды или группы, которые являются новыми для этой среды, либо необычные комбинации этого недавно определенного набора «обычных» видов.

    Важно отметить, что хотя мы показали, что микробиота кишечника становится все более стереотипной в течение первого года, четко установлено, что устойчивые межиндивидуальные различия сохраняются даже у взрослых [15,16].Когда и как развиваются эти стабильные «внутренние» характеристики микробиоты каждого человека? Как долго они сохраняются? Как различная стабильность колонизации разными бактериями связана с их микроанатомическими (например, крипта против ворсинок против слизистого слоя) или метаболическими нишами? Выявление экологических и генетических факторов, которые определяют отличительные характеристики микробиоты каждого человека, а также определение того, влияют ли эти индивидуальные особенности на физиологию и здоровье хозяина и каким образом, будет важной целью будущих исследований, в которых микроматрица, описанная в этом исследовании, будет быть полезным инструментом.

    Материалы и методы

    Разработка и производство микрочипов.

    Микроматрица содержала 10 500 ДНК-зондов (10265 уникальных последовательностей). Зонды включали 1379 контрольных зондов (1144 уникальных последовательностей) и 9121 уникальных таксономически специфичных зонда (5938 зондов на групповом уровне и 3183 зондов на уровне видов), состоящих из 40-нуклеотидных (нуклеотидных) последовательностей, полученных из генов SSU рРНК, и выбранных для их специфичность к соответствующему виду или таксономической группе. Основные принципы проектирования подробно описаны в предыдущем отчете [46].Дизайн был основан на базе данных последовательностей рДНК prokMSA SSU 2004 года и филогенетическом дереве [38], содержащем 86 453 прокариотических последовательностей рДНК SSU (5 672 архей и 80 781 бактериальных), организованных в 672 архейных и 15 765 бактериальных ОТЕ. OTU были определены в prokMSA как группы последовательностей с баллами идентичности (как определено в [38]) выше 95% или 98% (в определенных родах, имеющих медицинское значение). Мы дистиллировали эту базу данных, выбрав одну высококачественную последовательность, репрезентативную для каждой OTU, и урезали последовательности до областей, амплифицированных универсальными бактериями (Bact-8F: 5'-AGAGTTTGATCCTGGCTCAG-3 '[53] + 1391R: 5'- GACGGGCGGTGTGTRCA-3 '[54]) или архейный (Arch444 [55] / 1391R) праймеры.OTU в нашей сокращенной базе данных prokMSA были организованы в 945 (53 архейных + 892 бактериальных) таксономических групп (узлов), содержащих несколько OTU, и 92 отдельных «узла» OTU.

    Номенклатура базы данных была такова, что каждая OTU была обозначена числовым кодом, который указывал на ее таксономию prokMSA, например, вид «1.2.3.4.5.6.007» принадлежит к суперкоролевству 1, типу 1.2, классу 1.2.3, порядку 1.2. .3.4, семейство 1.2.3.4.5, род 1.2.3.4.5.6. В этой рукописи таксономические уровни упоминаются в соответствии с их глубиной в коде OTU, т.е.g., вид «1.2.3.4.5.6» принадлежит к группе с более широким охватом «1» на уровне 1 и к группе с меньшим охватом «1.2.3.4: на уровне 4».

    Мы сгенерировали большой набор зондов-кандидатов, используя BLAST [56], чтобы предсказать возможность гибридизации перекрывающихся последовательностей из 40 нуклеотидов из каждой OTU в нашей базе данных дистиллированных последовательностей с каждой из других OTU в базе данных (путем разбиения каждой последовательности с окном на два). Последовательность считалась зондом-кандидатом для конкретной таксономической группы, если предсказывалось, что она гибридизуется по крайней мере с 10% членов этой группы, а не с какими-либо членами, не входящими в группу, с использованием эмпирически определенного порога 28 из 40 совпадений BLAST - несовпадения (общее количество нуклеотидов за вычетом несовпадений соответствует лучшему совпадению BLAST для данной последовательности рДНК) в качестве предельного значения для потенциальной гибридизации [46].Из полученного набора зондов-кандидатов мы выбрали для каждого узла / таксономической группы два зонда, которые, по прогнозам, гибридизуются с наибольшей частью этой группы. Мы также выбрали зонды из нашего набора кандидатов таким образом, чтобы каждая OTU в нашей дистиллированной базе данных была представлена ​​зондами на максимально возможном количестве таксономических уровней. Из-за нехватки места в массиве мы не смогли напечатать видоспецифичные зонды для каждой OTU в нашей базе данных. Вместо этого мы дополнили набор зондов на уровне группы, разработанных, как описано выше, тремя дополнительными наборами зондов.Во-первых, мы составили список видов бактерий, которые были либо релевантными с медицинской точки зрения, либо известными человеческими комменсалами. Мы определили коды prokMSA для каждого из этих видов и протестировали выбранную последовательность из этой OTU для видоспецифичных 40-нуклеиновых последовательностей, как определено баллом совпадения-несоответствия BLAST не более 27 для любой другой последовательности. Мы также оценили видоспецифичные зонды из нашего предыдущего дизайна массива [46] в контексте базы данных prokMSA и включили 467 таких видоспецифичных зондов, представляющих 286 видов.Последней категорией таксономических зондов были зонды «новые OTU» - 316 зондов, разработанные для представления недавно открытых «видов» рДНК SSU, которые были идентифицированы в исследованиях толстой кишки [15] или желудка [57] взрослого человека (новые OTU были определены ограничение идентичности 99%, как описано в исходных исследованиях). Наконец, наш дизайн микрочипа включал 1153 контрольных зонда - положительных и отрицательных - предназначенных для нормализации и систематического изучения гибридизационного поведения. Отрицательные контроли включали как последовательности, не относящиеся к рДНК, так и последовательности рДНК обратного комплемента, тогда как положительные контроли включали последовательности праймеров и несколько наборов перекрывающихся зондов, охватывающих полные гены SSU рРНК бактерий, архей и эукариот.Прикрепленные к поверхности олигонуклеотидные зонды были синтезированы in situ, как описано ранее [58], с 10-нуклеотидным поли-Т линкером, используемым для связывания специфического 40-нуклеотидного ДНК-зонда (Agilent Technologies, http://www.chem.agilent.com ). Все наборы также включали 307 стандартных контрольных зондов Agilent. Все последовательности зондов и аннотации доступны в наборе данных S6.

    Покрытие массива.

    Наш набор микрочипов включает один или несколько группоспецифичных зондов для 649 из 950 таксономических групп в prokMSA и видоспецифических зондов для 1590 видов бактерий и 39 видов архей.Взятые вместе, эти зонды гарантировали, что 15 406 (94%) из 16 437 видов, представленных в базе данных prokMSA, имели по крайней мере один репрезентативный зонд на каком-то уровне дерева от типа к виду, а большинство видов prokMSA (74%) имели репрезентативные зонды на несколько таксономических уровней (в среднем 2,4 уровня на вид).

    Объекты исследования и сбор образцов.

    Тринадцать здоровых беременных женщин были набраны в Медицинском центре Стэнфордского университета. Все участники исследования, в том числе 14 младенцев (одна пара разнояйцевых близнецов), девять отцов, 13 матерей и двое братьев и сестер (в возрасте 1-2 лет) дали информированное согласие или получили согласие своих родителей.Дизайн исследования был одобрен административной комиссией Стэнфордского университета по медицинским исследованиям на людях. На 36–40 неделе беременности вагинальные мазки (Copan Diagnostics, http://www.copanusa.com) были получены от десяти из 13 матерей и немедленно заморожены при –20 ° C. После рождения родители брали образцы стула младенцев с помощью пробирок для сбора стула (Sarstedt, http://www.sarstedt.com/php/main.php), которые содержали ложку для стандартизированного сбора примерно 300 мг материала.Образцы детского стула были собраны в соответствии с предписанным графиком (таблица 1) и немедленно помещены в домашние морозильные камеры. Образец стула матери «нулевого дня» был взят в течение 0–5 дней после родов. Образцы стула были доставлены на льду в лабораторию для обработки через 2 недели, 3 месяца и 6 месяцев после рождения ребенка. Двенадцать матерей предоставили образцы грудного молока (~ 20 мл) через 3–9 месяцев после родов, а одна из них также предоставила грудное молоко через 6 дней после родов; эти образцы были собраны в пробирки на 50 мл и немедленно заморожены.Девять из исследуемых семей также предоставили образцы стула одновременно от матери, отца и ребенка через 12–17 месяцев после рождения ребенка. По прибытии в лабораторию все образцы были немедленно перенесены в морозильную камеру с температурой –80 ° C и хранились там до обработки. Всего было собрано 548 образцов, в том числе 471 образец стула у младенцев, 39 образцов стула от матерей, 9 образцов стула от отцов, 2 образца стула от братьев и сестер, 16 образцов грудного молока и 11 вагинальных мазков. Родителям было поручено вести дневник, фиксируя ключевые события в категориях болезней, лекарств, изменения диеты и путешествий.Таблица 2 содержит выбранную информацию для каждого ребенка (например, пол и способ родов).

    Экстракция ДНК и амплификация рДНК SSU.

    ДНК

    экстрагировали из образцов стула с помощью мини-набора QIAamp Stool DNA (Qiagen, http://www1.qiagen.com). Вагинальные мазки обрабатывали с использованием мини-набора QIAamp DNA (Qiagen). Образцы молока сначала концентрировали вращением 2 мл в микроцентрифуге в течение 10 мин при 5000 g, удаляя 1800 мкл супернатанта. Осадок ресуспендировали в 200 мкл оставшегося супернатанта, и ДНК экстрагировали с помощью мини-набора QIAamp DNA.Образцы обрабатывали партиями примерно по 16, и в каждый цикл включали несколько контрольных экстрактов для мониторинга загрязнения. Отношение образцов к контролю экстракции составляло 6,8 для стула, 2,8 для вагинальных мазков и 5,3 для молока.

    РДНК

    SSU была амплифицирована из экстрагированной ДНК с использованием бактериально-специфических праймеров широкого спектра действия Bact-8F (5'-AGAGTTTGATCCTGGCTCAG-3 ') [53] и T7-1391R (5'-AATTCTAATACGACTCACTATAGGGAGACGGGCGGTGTGTRCA-3) [46,5]. Эти праймеры амплифицируют приблизительно 90% или более полноразмерной бактериальной последовательности, кодирующей рРНК SSU, и обеспечивают промотор для РНК-полимеразы Т7.Смеси для ПЦР состояли из 1 × буфера II для ПЦР (Applied Biosystems, http://www.appliedbiosystems.com), 1,5 мМ MgCl 2 , 0,05% Triton X-100, 20 мМ хлорида тетраметиламмония, 2% диметилсульфоксида, 0,1 Концентрации мМ каждого дезоксирибонуклеозидтрифосфата, концентрации каждого праймера 0,4 мкМ, 2,5 ед. ДНК-полимеразы AmpliTaq (Applied Biosystems) и 5 ​​мкл экстрагированной ДНК в конечном объеме 50 мкл. Используемые условия ПЦР: 5 минут при 95 ° C, 20 циклов по 30 секунд при 94 ° C, 30 секунд при 55 ° C и 90 секунд при 72 ° C, затем 8 минут при 72 ° C.Амплификацию проводили с использованием системы ПЦР GeneAmp 9700 (Applied Biosystems). В случаях чрезвычайно низкого выхода объединяли несколько 20-цикловых реакций. Реакции ПЦР очищали в 96-луночном формате с использованием системы на основе шариков для очистки ПЦР с переключателем заряда Invitrogen (Invitrogen, http://www.invitrogen.com) и хранили при -20 ° C.

    Строительство эталонного бассейна.

    Нашим общим эталоном была эквимолярная смесь ампликонов рДНК SSU из каждого образца (детский или материнский стул, вагинальное или грудное молоко), собранных до того, как субъекту исполнился 1 год.Для создания эквимолярной смеси очищенные продукты ПЦР с 20 циклами количественно оценивали в 96-луночном формате с использованием набора дцДНК Quant-It PicoGreen (Molecular Probes, http://probes.invitrogen.com) и объединяли в равных количествах. Приблизительные доли рДНК SSU, полученной из стула, влагалища и молока, в полученном пуле составляли 90%, 5% и 5% соответственно. Этот пул ДНК использовали как в качестве матрицы для транскрипции in vitro (для гибридизации микроматриц), так и для конструирования библиотеки клонов SSU рДНК.

    Анализ последовательности и таксономическая классификация клонированных продуктов ПЦР рДНК.

    Контрольный пул (эквимолярная смесь ампликонов рДНК SSU из большинства образцов, описанных выше) клонировали и секвенировали, как описано ранее [15]. Мы получили 3458 высококачественных бактериальных последовательностей рДНК длиной более 800 нуклеотидов, включая 3163 двойных и 295 одиночных считываний. Эти последовательности были таксономически классифицированы с использованием классификатора Ribosomal Database Project (RDP) (обобщены в таблице 3).

    Мы также клонировали и секвенировали несколько сотен ампликонов рДНК SSU (среднее значение = 342; диапазон = 125–557 адекватных последовательностей) из каждого из 12 различных индивидуальных образцов одним и тем же способом, получив в общей сложности 4100 высококачественных последовательностей длиной более 800 nt.12 секвенированных образцов состояли из десяти образцов стула (день 11 от ребенка 2; день 1 от матери ребенка 3; неделя 12 от ребенка 3; месяц 6+ от ребенка 8; день 1 и день 2B от ребенка 10; день 12 от ребенка. 12; 7 месяц от ребенка 13; 7 месяц от матери близнецов: младенцев 13 и 14; и 7 месяц от ребенка 14), один образец молока от матери близнецов 13 и 14 и один образец из влагалища от матери близнецов 13 и 14.

    Каждая последовательность из этих 12 отдельных образцов была таксономически классифицирована в соответствии с таксономией prokMSA 2004 года [38] с использованием BLAST.В частности, мы использовали BLAST, чтобы найти последовательность с наибольшим количеством совпадений во всей базе данных prokMSA (также обрезанной до 8F и 1391R). Сообщали и сравнивали два самых популярных совпадения (совпадения с менее чем 600 совпадающими нуклеотидами не учитывались), и если эти два совпадения отображались на одну и ту же OTU, то последовательность классифицировалась по этой OTU. Если два самых популярных совпадения различались по таксономическому коду, то последовательность классифицируется только на самом конкретном уровне, разделяемом двумя лучшими совпадениями. В случаях, когда второй лучший результат был значительно хуже (соответствует 2-му / соответствует 1-му <0.9) учитывалось только лучшее попадание. Коды prokMSA OTU явно определяют таксономическую классификацию последовательности на всех филогенетических уровнях для всех 4100 высококачественных последовательностей «индивидуального образца».

    Мечение и гибридизация.

    Очищенные ампликоны рДНК SSU использовали в качестве матрицы для основанного на транскрипции синтеза амино-аллил-меченой одноцепочечной РНК с использованием набора для транскрипции MEGAScript T7 In Vitro (Ambion, http://www.ambion.com). Реакции транскрипции очищали в 96-луночном формате с использованием системы очистки Ambion MagMax RNA Purification и хранили при -20 ° C.Большие партии (5–10 мкг) эталонной РНК (эквимолярный пул всех образцов; см. Ниже) метили, используя сложный эфир Cy3 NHS, и хранили в течение нескольких недель для повторного использования. В день гибридизации 1 мкг каждого образца РНК метили, используя сложный эфир Cy5 NHS, как описано ранее [46]. Затем мы объединили 100 нг Cy5-меченного образца и 100 нг Cy3-меченного контрольного пула в объеме 48 мкл (в воде, свободной от нуклеаз). Затем мы добавили 2 мкл 25-кратного буфера для фрагментации Agilent и фрагментировали РНК путем нагревания при 70 ° C в течение 30 минут перед остановкой реакции, поместив ее на лед и добавив 50 мкл 2-кратного буфера для гибридизации Agilent.Непосредственно перед гибридизацией мы нагревали реакционную смесь до 95 ° C в течение 5 минут, затем охлаждали на льду перед добавлением 120 мкл 1 × гибридизационного буфера к 100 мкл фрагментированной меченой РНК и загружали 200 мкл этой смеси в камеру для гибридизации. (Agilent). Массивы гибридизовали при 60 ° C во вращающейся печи в течение 14–18 ч. Слайды промывали в 6 × SSC, 0,005% TritonX-102 в течение 5 минут при комнатной температуре, затем в 0,1 × SSC, 0,005% TritonX-102 в течение 5 минут и немедленно сканировали с использованием сканера Agilent DNA Microarray Scanner.Промывка и сканирование проводились в среде с низким содержанием озона [59].

    Нормализация данных микрочипа.

    Данные были извлечены из отсканированного изображения микрочипа с использованием самой последней версии программного обеспечения Agilent Feature Extraction (версии 7.1.1–8.1.1). Необработанные значения интенсивности флуоресценции Cy5 (или Cy3) за вычетом фона для каждого зонда были нормализованы путем деления значений Cy5 (или Cy3) на медианное значение Cy5 (или Cy3) универсального зонда «UNIV2» (расширенная версия 3 'ПЦР праймер 1391R: 5'-GTGGGGAGCGAACAGGATTAGATACCCTGGTAGTCCACGC-3 ') из соответствующего массива и умножение на 100.На этом этапе значения варьировались от 0,01 до примерно 100; значения выше 100 были редкими и возникали только тогда, когда флуоресцентный сигнал для определенного зонда был ярче, чем у универсального зонда. Нормализованные значения Cy5 были «декомпрессированы» следующей коррекцией: декомпрессированный Cy5 равен 10 в степени log 5 нормализованной интенсивности Cy5. Эта декомпрессия корректирует нелинейную связь сигналов гибридизации с относительной численностью целевых видов, которую мы наблюдали в серии экспериментов с серийным разведением, описанных в предыдущем отчете [46].В этих экспериментах мы обнаружили, что 10-кратное изменение численности переводится примерно в 5-кратное изменение соответствующей интенсивности флуоресценции. После этого преобразования расширенный диапазон значений составлял от 0,001 до приблизительно 700. Мы использовали BLAST для прогнозирования гибридизации каждой из 3458 общих эталонных последовательностей рДНК, превышающих 800 пар оснований, используя схему взвешивания, описанную ранее [46], так что зонд с идеальным соответствием каждой последовательности будет иметь ожидание 100%, а зонды с меньшим количеством совпадений или несовершенные совпадения с последовательностями в контрольном пуле будут иметь соответственно более низкие ожидаемые значения гибридизации.Затем мы рассчитали логарифмическое (наблюдаемое / ожидаемое) отношение для каждого зонда в контексте нашей объединенной эталонной смеси образцов и применили эти поправочные коэффициенты для конкретных зондов к разуплотненным значениям Cy5.

    Фильтрация микрочипов.

    Микроматричный анализ синтетических пулов определенного состава позволил нам идентифицировать плохо работающие зонды, которые затем были исключены из дальнейших анализов. Мы оценили эффективность зонда с использованием пяти синтетических пулов (четыре пула из шести уникальных продуктов ПЦР рДНК, один пул из 230 уникальных продуктов ПЦР рДНК [из [46]]) и одного биологического пула (общая ссылка, описанная выше), состав которых характеризовался следующим: глубокое секвенирование.Зонды со значениями интенсивности флуоресценции более 0,5% от интенсивности универсальных зондов, несмотря на отсутствие предсказанной гомологии последовательности (определяемой как значение совпадения-несовпадения BLAST менее 25 из возможных 40) с любым из видов в образце, были исключены. из последующих анализов. Мы также отбросили данные от зондов, которые имели наблюдаемую (декомпрессированную) интенсивность сигнала в 100 раз выше или ниже, чем ожидалось, в анализах биологического контрольного пула (как описано выше в разделе нормализации данных микрочипов).Оставшийся набор из 6381 зонда с хорошими характеристиками использовался во всех последующих анализах.

    Оценка численности таксономических групп.

    Для каждого образца мы получили оценку относительной численности каждой таксономической группы в нашем филогенетическом дереве с использованием алгоритма, который гарантирует, что ни один вид не вносит более одного вклада в оценку численности таксономической группы, и что нижележащие зонды (зонды, которые представляют отдельные подмножества видов, принадлежащих к этой филогенетической группе) включены в оценку совокупной численности группы.В частности, для каждой филогенетической группы в каждом образце мы отсортировали все находящиеся ниже по течению зонды в соответствии с их оценками относительной численности на основе микрочипов и рассчитали общую сумму оценок относительной численности всех неперекрывающихся зондов. В результате конкретные пробы, добавленные вместе для представления данной таксономической группы, варьировались в разных образцах, в зависимости от того, какие конкретные пробы имели наибольший сигнал гибридизации в этом образце.

    Сравнение данных микрочипа и последовательностей.

    Оценки относительной численности каждой группы prokMSA на каждом уровне таксономической иерархии в контрольном пуле и в 12 отдельных образцах, проанализированных с помощью секвенирования, были получены путем расчета доли последовательностей в соответствующей библиотеке рДНК, которые были назначены пользователя BLAST в эту группу. Эти основанные на последовательностях оценки численности были напрямую сравнены с оценками, полученными на основе данных микрочипа, как описано в предыдущем разделе.

    Автокорреляционный анализ.

    Мы использовали автокорреляции как способ измерения тенденции таксономической группы к сохранению после установления («прилипчивость»). Для данного временного ряда от времени a до времени b, мы вычислили корреляцию Пирсона для каждого дочернего вектора ( a + 1,…, b ) и вектора ( a, …, b - 1), представляющий логарифмические оценки (относительной численности). Автокорреляция каждой таксономической группы затем была принята как медианная автокорреляция для всех младенцев, для которых рассматриваемая таксономическая группа присутствовала хотя бы один раз (определяемая как численность> 0.1%) в рассматриваемом временном интервале. В нашем «липком» анализе мы выполнили этот анализ отдельно для двух разных наборов образцов, собранных с разными интервалами выборки, чтобы избежать смешивающего эффекта вариации в интервалах выборки: (1) образцы раз в неделю с 1 по 12 недель; и (2) ежемесячные пробы с 1 по 6 месяцев.

    Обнаружение последовательностей архей и грибов.

    Для скрининга последовательностей рДНК архей и грибов. мы сначала проверили пулы, включающие все извлеченные образцы ДНК от каждого ребенка (т.е., один пул на ребенка), все образцы стула родителей, все образцы из влагалища и все образцы молока, соответственно. Для каждого пула, дающего положительный результат, все образцы компонентов затем анализировались индивидуально. Для скрининга последовательностей рДНК архей мы использовали два набора специфичных для архей праймеров с широким спектром действия: A751F и U1406R [60]; и Arch433F (5'-TCCAGGCCCTACGGG-3 '[61]) и Arch958R (5'-YCCGGCGTTGAMTCCAATT-3' [62,63]). Для скрининга грибов мы использовали специфические для грибов праймеры широкого спектра действия 817F [64] и 1536R-rev (5'-AATRCAATGCTCTATCCCCA-3 ', адаптировано из [64]).Смеси для ПЦР были аналогичны тем, которые использовались для ПЦР с широким спектром бактерий, описанной выше, но со следующими изменениями: для ПЦР, специфичной для грибов, концентрация MgCl 2 была увеличена до 2 мМ, а BSA был добавлен в конечной концентрации. 1 мг / мл. В реакциях ПЦР, специфичных для грибов и архей, хлорид тетраметиламмония не добавляли, а добавляли 2 мкл объединенной ДНК с конечным объемом 50 мкл. Программа цикла состояла из 5 минут при 95 ° C, 35 циклов (30 секунд при 94 ° C, 30 секунд при 55 ° C и 30 секунд при 72 ° C), а затем 8 минут при 72 ° C.Реакции амплификации анализировали на агарозных гелях.

    Анализ смещения амплификации.

    Чтобы исследовать, могут ли несовпадения бактериальных праймеров влиять на амплификацию, ДНК была экстрагирована из пяти контрольных штаммов бактерий: Escherichia coli (клетки TOP10, Invitrogen), Clostridium perfringens (ATCC 13124), Bacteroides fragilis (ATCC 25285), Bifidobacterium longum. (ATCC 15707) и Bifidobacterium infantis (ATCC 15697) с использованием мини-набора QIAamp DNA.Концентрации ДНК измеряли с помощью УФ-спектрофотометра и корректировали для корректировки выхода ДНК, размера генома и количества копий гена рРНК SSU на геном для получения «нормализованных» ДНК, каждая из которых содержит одинаковое количество копий гена рРНК SSU на мкл. Бактериальную ДНК из лизатов амплифицировали индивидуально или парами с использованием праймеров 8F и T7-1391R, как описано выше, с использованием 20 или 35 циклов. Для парных реакций нормализованную ДНК Bifidobacterium longum смешивали с неразбавленными или серийными разведениями нормализованной ДНК из Escherichia coli, Clostridium perfringens, или Bacteroides fragilis.После амплификации смеси ПЦР очищали с использованием набора для очистки ПЦР QIAquick (Qiagen) и расщепляли с использованием набора рестрикционных ферментов, выбранных для различения двух продуктов ПЦР, полученных с парными видами. Расщепления анализировали на агарозных гелях для количественной оценки относительного количества продуктов ПЦР, представляющих Bifidobacterium longum и виды в группе сравнения, соответственно.

    Количественная ПЦР.

    Отдельный анализ кПЦР в реальном времени использовался для амплификации и количественного определения рДНК каждой из четырех микробных групп: все бактерии, бифидобактерии, все грибы и все археи.Тотальный бактериальный КПЦР выполняли с использованием смеси 10: 1 универсального прямого праймера 8FM (5'-AGAGTTTGATCMTGGCTCAG-3 ', адаптировано из [53]) и соответствующего прямого праймера 8FB для Bifidobacterium longum (5'-AGGGTTCGATTCTGGCTCAG-3', это исследование ), с обратным праймером Bact515R (5'-TTACCGCGGCKGCTGGCAC-3 ', адаптированным из [54]) и зондом TaqMan Bact338K (5'-FAM / CCAKACTCCTACGGGAGGCAGCAG / TAMRA-3', адаптированным из [65]). Мы дополнили универсальный бактериальный прямой праймер прямым праймером Bifidobacterium longum, потому что анализ последовательностей рДНК SSU показал, что эта группа была особой, поскольку она имела три несовпадения с нашим прямым праймером 8FM.Пилотные исследования показали, что эта смесь праймеров позволяет сравнимую амплификацию генов рРНК SSU из репрезентативных Bifidobacteria, Bacteroides, Enterobacteria и Clostridia. КПЦР рода Bifidobacterium выполняли с использованием праймеров Bif42F [26] и Bif164R (5'-CATCCGGCATTACCACCCGTT-3 ', адаптировано из [66]) и зонда Bif126_Taqman [26]. Тотальную количественную ПЦР грибов проводили с использованием праймеров ITS1F-F (5'-CTTGGTCATTTAGAGGAAGTAA-3 '[67]) и ITS4-R (5'-TCCTCCGCTTATTGATATGC-3' [68] и зонда TaqMan 5.8S (5'-FAM / CATTTCGCTGCGTTCTTCATCGATG / TAMRA-3 ', адаптировано из [68]. КПЦР архей выполняли с использованием праймеров Arch433F (5'-TCCAGGCCCTACGGG-3') [61] и Arch958R (5'-YCCGGCGTTCC) [63], и зонд 515F TaqMan (5'-FAM / GTGCCAGCMGCCGCGGTAA / TAMRA-3 ', адаптированный из [54]). Для всех анализов qPCR каждая 20-мкл реакционная смесь содержала 1 × мастер-микс TaqMan Universal PCR (Applied Biosystems) , 0,9 мкМ каждого праймера (0,09 мкМ праймера 8FB в общем бактериальном анализе), 0,2 мкМ зонда, 1 ед. ДНК-полимеразы AmpliTaq Gold (Applied Biosystems) и 2 мкл экстрагированной ДНК.Программа термоциклирования состояла из 95 ° C в течение 10 минут, за которыми следовали либо 40 циклов (анализы на бактерии и бифидобактерии), либо 45 циклов (анализы грибов и архей) 95 ° C в течение 30 секунд, 55 ° C в течение 30 секунд, 60 ° C в течение 45 с, 65 ° C в течение 15 с и 72 ° C в течение 15 с [69]. Реакции проводили в системе обнаружения последовательностей Prism 7900HT (Applied Biosystems). Для построения стандартных кривых использовали десятикратные серийные разведения известных количеств рДНК из соответствующей микробной группы (т. Е. Бактерий, бифидобактерий, грибов или архей).Абсолютную численность рДНК рассчитывали на основе стандартных кривых с использованием программного обеспечения SDS версии 2.1 (Applied Biosystems) с базовым уровнем, установленным на циклах 3–15 (бактериальные и бифидобактериальные анализы) или циклах 3–13 (анализы грибов и архей), а также пороге цикла. устанавливается в пределах геометрической фазы кривой усиления. Чувствительность каждого анализа составляла приблизительно 100 молекул рДНК на лунку для реакции ПЦР. Каждый реакционный планшет для количественной ПЦР включал два типа отрицательных контролей (контроль реагентов и контроль аликвот), каждый в трех экземплярах.Специфичность бифидобактериального ПЦР в реальном времени была протестирована с использованием геномной ДНК, выделенной из 17 контрольных штаммов бактерий: Bacillus subtilis (ATCC 6633), Bacteroides fragilis (ATCC 25285), Bacteroides thetaiotaomicron (ATCC 29148), Bifidobacterium longum) (ATCC 15ifidobacterium longum) (ATCC 15ifidobacterium longum). infantis (ATCC 15697), Clostridium perfringens (ATCC 13124), Clostridium putrefaciens (ATCC 25786), Enterococcus faecalis (ATCC 19433), Escherichia coli (клетки TOP10; Invitrogen), Haemophilus haemolyticus (ATCC 33390), Lactophilus haemolyticus (ATCC 33390), Lactophilus haemolyticus (ATCC 33390), Lactophilus haemolyticus (ATCC 33390), Lactobacillus Lactobacillus delbrueckii (ATCC 4797), Megasphaera elsdenii (ATCC 17752), Proteus vulgaris (ATCC 13315), Pseudomonas aeruginosa (ATCC 10145), Staphylococcus aureus (ATCC 25923) и Streptococcus salivarius (ATCC 13419).

    Проверка подозрительных видов / таксонов.

    Мы исследовали происхождение сигналов гибридизации массива, представляющих 12 видов / таксонов, присутствие которых в образцах было неожиданным и не подтвержденным последовательностями в контрольном пуле. Для каждого анализа мы использовали один или оба из двух независимых анализов. Во-первых, мы попытались амплифицировать последовательности, очевидно обнаруженные с помощью анализа массива, с использованием праймеров, специфичных для видов / таксонов; когда продукт был получен, его дополнительно анализировали путем секвенирования.Для амплификации последовательностей мы использовали праймер, идентичный 40-мерному зонду, который давал сигнал гибридизации на нашем микроматрице в качестве 5'-праймера и 40-мерную универсальную последовательность (обратный комплемент последовательности UNIV2, приведенный выше) в качестве 3'-фрагмента. грунтовка. В некоторых случаях мы также пытались амплифицировать подозрительную последовательность, используя усеченную (23-мерную) версию соответствующего олигонуклеотидного зонда из микроматрицы в паре с известным группоспецифическим праймером ПЦР от ProbeBase [55]. Все ПЦР проводили в условиях, идентичных тем, которые использовались при первоначальных амплификациях образцов для анализа микрочипов.Положительные полосы ожидаемого размера были клонированы и секвенированы. В качестве второго подхода четыре образца, которые, как было предсказано на основе результатов микроматрицы, содержали последовательности от неожиданных видов, были дополнительно проанализированы путем секвенирования библиотек клонов рДНК SSU (96–288 клонов), созданных путем амплификации с использованием бактериальных праймеров широкого диапазона 8F и 1391R (как указано выше. ), а также клонирование и секвенирование, как описано ранее [15]. Относительная численность, предсказанная анализом микроматриц, и количество секвенированных клонов были следующими: Vibrio (13%): 96, Deinococcus (0.1%): 192, спирохет (1%): 288 и Legionella pneumophila (1%): 192.

    Дополнительная информация

    Набор данных S3. Нормализованные данные микрочипов для всех образцов и всех отфильтрованных зондов

    Необработанные интенсивности Cy5 преобразовывали, как описано в разделе «Материалы и методы». Обратите внимание, что для образцов с повторной гибридизацией ( n = 36) показаны усредненные значения, а названия образцов обозначены (Avg).

    https://doi.org/10.1371/journal.pbio.0050177.sd003

    (19,0 МБ TXT)

    Рисунок S1. Численность бактерий и бифидобактерий в течение первого года жизни

    Для каждого образца ребенка общее количество бактерий и бифидобактерий оценивалось с помощью ПЦР в реальном времени TaqMan, как подробно описано в разделе «Материалы и методы». Для каждой из этих таксономических групп расчетные копии гена рРНК на грамм фекалий (ось y ) наносятся на график как функция дней жизни (ось x ). Обе оси имеют логарифмическую шкалу.Для каждой таксономической группы измерения численности усекаются на нижнем конце диапазона до значения, соответствующего 95-му процентилю экстракционных (отрицательных) контролей для соответствующего набора праймеров ПЦР (10702 и 1183 копий рДНК на грамм эквивалента стула. для общих бактерий и бифидобактерий соответственно). Таким образом, значения, нанесенные на соответствующие нижние пределы обнаружения, обычно представляют собой численность ниже указанного значения (диапазон, включающий ноль).

    https: // doi.org / 10.1371 / journal.pbio.0050177.sg001

    (457 КБ PDF)

    Рисунок S2. Обилие фекальных бактерий, грибов и архей в течение первого года жизни

    Для каждого образца ребенка обилие бактерий, грибов и архей оценивалось с помощью ПЦР в реальном времени TaqMan, как подробно описано в разделе «Материалы и методы». Для каждой из этих таксономических групп оценочные копии гена рРНК на грамм фекалий ( y -ось) нанесены на график как функция дней жизни ( x -ось). Обе оси имеют логарифмическую шкалу.Для каждой таксономической группы измерения численности усекаются на нижнем конце диапазона до значения, соответствующего 95-му процентилю экстракционных (отрицательных) контролей для соответствующего набора праймеров ПЦР (10702, 9831 и ноль копий рДНК на грамм). эквивалента стула для бактерий, грибов и архей соответственно). Таким образом, значения, нанесенные на соответствующие нижние пределы обнаружения, обычно представляют собой численность ниже указанного значения (диапазон, включающий ноль). Все значения, для которых оценка численности методом qPCR была равна нулю (только для архей), были опущены.Эпизоды антибактериального или противогрибкового (нистатин) лечения обозначены на временной оси серыми или розовыми полосами соответственно (дополнительную информацию см. В Таблице 1).

    https://doi.org/10.1371/journal.pbio.0050177.sg002

    (773 КБ PDF)

    Благодарности

    Мы благодарим все семьи, принявшие участие в этом исследовании. Мы благодарны за помощь членов групп Брауна и Релмана, включая Стивена Поппера, Гарольда Амогана, Ле Детлефсена и Лину Веннстрём, а также за ценные советы Майкла Эйзена (Национальные лаборатории Лоуренса Беркли и Калифорнийский университет в Беркли), Роба Тибширани ( Стэнфорд) и Джерел Дэвис.Мы благодарим Карен Нельсон и Джоан Эмерсон (Институт геномных исследований) за техническую поддержку в создании и секвенировании библиотеки клонов рДНК SSU. Мы благодарим Horn Foundation за поддержку этой работы. ПОБ - исследователь Медицинского института Говарда Хьюза. DAR является лауреатом премии Pioneer от Национального института здравоохранения.

    Вклад авторов

    CP, EMB, DBD, DAR и POB разработали и разработали эксперименты и проанализировали данные. CP, EMB и DBD проводили эксперименты.CP, EMB, DBD и POB написали статью.

    Ссылки

    1. 1. Ley RE, Backhed F, Turnbaugh P, Lozupone CA, Knight RD и др. (2005) Ожирение изменяет микробную экологию кишечника. Proc Natl Acad Sci U S A 102: 11070–11075.
    2. 2. Backhed F, Ding H, Wang T, Hooper LV, Koh GY и др. (2004) Микробиота кишечника как фактор окружающей среды, регулирующий накопление жира. Proc Natl Acad Sci U S A 101: 15718–15723.
    3. 3. Ley RE, Turnbaugh PJ, Klein S, Gordon JI (2006) Микробная экология: кишечные микробы человека, связанные с ожирением.Природа 444: 1022–1023.
    4. 4. Stappenbeck TS, Hooper LV, Gordon JI (2002) Регуляция развития кишечного ангиогенеза с помощью местных микробов через клетки Панета. Proc Natl Acad Sci U S A 99: 15451–15455.
    5. 5. Сюй Дж., Гордон Дж. И. (2003) Вступительная статья: Почитай своих симбионтов. Proc Natl Acad Sci U S A 100: 10452–10459.
    6. 6. Hooper LV, Midtvedt T, Gordon JI (2002) Как взаимодействия хозяина и микробов формируют питательную среду кишечника млекопитающих.Анну Рев Нутр 22: 283–307.
    7. 7. MacDonald TT, Gordon JN (2005) Бактериальная регуляция кишечных иммунных ответов. Гастроэнтерол Clin North Am 34: 401–412.
    8. 8. Парсоннет Дж., Фридман Г.Д., Вандерштин Д.П., Чанг Й., Фогельман Дж. Х. и др. (1991) Инфекция Helicobacter pylori и риск рака желудка. N Engl J Med 325: 1127–1131.
    9. 9. Лекит М., Абачин Э., Мартин А., Пойярт С., Почарт П. и др. (2004) Иммунопролиферативное заболевание тонкого кишечника, связанное с Campylobacter jejuni.N Engl J Med 350: 239–248.
    10. 10. Отт С.Дж., Мусфельдт М., Вендерот Д.Ф., Хампе Дж., Брант О. и др. (2004) Уменьшение разнообразия бактериальной микрофлоры слизистой оболочки толстой кишки у пациентов с активным воспалительным заболеванием кишечника. Кишечник 53: 685–693.
    11. 11. Сексик П., Риготтье-Гойс Л., Грамет Г., Сутрен М., Покхарт П. и др. (2003) Изменения доминирующих фекальных бактериальных групп у пациентов с болезнью Крона толстой кишки. Кишечник 52: 237–242.
    12. 12.Fell JM (2005) Воспалительные кишечные заболевания новорожденных: некротический энтероколит и аллергический колит. Early Hum Dev 81: 117–122.
    13. 13. de la Cochetiere MF, Piloquet H, des Robert C., Darmaun D, ​​Galmiche JP, et al. (2004) Ранняя кишечная бактериальная колонизация и некротический энтероколит у недоношенных детей: предполагаемая роль Clostridium . Pediatr Res 56: 366–370.
    14. 14. Vaughan EE, Schut F, Heilig HG, Zoetendal EG, de Vos WM, et al.(2000) Молекулярный взгляд на экосистему кишечника. Curr Issues Intest Microbiol 1: 1–12.
    15. 15. Eckburg PB, Bik EM, Bernstein CN, Purdom E, Dethlefsen L, et al. (2005) Разнообразие кишечной микробной флоры человека. Наука 308: 1635–1638.
    16. 16. Zoetendal EG, Akkermans AD, De Vos WM (1998) Анализ гель-электрофореза в градиенте температуры 16S рРНК из образцов фекалий человека выявляет стабильные и специфичные для хозяина сообщества активных бактерий.Appl Environ Microbiol 64: 3854–3859.
    17. 17. Старк П.Л., Ли А. (1982) Микробная экология толстой кишки грудных детей и детей, вскармливаемых смесями, в течение первого года жизни. J Med Microbiol 15: 189–203.
    18. 18. Penders J, Thijs C, Vink C, Stelma FF, Snijders B, et al. (2006) Факторы, влияющие на состав кишечной микробиоты в раннем младенчестве. Педиатрия 118: 511–521.
    19. 19. Бенно Ю., Савада К., Мицуока Т. (1984) Микрофлора кишечника младенцев: состав фекальной флоры у младенцев, находящихся на грудном и искусственном вскармливании.Microbiol Immunol 28: 975–986.
    20. 20. Favier CF, Vaughan EE, De Vos WM, Akkermans AD (2002) Молекулярный мониторинг последовательности бактериальных сообществ у новорожденных людей. Appl Environ Microbiol 68: 219–226.
    21. 21. Hopkins MJ, Macfarlane GT, Furrie E, Fite A, Macfarlane S (2005) Характеристика кишечных бактерий в детском стуле с использованием ПЦР в реальном времени и анализов северной гибридизации. FEMS Microbiol Ecol 54: 77–85.
    22. 22. Hall MA, Cole CB, Smith SL, Fuller R, Rolles CJ (1990) Факторы, влияющие на присутствие фекальных лактобацилл в раннем младенчестве.Arch Dis Child 65: 185–188.
    23. 23. Йошиока Х, Исэки К., Фудзита К. (1983) Развитие и различия кишечной флоры в неонатальном периоде у детей, находящихся на грудном и искусственном вскармливании. Педиатрия 72: 317–321.
    24. 24. Harmsen HJ, Wildeboer-Veloo AC, Raangs GC, Wagendorp AA, Klijn N, et al. (2000) Анализ развития кишечной флоры у детей, находящихся на грудном вскармливании и на искусственном вскармливании, с использованием методов молекулярной идентификации и обнаружения. J Pediatr Gastroenterol Nutr 30: 61–67.
    25. 25. Balmer SE, Wharton BA (1989) Диета и фекальная флора новорожденного: грудное молоко и детские смеси. Arch Dis Child 64: 1672–1677.
    26. 26. Пендерс Дж., Винк С., Дриссен С., Лондон Н., Тиджс С. и др. (2005) Количественная оценка Bifidobacterium spp., Escherichia coli и Clostridium difficile в образцах фекалий младенцев, вскармливаемых грудью и вскармливаемых смесями, с помощью ПЦР в реальном времени. FEMS Microbiol Lett 243: 141–147.
    27. 27. Lundequist B, Nord CE, Winberg J (1985) Состав фекальной микрофлоры у младенцев на грудном и искусственном вскармливании от рождения до восьми недель.Acta Paediatr Scand 74: 45–51.
    28. 28. Orrhage K, Nord CE (1999) Факторы, контролирующие бактериальную колонизацию кишечника у младенцев, находящихся на грудном вскармливании. Acta Paediatr Suppl 88: 47–57.
    29. 29. Fanaro S, Chierici R, Guerrini P, Vigi V (2003) Микрофлора кишечника в раннем младенчестве: состав и развитие. Acta Paediatr Suppl 91: 48–55.
    30. 30. Bennet R, Nord CE (1987) Развитие фекальной анаэробной микрофлоры после кесарева сечения и лечения антибиотиками у новорожденных.Инфекция 15: 332–336.
    31. 31. Neut C, Bezirtzoglou E, Romond C, Beerens H, Delcroix M и др. (1987) Бактериальная колонизация толстой кишки у новорожденных, рожденных путем кесарева сечения. Zentralbl Bakteriol Mikrobiol Hyg [A] 266: 330–337.
    32. 32. Hallstrom M, Eerola E, Vuento R, Janas M, Tammela O (2004) Влияние способа доставки и некротизирующего энтероколита на микрофлору кишечника у недоношенных детей. Eur J Clin Microbiol Infect Dis 23: 463–470.
    33. 33. Мандар Р., Микелсаар М. (1996) Передача микрофлоры матери новорожденному при рождении. Биол для новорожденных 69: 30–35.
    34. 34. Швирц А., Грюль Б., Лобниц М., Мишель П., Радке М. и др. (2003) Развитие бактериального состава кишечника у госпитализированных недоношенных детей по сравнению с доношенными детьми, находящимися на грудном вскармливании. Pediatr Res. 54: 393–399.
    35. 35. Саката Х., Йошиока Х., Фудзита К. (1985) Развитие кишечной флоры у младенцев с очень низкой массой тела при рождении по сравнению с нормальными доношенными новорожденными.Eur J Pediatr 144: 186–190.
    36. 36. Миллар М.Р., Линтон К.Дж., Кейд А., Глэнси Д., Холл М. и др. (1996) Применение ПЦР гена 16S рРНК для изучения флоры кишечника недоношенных детей с некротическим энтероколитом и без него. J Clin Microbiol 34: 2506–2510.
    37. 37. Коул Дж. Р., Чай Б., Марш Т. Л., Фаррис Р. Дж., Ван К. и др. (2003) Проект базы данных рибосом (RDP-II): предварительный просмотр нового средства автоматического выравнивания, которое позволяет регулярно обновлять новую таксономию прокариот. Nucl Acids Res 31: 442–443.
    38. 38. ДеСантис Т.З., Дубосарский И., Мюррей С.Р., Андерсен Г.Л. (2003) Комплексное построение выровненных последовательностей для автоматизированного проектирования эффективных зондов (CASCADE-P) с использованием 16S рДНК. Биоинформатика 19: 1461–1468.
    39. 39. Дедыш С.Н., Панкратов Т.А., Белова С.Е., Куличевская И.С., Лисак В. (2006) Филогенетический анализ и определение состава бактериального сообщества на кислых сфагновых торфяниках in situ. Appl Environ Microbiol 72: 2110–2117.
    40. 40.Шмитт-Вагнер Д., Фридрих М.В., Вагнер Б., Брюн А. (2003) Филогенетическое разнообразие, численность и осевое распределение бактерий в кишечном тракте двух термитов, питающихся почвой (Cubitermes spp.). Appl Environ Microbiol 69: 6007–6017.
    41. 41. Salzman NH, de Jong H, Paterson Y, Harmsen HJ, Welling GW и др. (2002) Анализ библиотек 16S микрофлоры желудочно-кишечного тракта мышей выявил новую большую группу кишечных бактерий мышей. Микробиология 148: 3651–3660.
    42. 42. Acinas SG, Marcelino LA, Klepac-Ceraj V, Polz MF (2004) Дивергенция и избыточность последовательностей 16S рРНК в геномах с множественными оперонами rrn. J Bacteriol 186: 2629–2635.
    43. 43. Park HK, Shim SS, Kim SY, Park JH, Park SE и др. (2005) Молекулярный анализ колонизированных бактерий в кишечнике новорожденного человека. J Microbiol 43: 345–353.
    44. 44. Mackie RI, Sghir A, Gaskins HR (1999) Микробная экология развития желудочно-кишечного тракта новорожденных.Am J Clin Nutr 69: 1035S – 1045S.
    45. 45. Macdonald TT, Monteleone G (2005) Иммунитет, воспаление и аллергия в кишечнике. Наука 307: 1920–1925.
    46. 46. Палмер С., Бик Е.М., Эйзен М.Б., Экбург П.Б., Сана Т.Р. и др. (2006) Быстрое количественное определение сложных микробных популяций. Nucleic Acids Res. 34.
    47. 47. Линц Б., Баллу Ф., Мудли Й., Маника А., Лю Х. и др. (2007) Африканское происхождение тесной связи между человеком и Helicobacter pylori.Природа 445: 915–918.
    48. 48. Caufield PW, Saxena D, Fitch D, Li Y (2007) Популяционная структура плазмидсодержащих штаммов Streptococcus mutans, члена местной биоты человека. J Bacteriol 189: 1238–1243.
    49. 49. Беленгер А., Дункан С.Х., Колдер А.Г., Холтроп Дж., Луи П. и др. (2006) Два пути метаболического перекрестного питания между Bifidobacterium adolescentis и анаэробами, продуцирующими бутират, из кишечника человека. Appl Environ Microbiol 72: 3593–3599.
    50. 50. Самуэль Б.С., Гордон Дж. И. (2006) Гуманизированная модель мыши-гнотобиотической мыши мутуализма «хозяин-архей-бактерия». Proc Natl Acad Sci U S A 103: 10011–10016.
    51. 51. Зонненбург JL, Chen CT, Gordon JI (2006) Геномные и метаболические исследования воздействия пробиотиков на модельный симбионт кишечника и хозяина. PLoS Biol 4: e413 ..
    52. 52. Фарук С.М., Насер И.Б., Ислам М.Дж., Фарук А.С., Гош А.Н. и др. (2005) Сезонные эпидемии холеры обратно коррелируют с распространенностью фагов холеры в окружающей среде.Proc Natl Acad Sci U S A 102: 1702–1707.
    53. 53. Edwards U, Rogall T, Blocker H, Emde M, Bottger EC (1989) Выделение и прямое полное определение нуклеотидов целых генов. Характеристика гена, кодирующего рибосомную РНК 16S. Nucleic Acids Res 17: 7843–7853.
    54. 54. Lane DJ, Pace B, Olsen GJ, Stahl DA, Sogin ML, et al. (1985) Быстрое определение последовательностей 16S рибосомной РНК для филогенетических анализов. Proc Natl Acad Sci U S A 82: 6955–6959.
    55. 55. Loy A, Horn M, Wagner M (2003) probeBase: Интернет-ресурс для олигонуклеотидных зондов, нацеленных на рРНК. Nucleic Acids Res 31: 514–516.
    56. 56. Альтшул С.Ф., Гиш В., Миллер В., Майерс Е. В., Липман Д. Д. (1990) Базовый инструмент поиска локального выравнивания. J Mol Biol 215: 403–410.
    57. 57. Бик Э.М., Экбург П.Б., Гилл С.Р., Нельсон К.Э., Пурдом Э.А. и др. (2006) Молекулярный анализ бактериальной микробиоты в желудке человека. Proc Natl Acad Sci U S A 103: 732–737.
    58. 58. Blanchard AP, Kaiser RJ, Hood LE (1996) Матрицы олигонуклеотидов высокой плотности. Biosens Bioelectron 11: 687–690.
    59. 59. Fare TL, Coffey EM, Dai H, He YD, Kessler DA и др. (2003) Влияние атмосферного озона на качество данных микрочипов. Anal Chem 75: 4672–4675.
    60. 60. Baker GC, Smith JJ, Cowan DA (2003) Обзор и повторный анализ доменно-специфичных праймеров 16S. J Microbiol Methods 55: 541–555.
    61. 61. Лепп П.У., Бриниг М.М., Оуверни С.К., Палм К., Армитаж Г.К. и др.(2004) Метаногенные археи и пародонтоз человека. Proc Natl Acad Sci U S A 101: 6176–6181.
    62. 62. DeLong EF, Wickham GS, Pace NR (1989) Филогенетические красители: зонды на основе рибосомной РНК для идентификации одиночных клеток. Наука 243: 1360–1363.
    63. 63. Делонг Е.Ф. (1992) Археи в прибрежной морской среде. Proc Natl Acad Sci U S A 89: 5685–5689.
    64. 64. Borneman J, Hartin RJ (2000) Праймеры для ПЦР, которые амплифицируют гены рРНК грибов из образцов окружающей среды.Appl Environ Microbiol 66: 4356–4360.
    65. 65. Аманн Р.И., Биндер Б.Дж., Олсон Р.Дж., Чисхолм С.В., Деверо Р. и др. (1990) Комбинация олигонуклеотидных зондов, нацеленных на 16S рРНК, с проточной цитометрией для анализа смешанных микробных популяций. Appl Environ Microbiol 56: 1919–1925.
    66. 66. Langendijk PS, Schut F, Jansen GJ, Raangs GC, Kamphuis GR, et al. (1995) Количественная флуоресцентная гибридизация in situ Bifidobacterium spp. с геноспецифическими зондами, нацеленными на 16S рРНК, и их применением в образцах фекалий.Appl Environ Microbiol 61: 3069–3075.
    67. 67. Гардес М., Брунс Т.Д. (1993) Праймеры ITS с повышенной специфичностью для базидиомицетов - применение для идентификации микоризы и ржавчины. Мол Экол 2: 113–118.
    68. 68. White TJ, Burns T, Lee S, Taylor J (1990) Амплификация и секвенирование генов грибковой рибосомной РНК для филогенетики. В: Иннис М.А., Гельфанд Д.Х., Снинский Дж. Дж., Уайт Т. Дж., Редакторы. Протоколы ПЦР. Руководство по методам и приложениям. Сан-Диего (Калифорния): Academic Press.С. 315–322.
    69. 69. Brinig MM, Lepp PW, Ouverney CC, Armitage GC, Relman DA (2003) Распространенность бактерий подразделения TM7 в поддесневой бляшке человека и их связь с заболеванием. Appl Environ Microbiol 69: 1687–1694.

    Прожектор на кишечную микробиоту - Papineni

    Микробиом человека разнообразен, варьируется в зависимости от человека и участка тела и важен для здоровья человека. Различные отделы желудочно-кишечного тракта населены популяциями микроорганизмов.Эти живые микроорганизмы образуют огромное микробное сообщество, которое включает как аэробные, так и анаэробные бактерии, а также вирусы, грибы и паразиты (1). В кишечном тракте человека обитает около 100 триллионов бактерий, представляющих до тысячи различных родов и видов (2). Количество бактерий неуклонно увеличивается от двенадцатиперстной кишки (10 2 бактерий / грамм) до толстой кишки (~ 10 12 бактерий / грамм ткани) (3). Слой слизи создает дополнительную неоднородность, отделяя бактерии, ограниченные просветом кишечника, от бактерий, способных проникать под слизь и прикрепляться к эпителию (, рис. 1, ) (4).Слизь в желудочно-кишечном тракте прилипает в виде геля к поверхностному эпителию, образуя поверхность раздела между просветом и слизистой оболочкой. У мышей слизь толстой кишки, секретируемая бокаловидными клетками, состоит из двух слоев, простирающихся на 150 м над эпителиальными клетками (, рис. 1А, ). Внешний слой подвижен, имеет увеличенный объем за счет протеолиза муцина MUC2 и заселен бактериями (, рис. 1А, ) (5). Внутренний слой плотно упакован, прочно прикреплен к эпителию и обычно лишен бактерий.Протеазы некоторых паразитов и некоторых бактерий могут расщеплять муцины и растворять слизь, что является частью их патогенности. Внутренний слой слизи также может стать проницаемым для бактерий благодаря нескольким другим механизмам, включая аберрации в иммунной системе. Когда бактерии достигают поверхности эпителия, активируется иммунная система и запускается воспаление. Например, во время воспалительного заболевания кишечника (ВЗК) контакт между кишечными бактериями и поверхностями слизистой оболочки может вызвать и продлить воспаление толстой кишки (6).

    Рис. 1 Кишечные бактерии, слои слизи и стволовые клетки. A. Репрезентативная микрофотография, показывающая распределение слоев слизи в толстой кишке мыши. Залитые парафином срезы окрашивали альциановым синим для обнаружения бокаловидных клеток и слизистых слоев. Внешний слой слизи обеспечивает убежище для микробиоты просвета, в то время как внутренний слой, защищающий слизистую оболочку, преимущественно стерилен; B. Прототип крипты толстой кишки мыши, показывающий области стволовых клеток, которые соответствуют либо быстро меняющимся клеткам, либо +4 покоящимся клеткам, соответственно.

    Бактериальные сообщества различаются по составу вдоль пищеварительного тракта, при этом каждый человек имеет уникальную коллекцию видов и адаптируется в течение жизни в соответствии с образом жизни и питанием хозяина. Как в кишечнике человека, так и в кишечнике мыши доминирующая микробиота принадлежит к типам Firmicutes и Bacteroidetes. Кроме того, Proteobacteria, Actinobacteria, Verrucomicrobia, Cyanobacteria и Deferribacteres также были обнаружены у людей и мышей, а Fusobacteria - у людей (7).Микробиота кишечника способствует здоровью кишечника у хозяина, ферментируя неиспользованные энергетические субстраты (8,9), предотвращая рост вредных патогенных бактерий (10) и помогая иммунной системе хозяина (11-13). С другой стороны, неупорядоченные и нарушенные сообщества микробиоты связаны с такими состояниями, как ожирение (14), ВЗК (15,16) и раковые поражения кишечника, печени и поджелудочной железы (, таблица 1, ) (17). Численность членов микробиоты, ассоциированных с тканями или слизистыми оболочками, у пациентов с ВЗК (болезнь Крона и язвенный колит) и колоректальным раком (CRC) изменяется по сравнению со здоровым контролем (18,19).Интересно, что размеры популяции членов семейства Enterobacteriaceae (например, Escherichia coli , Klebsiella и Shigella ), которые обычно связаны с воспалением, увеличиваются при всех трех заболеваниях. Собхани и др. . (19) сообщили о более высоких уровнях Bacteroides и Prevotella , обнаруженных в стуле пациентов с CRC, чем в стуле пациентов с нормальной колоноскопией. Два недавних исследования обнаружили, что Fusobacterium связаны с тканью CRC, но не с нормальной толстой кишкой (20,21).Поэтому крайне важно исследовать терапевтические стратегии, направленные на управление дисбактериозом (нарушенным микробиологическим сообществом) под влиянием стрессоров (болезни или других факторов). Это может помочь эндогенной микробиоте восстановить нормальный или более консолидированный статус микробиоты. Попавшие внутрь пробиотики (полезные для здоровья бактерии) или их высвобождаемые факторы могут изменить эндогенную микробиоту для достижения благоприятного баланса в кишечнике. Действительно, хорошо спланированные, рандомизированные и двойные слепые плацебо-контролируемые исследования на людях с использованием про-пре- или синбиотиков с адекватным последующим наблюдением должны сформулировать указания по профилактике и терапии.Вместе комбинированная микробиота может снизить серьезность одних заболеваний, предотвращая при этом другие, в конечном итоге улучшая здоровье человека.

    Таблица 1 Возможная ассоциация бактерий с различными видами рака
    Полный стол

    Вмешательства, влияющие на микробиоту

    Антибиотики

    Клиническое использование антибиотиков, способствуя избавлению от целевых инфекций, также разрушает комменсальные микробные сообщества и снижает устойчивость хозяина к устойчивым к антибиотикам микробам.Антибиотики радикально влияют на микробное сообщество желудочно-кишечного тракта на всех этапах жизни, и ответы на них различаются у разных людей. Глобальное использование антибиотиков и исчезновение образа жизни коренных народов могло бы устранить ключевой источник информации о микробах, с которыми мы эволюционировали; Сохранение образцов этих находящихся под угрозой исчезновения микробов желудочно-кишечного тракта на всех этапах развития человека может быть важной целью расширенных проектов по созданию микробиома человека во всем мире. В кишечнике млекопитающих обитает сложное микробное сообщество, которое обеспечивает хозяину многочисленные преимущества.Однако микробиота также может включать потенциально вирулентные виды, называемые патобионтами, которые могут вызывать заболевание при нарушении гомеостаза кишечника. Молекулярные механизмы, с помощью которых патобионты вызывают заболевание, остаются малоизученными. В недавно проведенном исследовании было описано заболевание, подобное сепсису, которое возникает при повреждении кишечника у мышей, получавших антибиотики (22). Сепсис был связан с системным распространением специфического патобионта Escherichia coli с множественной лекарственной устойчивостью, который заметно увеличился в микробиоте мышей, получавших антибиотики.Для быстрой смерти, подобной сепсису, необходим компонент врожденной иммунной системы, инфламмасома Naip5-Nlrc4. В соответствии с постулатами Коха было обнаружено, что патобионта E. coli было достаточно, чтобы активировать Naip5-Nlrc4 и вызвать заболевание при внутривенном введении необработанным мышам. Эти результаты показывают, как сепсисоподобное заболевание может возникнуть в результате распознавания патобионтов врожденной иммунной системой.

    Радиация

    Воздействие высоких доз ионизирующего излучения (ИК) на людей вызывает выпадение волос, ожоги кожи, врожденные дефекты, желудочно-кишечные заболевания, рак и смерть.Клетки, которые быстро делятся и быстро размножаются, наиболее чувствительны к цитотоксическим и генотоксическим эффектам лучевого поражения. Эти ткани включают костный мозг, репродуктивную и лимфоидную ткань и желудочно-кишечный тракт (23). Реакция желудочно-кишечного тракта на острое лучевое поражение является наиболее подробно описанной модельной системой для изучения восстановления повреждений у грызунов. Непрерывный и быстрый оборот желудочно-кишечного тракта, в частности, объясняет его уникальную чувствительность к высоким дозам ИР.После серьезного повреждения ДНК у клетки есть два физиологических варианта: (I) восстановить повреждение ДНК или (II) умереть. После облучения высокой дозой (> 8 Гр; радиационная реакция зависит от вида и дозы) стволовые эпителиальные клетки желудочно-кишечного тракта / клетки-предшественники неспособны к достаточному размножению, чтобы заменить умирающие клетки. Это приводит к синдромам мальабсорбции, дисбалансу электролитов, потере жидкости и бактериальным инфекциям. Агенты, которые могут предотвращать или ослаблять потерю эпителиальных стволовых клеток / клеток-предшественников и тем самым предотвращать нарушение барьера или восстанавливать целостность эпителия, были бы идеальными кандидатами для разработки радиозащитных лекарств.

    Радиация влияет на микробиоту слизистой оболочки и нарушает ее, приводя к перемещению микроорганизмов или микробных продуктов через слизистую оболочку в кровоток (24). Можно ожидать, что проницаемость слизистой оболочки облученной толстой кишки у пациентов, леченных от рака прямой кишки, будет увеличиваться из-за атрофии слизистой оболочки, наблюдаемой у облученных пациентов, и может привести к повышенному риску радиационного энтерита (25). Транслокация патогенных организмов через стенку кишечника в кровоток, брюшную полость и органы брюшной полости является общепризнанной причиной последующего сепсиса и опасных для жизни осложнений у пациентов в критическом состоянии (26).Поэтому существует острая потребность в быстрых, точных и чувствительных диагностических платформах для подтверждения облучения и оценки дозы, поглощенной людьми, подвергшимися актам радиологического терроризма, авариям на атомных электростанциях или ядерной войне. Клинические симптомы и физические дозиметры, даже если они доступны, не предоставляют адекватной диагностической информации для сортировки и лечения опасных для жизни лучевых поражений. В недавнем исследовании Lam V. et al . (27) элегантно описали присутствие 12 членов Bacteroidales , Lactobacillaceae и Streptococcaceae в кале человека и крысы после радиационного воздействия при уровнях 98 Clostridiaceae и Peptostreptococcaceae членов семейства и сниженных уровнях 47 отдельных Зарегистрировано особей Clostridiaceae.Таким образом, кишечная микробиота служит новыми биомаркерами предшествующего радиационного облучения и может дополнять традиционный анализ хромосомных аберраций для значительного улучшения оценок биологических доз (27). Действительно, исследования, направленные на расшифровку взаимодействий микробиома и хозяина до и после лучевого поражения небольшой чаши, могут в конечном итоге позволить прогнозировать течение заболевания и открывать возможности для разработки новых терапевтических или профилактических стратегий. Наконец, можно контролировать состав микробиоты, чтобы определить положительные эффекты целевого подхода во время радиосенсибилизации с использованием золота и других наночастиц.Такие исследования могут оказаться неоценимыми для повышения эффективности целевого подхода, а также помочь в оценке того, действительно ли они ограничивают / снижают токсичность лучевой терапии.

    Химиотерапия

    Системная цитотоксическая химиотерапия - это распространенное лечение злокачественных новообразований, которое используется уже полвека (28). Он может вызывать функциональные и структурные изменения желудочно-кишечного тракта (29), изменяя среду хозяина. Общие желудочно-кишечные симптомы после химиотерапии включают изжогу, боль в животе, диарею (и запор), вздутие живота и тошноту (29).Эти симптомы возникают в результате повреждения, вызванного химиотерапевтическими агентами (29). Боль в животе вызвана обширным повреждением тонкой кишки. Считается, что диарея и запор вызываются изменением абсорбционных функций клеток, распределением и составом бокаловидных клеток и муцина, а также взаимодействием бактерий с этими клетками и метаболитами самих лекарств (29). Несколько исследований продемонстрировали влияние химиотерапевтических агентов на микробиоту кишечника (30).Одним из наиболее исследованных агентов является иринотекан из-за участия кишечной микробиоты в его метаболизме (31,32). Иринотекан (используемый для лечения различных солидных опухолей) представляет собой ингибитор топоизомеразы-I, превращенный в активный и токсичный метаболит SN-38, а затем метаболизируется в нетоксичный метаболит глюкуронид SN-38 (SN-38G) (31,32 ). Эта молекула попадает в желудочно-кишечный тракт, где становится восприимчивой к обработке бактериальными ферментами. Кишечные микробы производят фермент β-глюкуронидазу, который может отщеплять молекулу глюкуронида от менее токсичного метаболита иринотекана, делая его повторно активированным и токсичным (31,32).Воздействие на кишечную микробиоту, вызванное иринотеканом, считается важным из-за его участия в метаболизме препарата и потенциально сложной токсичности. Было показано, что антиметаболит 5-фторурацил (5-FU), используемый для лечения колоректального рака, рака груди и печени, связан с изменениями микробиоты кишечника (33). В клинических исследованиях также были продемонстрированы изменения кишечной микробиоты. В исследовании, проведенном van Vliet и его коллегами в 2009 г. (34), с помощью денатурирующего градиентного гель-электрофореза было показано, что у педиатрических пациентов с острым миелоидным лейкозом, получавших AML-97, уменьшилось разнообразие кишечных микробов.У онкологических больных, получающих химиотерапию, часто развивается мукозит как прямой результат лечения. В последнее время кишечная микробиота привлекла большое внимание при изучении патобиологии мукозита. Более того, диарея, вызванная химиотерапией (CID), является распространенной проблемой, особенно у пациентов с запущенным раком. Сообщалось, что частота CID достигает 50-80% пациентов, получавших лечение болюсом 5-FU или некоторыми комбинациями терапии иринотеканом и фторпиримидином.Доказано, что пробиотики предотвращают диарею при воспалительном заболевании кишечника. Доклинические данные показали аналогичную эффективность при CID (35,36). В клинических условиях комбинация Lactobacillus rhamnosus и клетчатки привела к значительному уменьшению диареи 3/4 степени в рандомизированном исследовании пациентов, получавших болюс (Mayo) или болюс и инфузию (упрощенно de Gramont) 5-FU. с лейковорином для адъювантного лечения CRC (37). На недавней Международной конференции по антимикробным препаратам и химиотерапии представленные данные свидетельствуют о том, что изменения в кишечной микробиоте, особенно увеличение популяций Bacteroides , позволяют прогнозировать, у каких пациентов, получающих химиотерапию, вероятно, разовьется CID.Эти изменения происходят в среднем за 6 дней до появления симптомов, что может открыть путь к пробиотической или другой целевой терапии. В связи со значительным воздействием на кишечную микробиоту, происходящим после проведения химиотерапии, в настоящее время возникает интерес, связанный с последующими патологическими эффектами, которые могут быть связаны с измененной экологией кишечника и использованием нанотехнологий для доставки химиотерапевтических препаратов для снижения такой токсичности (см.).


    Диета и микробиом: роль про, пре и синбиотиков

    Воздействие диеты и окружающей среды влияет на состав микрофлоры кишечника.Выбранные популяции бактерий могут, в свою очередь, влиять на физиологические характеристики человека-хозяина. Были идентифицированы три энтеротипа для классификации людей по преобладающим классам кишечной микробиоты (7). Эти бактериальные профили стабильны даже при краткосрочных изменениях диеты (38,39). Как показали эти и другие исследования, состав кишечной флоры мало меняется со временем (7,40), но на относительное распределение типов бактерий в популяции может влиять диета, лекарства и такие формы поведения, как курение (41, 42).Бактерии, такие как виды Bifidobacter и Lactobacilli, широко известные как пробиотики, определяются как жизнеспособные микроорганизмы, достаточные количества которых достигают кишечника в активном состоянии и, таким образом, оказывают положительное влияние на здоровье (43). Популярные коммерчески используемые виды пробиотиков включают L. paracasei , L. rhamnosus, L. acidophilus, L. johnsonii, L. fermentum, L. reuteri, L. plantarum , Bifidobacterium longum и Bifidobacterium animalis .Среди многочисленных преимуществ для здоровья, приписываемых пробиотикам, основными механизмами являются (временная) модуляция микрофлоры кишечника хозяина и способность взаимодействовать с иммунной системой напрямую или через посредство автохтонной микрофлоры. Кроме того, хорошо зарекомендовавшие себя пробиотические эффекты включают, но не ограничиваются ими: профилактику и / или сокращение продолжительности и жалоб на диарею, вызванную ротавирусами или антибиотиками, снижение уровней ферментов и / или метаболитов, способствующих развитию рака в кишечнике, положительные эффекты, связанные с восстановлением комменсалов, нормализацией дефекации и консистенции стула у субъектов, страдающих запорами или раздраженной толстой кишкой, профилактикой или облегчением аллергии и атопических заболеваний у младенцев и, наконец, профилактикой инфекций дыхательных путей и других инфекционных заболеваний.

    Пребиотик - это «избирательно ферментированный ингредиент, который допускает определенные изменения как в составе, так и в активности микрофлоры желудочно-кишечного тракта, что оказывает положительное влияние на самочувствие и здоровье хозяина» (44), тогда как синергетические комбинации про- и пребиотиков называются синбиотиками. Пребиотики - это пищевые волокна, положительно влияющие на микрофлору кишечника. Другие эффекты пребиотиков на здоровье (профилактика диареи или запоров, модуляция метаболизма кишечной флоры, профилактика рака, положительное влияние на липидный обмен, стимуляция адсорбции минералов и иммуномодулирующие свойства) являются косвенными, т.е.е. опосредовано микрофлорой кишечника. Пектин, например, представляет собой полисахаридное волокно, которое обладает широкими противовоспалительными свойствами и подвергается ферментации в толстой кишке с образованием короткоцепочечных жирных кислот (SCFA) (45), в частности ацетата, н-бутирата, пропионата и валерата. Эти SCFA используются эпителиальными клетками кишечника и выводятся с калом. Бутират обладает антипролиферативными свойствами in vitro, и противораковыми свойствами на моделях мышей (46). Корреляцию между концентрациями бутирата и заболеваемостью CRC у людей было трудно оценить отчасти из-за наличия подтипов CRC, уровней и сроков введения бутирата.Добавка бутирата при пероральном приеме быстро всасывается в верхних отделах желудочно-кишечного тракта и не достигает толстой кишки, но недавнее исследование показало, что пероральное введение Butyrivibrio fibrisolvens , бактерии, продуцирующей бутират, уменьшает образование аберрантных очагов крипт в толстой кишке. и прямая кишка мышей (47). Мы показали на модели in vivo индуцированной Citrobacter rodentium (CR) гиперпролиферации и гиперплазии крипт толстой кишки, что пищевой пектин как источник бутирата является эффективным средством доставки бутирата в толстую кишку (48-50).В ходе продолжающегося исследования мы обнаружили, что вмешательство с помощью диетического пектина (6%) способствует привлечению комменсалов, таких как B. vulgatus , S. gordonii и L. lactis , которые теряются во время заражения Citrobacter , вызванного инфекцией. колит (рукопись в стадии подготовки). Более того, у восприимчивых хозяев, когда CR-инфицированных мышей помещали на 6% пектиновую диету в течение 9 дней, начиная через 2 дня после CR-инфекции, это: (I) снижало заболеваемость и смертность CR-инфицированных мышей C3H; (II) Восстановлено мечение соединений β-катенина / E-кадгерина и ZO-2 и; (III) Восстановлена ​​барьерная функция.Кроме того, мы также обнаружили, что мыши, получавшие диетический пектин и подвергнутые облучению 14 Гр (IR), имели значительную выживаемость стволовых клеток крипт после анализа микроколоний (неопубликованное наблюдение). Кроме того, у мышей, получавших пектин, наблюдалось улучшение общей выживаемости по сравнению с мышами, получавшими обычную диету. Таким образом, введение пектина после тяжелой ИР может смягчить радиационно-индуцированную делецию стволовых клеток кишечника и / или клеток-предшественников, облегчить регенерацию крипт, усилить барьерную функцию слизистой оболочки и, в конечном итоге, способствовать выживанию, что оправдывает использование пребиотиков.Действительно, как упоминалось в другом месте, обнаружено, что использование пектина связано с восстановлением комменсалов, которые способствуют выживанию и лучшему результату.


    Кишечные стволовые клетки (ISC) и микробиота

    ISC представляют собой недифференцированные примитивные клетки, которые асимметрично делятся, подвергаются самообновлению и продуцируют коммитированные дочерние клетки, которые вносят вклад во все взрослые клоны в кишечнике. Расположение и идентичность ISC является предметом многочисленных дискуссий, что имеет значение для понимания рака желудочно-кишечного тракта, восстановления после повреждения кишечника и нормальной физиологии.Во многих сообщениях было высказано предположение, что +4 клетки соответствуют местоположению медленно меняющихся, сохраняющих метку клеток (51), которые окрашиваются положительно на Bmi1, mTert и DCLK1 (52-54), тогда как другая ниша стволовых клеток расположена в основании крипт и занятые столбчатыми (CBC) клетками основания крипты отмечены Lgr5 (55) (, рис. 1B, ). Хотя +4 клетки и CBC четко различаются, исследования по отслеживанию клонов показали, что оба могут дать начало всем клонам в кишечнике: бокаловидным клеткам, энтероэндокринным клеткам, клеткам Панета и абсорбирующим эпителиальным клеткам.Недавно проведенное элегантное исследование показало, что Hopx, атипичный гомеобоксный белок, является специфическим маркером +4 клеток (56) (, рис. 1B, ). Клетки, экспрессирующие Hopx, дали начало CBC и всем зрелым клонам кишечного эпителия. Напротив, было обнаружено, что CBC дают +4 Hopx-положительных клеток. Хотя эти находки демонстрируют двунаправленную клональную взаимосвязь между активными и покоящимися стволовыми клетками в их нишах, недавнее исследование показало, что +4 клетки, экспрессирующие Bmi1, могут компенсировать потерю CBCs для поддержания гомеостаза после экспериментального удаления клеток, экспрессирующих Lgr5 (57).Следовательно, вероятно, что популяция Lgr5 представляет собой «активный» пул стволовых клеток, который может пополняться из более спокойного пула клеток Bmi1. Эти открытия также предоставили нам инструменты для визуализации стволовых клеток и изучения их поведения в контексте самообновления и мультиактивности, двух характеристик взрослых стволовых клеток. Самообновление - это процесс, который требует строгого контроля клеточного цикла и часто поддержания мульти-активности или плюрипотентности, в зависимости от стволовых клеток. Гомеостатическая активность резервуаров взрослых стволовых клеток адаптирована для удовлетворения конкретных требований к обновлению отдельных тканей за счет комбинации внутреннего генетического программирования и локальных сигналов, доставляемых из окружающей среды (ниши).В кишечнике различные сигнальные пути, включая Wnt, Notch и BMP, действуют согласованно на основании крипт, чтобы поддерживать обновление эпителия, управляемое стволовыми клетками (58). В ответ на меняющиеся потребности тканей стволовые клетки со временем претерпевают изменения в статусе клеточного цикла и потенциале развития, что требует различных программ самообновления на разных этапах жизни. Снижение функции стволовых клеток и регенеративной способности тканей во время старения вызвано изменениями в программах самообновления, которые усиливают подавление опухоли.Рак возникает из-за мутаций, которые неправильно активируют программы самообновления.

    Соматические стволовые клетки толстой кишки поддерживают самообновление, и обычно считается, что нарушения в динамике стволовых клеток представляют собой самый ранний шаг к канцерогенезу толстой кишки. Многие опухоли состоят из фенотипически и функционально гетерогенных раковых клеток. В течение многих лет такая гетерогенность была основана на представлении о том, что все раковые клетки обладают канцерогенным потенциалом и могут развиваться в опухоли в зависимости от генетических и / или эпигенетических изменений.Однако недавние исследования показали, что опухоли демонстрируют иерархию, при которой субпопуляция раковых клеток может иметь более высокий канцерогенный потенциал, чем другие раковые клетки. Эти клетки, широко известные как «раковые стволовые клетки» (РСК), определяются как «клетка в опухоли, которая обладает способностью самообновляться и вызывать гетерогенные линии раковых клеток, составляющих опухоль». скрещивая специфичных для стволовых клеток Lgr5-EGFP-IRES-creERT2 knock-in мышей с Apc flox / flox , было однозначно показано, что криптные Lgr5 + стволовые клетки являются клетками происхождения рака кишечника ( 59).Недавнее исследование еще больше укрепило это утверждение, показав, что меченные Doublecortin-подобной киназой 1 (Dclk1) опухолевые стволовые клетки (TSC) непрерывно продуцируют опухолевое потомство в полипах мышей Apc Min / + (60). Специфическое удаление Dclk1-положительных TSC привело к заметной регрессии полипов без видимого повреждения нормального кишечника (60).

    Кишечный крипта, в которой находятся стволовые клетки, является местом восстановления эпителия и представляет собой редкую ситуацию, когда дифференцирующийся и пролиферативный эпителий подвергается прямому воздействию бактерий, как постоянных симбионтов, так и случайных патогенов.Поэтому вполне вероятно, что совместная эволюция млекопитающих с микробиотой кишечника привела к балансу, защищающему крипту от микробных повреждений, сохраняя при этом способность воспринимать и интегрировать микробные сигналы, чтобы преобразовать их в сигналы, стимулирующие регенерацию эпителия (61). Метагеномные исследования с участием микробиома просвета всего кишечника недавно открыли большие возможности для физиологического и патофизиологического анализа взаимодействия хозяина и микробиоты. Исходя из этого, становится все более важным анализировать, какие ниши кишечника, подверженные воздействию той или иной микробиоты, имеют большое функциональное значение.Уникальное подмножество эпителия, называемое клетками пучка, находится в желудочно-кишечном тракте многих позвоночных, и недавние исследования показали, что апикальный "пучок" может обнаруживать и передавать сигналы окружающей среды. Следовательно, вероятно, что клетки кишечного пучка чувствуют кишечные микробы через вкусовые рецепторы и вносят свой вклад в гомеостаз кишечника. Интересно, что мы и другие показали, что Dclk1 маркирует покоящуюся популяцию стволовых клеток в кишечнике (54,62). Поскольку было показано, что Dclk1 маркирует клетки пучка (63), можно предположить провокационную гипотезу, согласно которой стволовые клетки могут быть непосредственно вовлечены в восприятие кишечной микробиоты и реагирование на нее.Аналогичным образом ожидается, что вмешательства, такие как лечение антибиотиками, лучевая или химиотерапия, которые влияют на микробиоту, нацелены на ISC, чтобы модулировать патогенез заболевания. Однако такой связи между экологическими сигналами и ISC пока не установлено. Правдоподобный подход, связанный с использованием биосовместимых наночастиц, инкапсулированных с фитонутриентами, для восстановления благоприятного микробиома может оказаться стратегически полезным для предотвращения или минимизации дерегулированных стволовых клеток. Действительно, элегантное исследование недавно показало, что стволовые клетки Lgr5 + очень восприимчивы к DSS-индуцированному повреждению и что пищевые сигналы могут влиять на регуляторные сети стволовых клеток (64).Аналогичным образом описано увеличение количества стволовых клеток Lgr5 + у мышей, подвергшихся ограничению калорийности (65). Это иллюстрирует то обстоятельство, что мы еще мало знаем о том, как диета и микробиота в целом влияют на количество и функцию стволовых клеток, взаимное преобразование клеток между различными компартментами стволовых клеток или кишечную «нишу». Учитывая доступность мышей-репортеров Lgr5, Bmi1 и Prominin-1, будет интересно провести отслеживание клонов, при этом прямая имплантация стула / микробов этим мышам, выращенным в стерильных условиях, позволит установить прямую роль микробиоты в стволовых клетках, которые можно объективно оценить количественно.Точно так же целевой подход к мониторингу ландшафта и состояния стволовых клеток с использованием флуоресцентных наночастиц (в исследованиях на животных) или контрастных наночастиц МРТ (будущие клинические исследования) может быть полезным для отслеживания стволовых клеток в желудочно-кишечном тракте. Наконец, биосовместимые наночастицы, инкапсулированные с фитонутриентами для восстановления благоприятного микробиома, могут оказаться неоценимыми для защиты стволовых клеток после лучевой терапии.


    Наночастицы и другие носители для про / пребиотиков для улучшения здоровья человека

    Органическая конструкция, потребляемая в пищу, поставляется в упаковках, которые несут активные компоненты и защищают захваченные активные материалы до тех пор, пока не будут доставлены в целевые органы человека.Роль упаковки и доставки имитируется в инструментах микрокапсулирования, используемых для доставки активных ингредиентов в обработанные пищевые продукты. Эффективность микрокапсулирования сбалансирована с необходимостью доступа к захваченным питательным веществам в биодоступных формах. Инкапсулированные ингредиенты, обогащенные биоактивными питательными веществами, предназначены для улучшения здоровья и благополучия, а также для предотвращения будущих проблем со здоровьем. В настоящее время активные ингредиенты доставляются с использованием новых технологий, таких как гидрогели, наноэмульсии и наночастицы.Используя подход инкапсулированной наночастицы siRNA для блокирования передачи сигналов Wnt / -катенин, мы недавно показали, что мы можем значительно ослабить процесс эпителиально-мезенхимального перехода (EMT), вызванный бактериальной инфекцией (66). Аналогичные подходы к инкапсулированию пробиотиков или пребиотиков необходимо будет адаптировать для улучшения доставки и борьбы с болезнями инфекционной этиологии. В будущем нутрицевтики и функциональные продукты питания могут быть адаптированы к индивидуальным метаболическим потребностям и привязаны к генетическому составу каждого человека.Биоактивные ингредиенты содержат полезные для здоровья питательные вещества и защищены процессами инкапсуляции, которые защищают активные ингредиенты от вредных сред.

    Ободочная кишка предоставляет множество терапевтических возможностей. Необходимо изучить множество мишеней для болезней, молекул лекарств и систем доставки, специфичных для толстой кишки. Клинические исследования подчеркивают возможность системной доставки через толстую кишку, и новые данные об уровнях переносчиков клеточных мембран и метаболических ферментов в кишечнике могут оказаться полезными для этого.Часто переносчики оттока и уровни метаболических ферментов ниже в толстой кишке, что указывает на возможность улучшения биодоступности субстратов лекарств в этом месте. Местная доставка к слизистой оболочке толстой кишки остается ценным терапевтическим вариантом. Новые методы лечения, нацеленные на медиаторы воспаления, могут улучшить лечение ВЗК, а старые и новые противораковые молекулы при местном применении могут оказаться полезными дополнениями к текущим системным или хирургическим методам лечения. Новые проблемы, такие как фармакогеномика, хронотерапия и доставка пребиотиков и пробиотиков, являются одними из последних достижений в улучшении здоровья человека.Для нацеливания лекарств на толстую кишку используются различные стратегии, каждая со своими преимуществами и недостатками. Наиболее перспективные системы рассматриваются в свете физиологических данных, влияющих на их поведение in vivo и . Биосовместимые наночастицы, несущие полезную нагрузку (питательные вещества / лекарства), могут отслеживаться во время желудочно-кишечного транзита (, рис. 2А, ) и потенциально могут быть нацелены на определенные желудочно-кишечные компартменты (, рис. 2В, ).

    Рисунок 2 JenyA. In vivo отслеживание флуоресценции в ближней инфракрасной области (NIRF) полимерных наночастиц размером ~ 35 нм с инкапсулированным красителем в ближней инфракрасной области. Показанные интервальные изображения представляют собой репрезентативные изображения в тех же положениях и идентичном контрасте сигнала ( верхние панели, ). Изображения внизу были получены в разные моменты времени. Рентгеновские изображения и изображения NIRF получали на мультимодальной системе визуализации при EX: 730 нм, EM: 790 нм. Б. Наночастицы, дериватизированные лекарствами, для визуализации в определенном отсеке.

    Микроинкапсуляция была разработана фармацевтической промышленностью как средство контроля или изменения высвобождения лекарственных веществ из систем доставки лекарств.В системах доставки лекарств микрокапсулирование используется для улучшения биодоступности лекарств, контроля кинетики высвобождения лекарств, минимизации побочных эффектов лекарств и маскирования горького вкуса лекарственных веществ. Применение микрокапсулирования распространилось на пищевую промышленность, как правило, для контроля высвобождения ароматизаторов и производства пищевых продуктов, содержащих функциональные ингредиенты (например, пробиотики и биоактивные ингредиенты). Тип производимой микрокапсулы и ее результирующие свойства высвобождения зависят от технологии микрокапсулирования в дополнение к физико-химическим свойствам материалов ядра и оболочки.Также обсуждаются ключевые критерии выбора подходящей технологии микрокапсулирования. Две из наиболее распространенных технологий физического микрокапсулирования, используемые в фармацевтической обработке, покрытие в псевдоожиженном слое и экструзия-сферонизация, могут быть адаптированы для микрокапсулирования функциональных биоактивных ингредиентов в пищевой промышленности.


    Благодарности

    Финансирование: Нет.


    Провенанс и экспертная оценка: Эта статья написана по заказу редакции Translational Cancer Research для серии «Нанотехнологии в радиационных исследованиях».Статья прошла независимую рецензию.

    Конфликты интересов: Оба автора заполнили единую форму раскрытия информации ICMJE (доступна по адресу http://dx.doi.org/10.3978/j.issn.2218-676X.2013.08.12). Серия «Нанотехнологии в радиационных исследованиях» была заказана редакцией без какого-либо финансирования и спонсорства. RVLP выступал в качестве бесплатного приглашенного редактора серии и неоплачиваемого члена редакционной коллегии Translational Cancer Research .Авторы не заявляют о других конфликтах интересов.

    Этическое заявление: Авторы несут ответственность за все аспекты работы, гарантируя, что вопросы, связанные с точностью или целостностью любой части работы, должным образом исследованы и решены.

    Заявление об открытом доступе: Это статья в открытом доступе, распространяемая в соответствии с международной лицензией Creative Commons Attribution-NonCommercial-NoDerivs 4.0 (CC BY-NC-ND 4.0), что разрешает некоммерческое тиражирование и распространение статьи со строгим условием, что не будут вноситься никакие изменения или исправления, а оригинальная работа должным образом процитирована (включая ссылки как на официальную публикацию через соответствующий DOI, так и на лицензию). См. Https://creativecommons.org/licenses/by-nc-nd/4.0/.


    Ссылки

    1. Моенс Э., Велдхоен М. Биология эпителиального барьера: хорошие заборы - хорошие соседи. Иммунология 2012; 135: 1-8. [PubMed]
    2. Clemente JC, Ursell LK, Parfrey LW, et al.Влияние микробиоты кишечника на здоровье человека: комплексный взгляд. Cell 2012; 148: 1258-70. [PubMed]
    3. Фрэнк Д.Н., Пейс Н.Р. Молекулярно-филогенетический анализ микробиоты желудочно-кишечного тракта человека. Curr Opin Gastroenterol 2001; 17: 52-7. [PubMed]
    4. Pullan RD, Thomas GA, Rhodes M, et al. Толщина прилипшего геля слизи на слизистой оболочке толстой кишки у людей и его значение для колита. Gut 1994; 35: 353-9. [PubMed]
    5. Йоханссон М.Э., Филлипсон М., Петерссон Дж. И др. Внутренний из двух слоев слизи, зависимой от муцина Muc2 в толстой кишке, лишен бактерий.Proc Natl Acad Sci U S A 2008; 105: 15064-9. [PubMed]
    6. Подольский ДК. Текущее будущее понимание воспалительного заболевания кишечника. Лучшая практика Res Clin Gastroenterol 2002; 16: 933-43. [PubMed]
    7. Arumugam M, Raes J, Pelletier E, et al. Энтеротипы микробиома кишечника человека. Природа 2011; 473: 174-80. [PubMed]
    8. Turnbaugh PJ, Ley RE, Mahowald MA, et al. Микробиом кишечника, связанный с ожирением, с повышенной способностью собирать энергию. Nature 2006; 444: 1027-31. [PubMed]
    9. Flint HJ, Bayer EA, Rincon MT, et al.Использование полисахаридов кишечными бактериями: потенциал для новых открытий на основе геномного анализа. Nat Rev Microbiol 2008; 6: 121-31. [PubMed]
    10. Дай З.Л., Ву Г, Чжу, Вайоминг. Аминокислотный метаболизм в кишечных бактериях: связь между экологией кишечника и здоровьем хозяина. Front Biosci (Landmark Ed) 2011; 16: 1768-86. [PubMed]
    11. Corr SC, Hill C, Gahan CG. Понимание механизмов, с помощью которых пробиотики подавляют патогены желудочно-кишечного тракта. Adv Food Nutr Res 2009; 56: 1-15. [PubMed]
    12. Косевич М.М., Зирнхельд А.Л., Алард П.Микробиота кишечника, иммунитет и болезнь: сложная взаимосвязь. Front Microbiol 2011; 2: 180. [PubMed]
    13. DuPont AW, DuPont HL. Микробиота кишечника и хронические заболевания кишечника. Нат Рев Гастроэнтерол Гепатол 2011; 8: 523-31. [PubMed]
    14. Ley RE, Bäckhed F, Turnbaugh P, et al. Ожирение изменяет микробную экологию кишечника. Proc Natl Acad Sci U S A 2005; 102: 11070-5. [PubMed]
    15. Mueller C, Macpherson AJ. Слои мутуализма с комменсальными бактериями защищают нас от воспаления кишечника.Кишечник 2006; 55: 276-84. [PubMed]
    16. Диксвед Дж., Халфварсон Дж., Розенквист М. и др. Молекулярный анализ микробиоты кишечника однояйцевых близнецов с болезнью Крона. ISME J 2008; 2: 716-27. [PubMed]
    17. Spor A, Корен О., Лей Р. Выявление влияния окружающей среды и генотипа хозяина на микробиом кишечника. Nat Rev Microbiol 2011; 9: 279-90. [PubMed]
    18. Marchesi JR, Dutilh BE, Hall N, et al. К микробиому колоректального рака человека. PLoS One 2011; 6: e20447 [PubMed]
    19. Sobhani I, Tap J, Roudot-Thoraval F, et al.Микробный дисбактериоз у пациентов с колоректальным раком (CRC). PLoS One 2011; 6: e16393 [PubMed]
    20. Castellarin M, Warren RL, Freeman JD, et al. Инфекция Fusobacterium nucleatum широко распространена при колоректальной карциноме человека. Genome Res 2012; 22: 299-306. [PubMed]
    21. Костич А.Д., Геверс Д., Педамаллу С.С. и др. Геномный анализ выявляет ассоциацию Fusobacterium с колоректальной карциномой. Genome Res 2012; 22: 292-8. [PubMed]
    22. Эйрес Дж. С., Тринидад, штат Нью-Джерси, Вэнс, RE. Смертельная активация инфламмасом патобионтом с множественной лекарственной устойчивостью при разрушении микробиоты антибиотиками.Нат Мед 2012; 18: 799-806. [PubMed]
    23. Уэйкфорд Р. Радиационные эффекты: модулирующие факторы и оценка риска - обзор. Анн ICRP 2012; 41: 98-107. [PubMed]
    24. Packey CD, Ciorba MA. Влияние микробов на реакцию тонкого кишечника на лучевое поражение. Курр Опин Гастроэнтерол 2010; 26: 88-94. [PubMed]
    25. Циммерер Т., Бёкер Ю., Венц Ф. и др. Медицинская профилактика и лечение острого и хронического лучевого энтерита - есть ли проверенная терапия? Краткий обзор. Z Gastroenterol 2008; 46: 441-8.[PubMed]
    26. Brook I, Elliott TB, Ledney GD, et al. Ведение пострадиационного сепсиса. Мил Мед 2002; 167: 105-6. [PubMed]
    27. Lam V, Moulder JE, Salzman NH, et al. Кишечная микробиота как новые биомаркеры предшествующего радиационного облучения. Радиат Рес 2012; 177: 573-83. [PubMed]
    28. Кроуфорд С. Пришло ли время для новой парадигмы системного лечения рака? Уроки века химиотерапии рака. Front Pharmacol 2013; 4: 68. [PubMed]
    29. Stringer AM, Gibson RJ, Bowen JM, et al.Мукозит, вызванный химиотерапией: роль микрофлоры желудочно-кишечного тракта и муцинов в просветной среде. J Support Oncol 2007; 5: 259-67. [PubMed]
    30. van Vliet MJ, Harmsen HJ, de Bont ES, et al. Роль кишечной микробиоты в развитии и тяжести мукозита, вызванного химиотерапией. PLoS Pathog 2010; 6: e1000879 [PubMed]
    31. Робертс А.Б., Уоллес Б.Д., Венкатеш М.К. и др. Молекулярное понимание ингибирования микробной β-глюкуронидазы для отмены токсичности СРТ-11. Мол Pharmacol 2013; 84: 208-17.[PubMed]
    32. Lin XB, Dieleman LA, Ketabi A, et al. Химиотерапия иринотеканом (CPT-11) изменяет микробиоту кишечника у крыс с опухолями. PLoS One 2012; 7: e39764 [PubMed]
    33. Holma R, Korpela R, Sairanen U, et al. Производство метана в толстой кишке изменяет желудочно-кишечную токсичность, связанную с адъювантной химиотерапией 5-фторурацилом при колоректальном раке. Дж. Клин Гастроэнтерол 2013; 47: 45-51. [PubMed]
    34. van Vliet MJ, Tissing WJ, Dun CA, et al. Химиотерапевтическое лечение у педиатрических пациентов с острым миелоидным лейкозом, получающих противомикробную профилактику, приводит к относительному увеличению колонизации потенциально патогенными бактериями в кишечнике.Clin Infect Dis 2009; 49: 262-70. [PubMed]
    35. Фон Бюлтцингсловен I, Адлерберт I, Вольд А.Е. и др. Микрофлора полости рта и кишечника у крыс, получавших 5-фторурацил, транслокация в шейные и брыжеечные лимфатические узлы и эффекты пробиотических бактерий. Устный микробиол иммунол 2003; 18: 278-84. [PubMed]
    36. Гибсон Р.Дж., Боуэн Дж.М., Альварес Э. и др. Создание однократной дозы иринотекана при желудочно-кишечном мукозите. Химиотерапия 2007; 53: 360-9. [PubMed]
    37. Остерлунд П., Руотсалайнен Т., Корпела Р. и др.Добавка Lactobacillus при диарее, связанной с химиотерапией колоректального рака: рандомизированное исследование. Br J Cancer 2007; 97: 1028-34. [PubMed]
    38. Wu GD, Chen J, Hoffmann C, et al. Связь долгосрочных диетических моделей с кишечными микробными энтеротипами. Наука 2011; 334: 105-8. [PubMed]
    39. Гофна У. Микробиология. Кишечник диетических привычек. Наука 2011; 334: 45-6. [PubMed]
    40. Zoetendal EG, Akkermans AD, De Vos WM. Анализ гель-электрофореза в градиенте температуры 16S рРНК из образцов фекалий человека выявляет стабильные и специфичные для хозяина сообщества активных бактерий.Appl Environ Microbiol 1998; 64: 3854-9. [PubMed]
    41. Джернберг С., Лёфмарк С., Эдлунд С. и др. Долгосрочное воздействие антибиотиков на микробиоту кишечника человека. Микробиология 2010; 156: 3216-23. [PubMed]
    42. Парри С.Д., Бартон-младший, МР по благосостоянию. Факторы, связанные с развитием постинфекционных функциональных заболеваний ЖКТ: играет ли роль курение? Eur J Gastroenterol Hepatol 2005; 17: 1071-5. [PubMed]
    43. Чорба М.А., Стенсон В.Ф. Пробиотическая терапия при радиационно-индуцированном поражении и восстановлении кишечника.Энн Н. Ю. Акад. Наук 2009; 1165: 190-4. [PubMed]
    44. Delzenne NM, Neyrinck AM, Cani PD. Модуляция микробиоты кишечника питательными веществами с пребиотическими свойствами: последствия для здоровья хозяина в контексте ожирения и метаболического синдрома. Факт о микробных клетках 2011; 10: S10. [PubMed]
    45. O’Keefe SJ. Питание и здоровье толстой кишки: критическая роль микробиоты. Curr Opin Gastroenterol 2008; 24: 51-8. [PubMed]
    46. Roy CC, Kien CL, Bouthillier L, et al. Короткоцепочечные жирные кислоты: готовы к прайм-тайму? Нутр Клин Практ 2006; 21: 351-66.[PubMed]
    47. Окавара С., Фуруя Х., Нагашима К. и др. Пероральное введение butyrivibrio fibrisolvens, бактерии, продуцирующей бутират, снижает образование аберрантных очагов крипт в толстой и прямой кишке мышей. J Nutr 2005; 135: 2878-83. [PubMed]
    48. Умар С., Моррис А.П., Курума Ф. и др. Диетический пектин и кальций ингибируют пролиферацию толстой кишки in vivo с помощью различных механизмов. Cell Prolif 2003; 36: 361-75. [PubMed]
    49. Чандракесан П., Ахмед И., Анвар Т. и др. Новые изменения активности NF- {kappa} B во время фаз прогрессирования и регресса гиперплазии: роль MEK, ERK и p38.J Biol Chem 2010; 285: 33485-98. [PubMed]
    50. Чандракесан П., Ахмед И., Чинталапалли А. и др. Отчетливая компартментализация активности NF-κB в крипте и собственной пластинке, лишенной крипт, предшествует и сопровождает гиперплазию и / или колит после бактериальной инфекции. Инфекция Иммун 2012; 80: 753-67. [PubMed]
    51. Potten CS, Kovacs L, Hamilton E. Непрерывные исследования мечения на коже и кишечнике мышей. Cell Tissue Kinet 1974; 7: 271-83. [PubMed]
    52. Sangiorgi E, Capecchi MR. Bmi1 экспрессируется in vivo в стволовых клетках кишечника.Нат Генет 2008; 40: 915-20. [PubMed]
    53. Montgomery RK, Carlone DL, Richmond CA, et al. Экспрессия обратной транскриптазы теломеразы мыши (mTert) маркирует медленно циркулирующие кишечные стволовые клетки. Proc Natl Acad Sci U S A 2011; 108: 179-84. [PubMed]
    54. Мэй Р., Риль Т.Э., Хант С. и др. Идентификация новых предполагаемых стволовых клеток желудочно-кишечного тракта и маркера стволовых клеток аденомы, даблкортина и СаМ-киназы-1, после лучевого поражения и у мышей с аденоматозным полипозом кишечной палочки / множественной кишечной неоплазией.Стволовые клетки 2008; 26: 630-7. [PubMed]
    55. Баркер Н., ван Эс Дж. Х., Койперс Дж. И др. Идентификация стволовых клеток тонкой и толстой кишки по маркерному гену Lgr5. Природа 2007; 449: 1003-7. [PubMed]
    56. Takeda N, Jain R, LeBoeuf MR, et al. Взаимопревращение популяций кишечных стволовых клеток в разных нишах. Наука 2011; 334: 1420-4. [PubMed]
    57. Тиан Х., Бис Б., Уорминг С. и др. Популяция резервных стволовых клеток в тонком кишечнике делает ненужными Lgr5-положительные клетки. Природа 2011; 478: 255-9.[PubMed]
    58. Haegebarth A, Clevers H. Передача сигналов Wnt, lgr5 и стволовые клетки в кишечнике и коже. Ам Дж. Патол 2009; 174: 715-21. [PubMed]
    59. Баркер Н., Риджуэй Р.А., ван Эс Дж. Х. и др. Стволовые клетки крипт как клетки происхождения рака кишечника. Природа 2009; 457: 608-11. [PubMed]
    60. Наканиши Ю., Сено Х., Фукуока А. и др. Dclk1 различает опухолевые и нормальные стволовые клетки кишечника. Нат Генет 2013; 45: 98-103. [PubMed]
    61. Moossavi S, Zhang H, Sun J, et al.Взаимодействие хозяина и микробиоты и стволовые клетки кишечника при хроническом воспалении и колоректальном раке. Эксперт Rev Clin Immunol 2013; 9: 409-22. [PubMed]
    62. Мэй Р., Суребан С.М., Хоанг Н. и др. Doublecortin и CaM-киназа-1 и рецептор, связанный с G-белком, содержащий богатые лейцином повторы, маркируют покоящиеся и циркулирующие кишечные стволовые клетки, соответственно. Стволовые клетки 2009; 27: 2571-9. [PubMed]
    63. Saqui-Salces M, Keeley TM, Grosse AS, et al. Клетки пучка желудка экспрессируют DCLK1 и увеличиваются при гиперплазии.Histochem Cell Biol 2011; 136: 191-204. [PubMed]
    64. Дэвидсон Л.А., Голдсби Дж.С., Каллавей Е.С. и др. Изменение сигнатур генов стволовых клеток толстой кишки во время регенеративного ответа на повреждение. Biochim Biophys Acta 2012; 1822: 1600-7.
    65. Yilmaz ÖH, Katajisto P, Lamming DW, et al. mTORC1 в нише клеток Панета связывает функцию кишечных стволовых клеток с потреблением калорий. Природа 2012; 486: 490-5. [PubMed]
    66. Чандракесан П., Рой Б., Джаккула Л.Ю. и др. Полезность модели бактериальной инфекции для изучения эпителиально-мезенхимального перехода, мезенхимально-эпителиального перехода или туморогенеза.Онкоген 2013; [Epub перед печатью]. [PubMed]

    Цитируйте эту статью как: Папинени Р.В.Л., Умар С. Обратите внимание на микробиоту кишечника. Перевод Cancer Res 2013; 2 (4): 359-369. doi: 10.3978 / j.issn.2218-676X.2013.08.12

    Трансплантация фекалий может восстановить микрофон кишечника

    Кишечник человека содержит разнообразную экосистему микробов: в основном бактерии, а также вирусы и грибы, называемые кишечной микробиотой. Последние годы показали, что микробиота кишечника оказывает широкое влияние на общее функционирование организма хозяина.

    Обычно младенцы получают кишечные бактерии от матери при рождении. Некоторые из этих материнских бактерий растут в младенце, поскольку они помогают ребенку переваривать грудное молоко.

    Было показано, что рождение путем кесарева сечения (кесарево сечение) особенно вредно для нормального развития микробиоты кишечника. Во время родов путем кесарева сечения младенцы не подвергаются воздействию материнских фекальных микробов, и это предотвращает естественную передачу микробов от матери к ребенку.

    В недавно опубликованном исследовании исследователи, в основном из Университета Хельсинки, оценили, можно ли восстановить нарушенное развитие кишечной микробиоты у доношенных новорожденных после кесарева сечения с помощью послеродовой пероральной трансплантации материнской фекальной микробиоты (FMT).FMT успешно применялся у взрослых для нормализации состава кишечной микробиоты и лечения таких заболеваний, как рецидивирующие инфекции Clostridium difficile .

    Результаты исследования опубликованы в научном журнале Cell .

    «Рождение через кесарево сечение связано с повышенным риском многих заболеваний, связанных с иммунной системой, что позволяет предположить, что отсутствие материнских микробов в раннем возрасте может иметь долгосрочные последствия для здоровья ребенка. Это доказательное исследование демонстрирует, что кишечная микробиота младенцев, рожденных с помощью кесарева сечения, может быть постнатально восстановлена ​​с помощью материнской FMT и обеспечивает дополнительную поддержку естественной передачи кишечной микробиоты от матери к младенцу », - говорит Виллем де Вос, профессор микробиомики человека, который был старшим специалистом. автор исследования.

    Процедура снижает риски, связанные с аномальной микробиотой кишечника.

    Исследователи применили FMT сразу после рождения, используя образцы фекалий матери младенцев. Поскольку фекалии могут содержать опасные патогены, они сначала были тщательно проверены. Из 17 протестированных матерей у 7 были образцы, свободные от патогенов, и они были отобраны для исследования.

    Все семь новорожденных с кесаревым сечением, получивших FMT, остались здоровыми и не испытали никаких отрицательных эффектов от лечения.Состав их кишечной микробиоты отслеживали в течение 3 месяцев и сравнивали с составом нелеченных младенцев, рожденных с помощью кесарева сечения и младенцев, рожденных естественным путем.

    «Микробиота кишечника младенцев, получавших FMT, очень быстро стала похожей на микробиоту младенцев, рожденных естественным путем. Она не походила на микробиоту необработанных младенцев, рожденных кесаревым сечением, что показывает, что лечение было эффективным в восстановлении нормального развития микробиоты», - говорит Доктор Катри Корпела, первый автор исследования.

    «Эта простая процедура может нормализовать колонизацию и развитие кишечной микробиоты у младенцев, рожденных кесаревым сечением, что, вероятно, будет способствовать снижению риска развития хронических заболеваний, которые могут возникнуть из-за аномальной микробиоты кишечника», - добавляет доктор.Отто Хельве, доктор медицины, специалист по детским инфекционным заболеваниям и первый автор исследования.

    «Эту процедуру следует выполнять только после тщательного скрининга матери на наличие потенциальных патогенов», - подчеркивает профессор Стуре Андерссон, неонатолог, который также был старшим автором публикации.

    ###



    Заявление об отказе от ответственности: AAAS и EurekAlert! не несут ответственности за точность выпусков новостей, размещенных на EurekAlert! участвующими учреждениями или для использования любой информации через систему EurekAlert.

    Двунаправленные взаимодействия между индометацином и кишечной микробиотой мышей

    Существенные изменения:

    Основные проблемы, отраженные в комментариях рецензентов ниже, касались дозировки индометацина и выбора временных точек исследования, анализа 16S и его результатов с учетом большого эффекта носителя, а также недостаточного экспериментального исследования и обсуждения того, как лекарство является посредником. Повреждение SI приводит к более широким биогеографическим сдвигам, например.грамм. LI микробиом.

    В ответ на существенные исправления редакции:

    1) Доза индометацина была выбрана по следующим причинам:

    Согласно руководству FDA, доза 10 мг / кг массы тела у мышей эквивалентна 0,81 мг / кг массы тела у человека (48,8 мг для человека весом 60 кг). Это дозировка, которая обычно используется для лечения острой боли, а также ревматоидного артрита и остеоартрита. Эта доза также широко используется в экспериментальных моделях на животных, чтобы вызвать повреждение кишечника (Fukumoto et al.2011, Танигава и др. 2013).

    В этой дозе индометацин успешно ингибирует ферменты ЦОГ-1 и ЦОГ-2 in vivo, на что указывает значительно сниженный уровень метаболитов простагландина в моче. Эта информация была представлена ​​на Рисунке 2 - приложении к рисунку 2. В нашем исследовании, а также в предыдущих отчетах было показано, что эта доза вызывает поражения тонкого кишечника. Наши данные представлены на рисунке 2 - приложение к рисунку 1.

    В нашем эксперименте по хроническому лечению в рационе содержалось 20 частей на миллион индометацина.Для взрослой мыши весом 25 г, потребляющей 4 г в день, это составляет 3,2 мг / кг / день. Эта доза была выбрана на основании предыдущих отчетов, показывающих подавление простаноидов индометацином (Chiu et al. 2000, Leibowitz et al. 2014, Fjaere et al. 2014). Этот эквивалент дозы меньше, чем при остром режиме дозирования, чтобы обеспечить переносимость и соблюдение нормативных требований. Причины выбранных доз теперь более четко указаны в отредактированной рукописи.

    2) 6-часовой курс лечения был выбран по следующим причинам:

    Шесть часов - это примерно период полураспада индометацина у грызунов.Через шесть часов после введения дозы до появления индуцированных индометацином поражений; следовательно, это позволяет нам изучить потенциальную роль кишечной микробиоты в развитии индуцированного индометацином поражения кишечника. Поражения в тонкой кишке были обнаружены через 24 часа. Следовательно, анализ через 6 часов после обработки исключил возможные вызванные поражением изменения в микробном составе. Эти причины теперь более четко изложены в переработанной рукописи.

    3) Секвенирование гена 16S рРНК - влияние носителя и выбор окна V1-V2:

    Транспортное средство, использованное в острых исследованиях, имело заметный эффект.ПЭГ был необходим для солюбилизации индометацина для исследований дозирования в кратчайшие сроки, но ПЭГ также является компонентом смесей для лаважа, используемых для подготовки кишечника у людей, и поэтому сильно влияет на присутствующие микробы. Здесь обработка ПЭГ привела к получению более мягких гранул и изменению микробиоты. Использование только ПЭГ в качестве контроля указывает на влияние индометацина сверх эффекта носителя в исследовании с острым дозированием. В долгосрочном исследовании дозирования ПЭГ не использовался, и наблюдались некоторые из тех же изменений бактериального состава, несмотря на более низкое системное воздействие индометацина, что опять же согласуется с влиянием как ПЭГ, так и индометацина на микробный состав.

    Что касается выбора области V1-V2 гена 16S рРНК для секвенирования, было обнаружено, что эта область дает хорошее разделение в наборах образцов из множества различных контрольных исследований и экспериментов в лабораториях Гордона, Найта, Бушмана и других (Liu и др., 2007 г., Чакраворти и др., 2007 г., Ву и др., 2010 г.). Все окна последовательности 16S, используемые для анализа, лучше восстанавливают показания одних бактерий, чем других. Например, известно, что окно V1-V2 смещено в отношении бифидобактерий, но эта группа обычно не встречается в фекальном микробиоме мышей.Таким образом, мы считаем, что область V1-V2 является здесь разумным выбором. Мы добавили обсуждение этих вопросов в исправленную рукопись.

    4) Связь между повреждением тонкого кишечника и микробными сдвигами в толстом кишечнике:

    Хотя мы не выявили статистически значимых изменений в бактериальных сообществах, проживающих в тонком кишечнике (SI), это не обязательно позволяет нам сделать вывод о том, что индометацин не влияет на микробиоту SI. Как показано на рисунке 1, микробиота SI проявляет большую вариабельность среди людей, чем в толстом кишечнике (LI), что может маскировать изменения состава, вызванные индометацином.

    Индометацин также вызывает повреждение нижних отделов желудочно-кишечного тракта. Сообщалось о значительном увеличении проницаемости толстой кишки (Suenaert et al. 2003), язве и кровотечении толстой кишки (Oren, Ligumsky 1994), множественных перфорациях толстой кишки (Loh et al. 2011) и кровотечениях (Langman et al. 1985) у пациентов, получавших индометацин. . Данные свидетельствуют о том, что частота осложнений со стороны верхних и нижних отделов желудочно-кишечного тракта, вызванных НПВП, схожа (Sostres et al. 2013). Изменения состава в толстом кишечнике, вызванные индометацином, также могут быть вовлечены в эти воспалительные процессы.

    Кишечные бактерии постоянно взаимодействуют с другими видами и с хозяином, частично через метаболиты, которые они синтезируют. Измененные популяции бактерий могут секретировать молекулы, которые изменяют местную среду или попадают в кровоток, тем самым изменяя межбактериальные взаимодействия или физиологию хозяина, что, возможно, влияет на патогенез поражений кишечника. Возможные механизмы являются предметом текущих исследований - неясно, механически ли популяции микробов вовлечены в повреждение кишечника.Теперь мы разъясняем это в исправленной рукописи.

    Рецензент № 1:

    В то время как область и тема подходят для eLife и представляют собой сильную попытку координировать биогеографические данные с взаимными эффектами между микробиотой и хозяином (область, которая становится научной темой все более широко), есть несколько проблем, касающихся методологии и интерпретация этой работы. Основные опасения связаны с планом эксперимента [дозировка индометацина и временные точки, выбранные в этом исследовании (6 часов), которые используются для описания работы как продольной].Обоснуйте, пожалуйста, выбор в пользу использования такой травматической дозировки, а не дозировки, более подходящей для использования препарата в терапевтических целях / в целях контроля симптомов, учитывая цель исследования - использовать мышиные модели для механического выяснения взаимодействия хозяина, микроба и лекарства. в людях. Кроме того, учитывая изменения, происходящие в микробиоме в течение диетических, циркадных циклов и т. Д., Более длительные сроки предоставят более актуальную информацию о влиянии индометацина на микробиоту. В идеале эксперименты в этом исследовании должны проводиться в течение периода времени в несколько недель с субвоспалительными дозами индометацина и включать такие временные данные.

    Мы ценим комментарии рецензента по поводу дизайна эксперимента, включая выбор дозы, выбор временной точки и обоснование использования области V1-V2 гена 16S рРНК. Эти вопросы рассматриваются выше.

    Мы согласны с тем, что влияние длительного лечения индометацином на микробный состав является важным вопросом, поэтому после комментария автора обзора мы провели дополнительный эксперимент, в котором мыши получали контрольную диету или индометацин в рационе (20 частей на миллион) в течение 7 дней.Данные и интерпретация представлены в отредактированной рукописи. Хроническое лечение также вызывало распространение Peptococcaceae и Erysipelotrichaceae в желудочно-кишечном тракте и Ruminococcus и Anearoplasma в кале, что согласуется с предыдущими результатами исследования острого лечения. Очевидно, эти роды ответили на индометацин как в начальной фазе, так и в более отдаленной перспективе. Мы также заметили, что несколько острых изменений, вызванных лечением, были менее значительными в долгосрочном исследовании дозирования.Может случиться так, что эти изменения участвуют только в первоначальном ответе, или временные вариации перекрывают изменения, вызванные лекарством. Дополнительные возможности включают различную величину системного воздействия лекарств, способы доставки лекарств и неодинаковую микробиоту мышей в начале эксперимента. Эти возможности будут рассмотрены в дальнейших исследованиях, выходящих за рамки данной рукописи.

    Конкретные моменты: 1) Пожалуйста, объясните / рассмотрите возможность выбора V1-V2 для секвенирования гена 16S рРНК вместо V3-V4 в соответствии со стандартами проекта Earth Microbiome.

    Использование гена 16S рРНК V1-V2 для секвенирования оправдано в комментарии № 3 к существенным изменениям, приведенном выше.

    2) Добавьте объясненное процентное отклонение к рисунку PCoA.

    Процентное отклонение было добавлено к осям на каждом графике PCoA в соответствии с запросом.

    3) Результаты, параграф 2, кажутся неясными / не подтверждаемыми данными проксимального LI.

    Теперь они поддерживаются числовыми данными.

    4) Результаты, абзац шестой: Подтверждение с помощью qPCR или другого метода, такого как FISH, усилит этот раздел.

    Мы согласны с рецензентом в том, что изменения численности бактерий могут быть усилены конформацией с другими методами. Как упоминалось выше, мы воспроизвели ключевые изменения состава, наблюдаемые в исследовании острых состояний, в недавно добавленном исследовании долгосрочного дозирования.

    5) Учитывая, что повреждение происходит в SI, в Обсуждении следует уделить больше внимания влиянию на микробиоту LI. Почему эти изменения могут произойти здесь? Существуют ли проверяемые гипотезы, которые можно выдвинуть?

    Обсуждение микробных сдвигов в LI и повреждении SI представлено под комментарием № 4 к существенным изменениям выше, а также в пересмотренном разделе «Обсуждение».

    6) Совпадают ли фекальные данные на Рисунке 2 с данными, использованными в «продольном» исследовании на Рисунке 3? Пожалуйста, уточните / объедините, чтобы избежать повторения данных.

    Данные о фекалиях, представленные на рисунках 2 и 3, частично совпадают, но не повторяются. На рисунке 2 показаны географические изменения, вызванные лечением индометацином через 6 часов в трех группах. Микробиота фекалий рассматривалась как расширение микробиоты просвета кишечника, поэтому она была предоставлена ​​как часть этого анализа.Однако, поскольку это поперечный анализ, на рисунке 2 представлены данные о фекалиях только за 6 часов. Рисунок 3, с другой стороны, иллюстрирует временные изменения фекальной микробиоты у каждой отдельной мыши путем сравнения микробного состава до (0 часов) и после (6h) лечение индометацином в отдельных группах. Следовательно, данные о фекальной микробиоте не повторялись.

    7) В «продольных» исследованиях (рис. 3) почти кажется, что мыши, получавшие индометацин, были «ненормальными» при t = 0, а не отличались от необработанного контроля при t = 6 часов.Уточните выбор данных для сравнения в статистических целях.

    Мы согласны с автором обзора в том, что при t = 0 ч между обработанными мышами и контрольными мышами были различия. Хорошо известно, что состав кишечной микробиоты сильно различается у разных людей. Мы рандомизировали распределение мышей по каждой группе и, что важно, контролировали влияние клетки в рамках статистического анализа. Мы сравниваем внутриличностные изменения, вызванные изменениями индометацина, поэтому каждый индивидуум служит их собственным контролем, что еще больше подтверждает наш вывод.

    Рецензент № 2:

    Лян и его коллеги представляют рукопись, богатую данными, но, к сожалению, без учебника. Хотя в этой рукописи содержится огромное количество информации, в ней отсутствует научный контекст, что оказывает медвежью услугу количеству содержащихся в ней данных. Читателю будет полезно, если авторы предоставят контекст для каждого проведенного эксперимента. Кроме того, в тексте много устаревших цитат и много опечаток, которые следует отредактировать.Что наиболее важно, в этой рукописи явно не хватает синтеза и интерпретации данных, что является основной причиной того, что рецензент не заинтересован в принятии рукописи как есть.

    Мы высоко оценили комментарии рецензента по поводу языка и цитат и в ответ внесли значительные изменения в рукопись.

    Конкретная критика: 1) Введение содержит цитаты еще с 1977 года и не упоминает современные работы, такие как работы Боелстерли и его коллег.На более современные цитаты следует ссылаться как во Введении, так и в Обсуждении.

    В отредактированной рукописи мы процитировали работы Боелстерли и других во Введении и Обсуждении.

    2) Авторы должны включить краткое описание жаргона, такого как «индекс Шеннона» и т. Д., Которые знакомы только специалистам в данной области, а не широкой аудитории.

    По запросу мы добавили краткое описание индекса Шеннона.

    3) Каковы клинические последствия этих открытий? Это должно быть рассмотрено в разделе «Обсуждение » .Влияет ли одновременное лечение антибиотиками на эффективность или побочные эффекты (хронического или острого) лечения НПВП? Обзор литературы может ответить на этот вопрос, который следует включить в обсуждение.

    Клинические последствия теперь более подробно обсуждаются в новой редакции «Обсуждение».

    4) Как правило, в тонкой кишке наблюдается повреждение, опосредованное НПВП. Какое значение имеет обнаружение распространения Erysipelotrichaceae на слизистой оболочке толстой кишки?

    Мы обсудили проблему, заключающуюся в том, что изменения были обнаружены в микробиоте толстой кишки, в то время как повреждение присутствовало в тонкой кишке, в ответ на комментарий редактора № 4 Essential Revisions, а также в обновленном Обсуждении.Экспансия Erysipelotrichaceae была связана с повреждением печени, вызванным парентеральным питанием, ожирением, колоректальным раком и болезнью Крона, что указывает на провоспалительную роль Erysipelotrichaceae . Однако из-за отсутствия в настоящее время знаний об этих бактериях и их потенциальной причинной связи с этими заболеваниями, еще слишком рано делать вывод о значении экспансии Erysipelotrichaceae в индуцированной индометацином токсичности желудочно-кишечного тракта.

    5) На рисунке 3A есть некоторые проблемы: авторы упоминают отдельные кластеры, образующиеся в группе индометацина, однако они не видны на рисунке, который выглядит как полностью перекрывающиеся синие и черные круги.Аналогичным образом, каково значение двух основных кластеров, наблюдаемых в группе, получавшей PEG-400? Кажется, что черные и синие точки перекрываются во всех случаях. Просьба уточнить.

    На рисунке 3A мы выполнили тест ADONIS (Anderson 2001) на взвешенных расстояниях UniFrac, чтобы проверить кластеризацию образцов на основе обработки, и результаты были представлены в разделе «Результаты».

    6) Могут ли авторы прокомментировать, почему индометацин может активировать Ruminococceae spp? В том же духе авторы могли бы прокомментировать, почему PEG-400 может активировать другие виды.

    Автор обзора запросил возможное объяснение распространения Ruminococceae spp при лечении индометацином, а также аналогичных эффектов, связанных с лечением ПЭГ-400. Мы думаем, что может быть несколько механизмов, с помощью которых ксенобиотики вызывают изменения состава кишечной микробиоты, в том числе те, о которых ранее сообщали другие. Одним из примеров может служить модель перекрестного кормления. Некоторые комменсальные бактерии могут напрямую потреблять ксенобиотики и выделять метаболиты в окружающую среду, которые могут использоваться другими бактериями для ускорения своего роста.Другим примером может быть влияние хозяина, когда ксенобиотики влияют на характеристики хозяина (особенно в локальной среде кишечника) и вызывают изменения в иммунной регуляции кишечных бактерий. Chassaing и его коллеги (Chassaing et al.2015) сообщили, что диетические эмульгаторы, такие как карбоксиметилцеллюлоза и полисорбат-80, изменяют локализацию микробов, а также количество ОТЕ. Однако они не установили причинно-следственную связь между локализацией и измененными OTU.Необходимы дальнейшие исследования, чтобы понять механизм вызванных ксенобиотиками изменений у бактерий.

    7) Дополнительные цифры: у некоторых отсутствуют метки (например, на гистологическом изображении отсутствуют подписи).

    По запросу мы добавили подписи к изображениям гистологии.

    8) Авторам следует потратить больше времени на описание рисунка 4, который содержит очень важную информацию. Авторы «рассмотрели гипотезу», но на самом деле не сделали вывод и не коррелировали с тем, как это влияет на схемы лечения НПВП (см. Комментарий № 3).Намек на это делается в четвертом параграфе Обсуждения, но необходимо более глубокое обсуждение.

    Мы добавили более подробное обсуждение рисунка 4 в разделе «Результат и обсуждение» отредактированной рукописи.

    9) Авторы обнаруживают, что нарушения кишечной микробиоты, в частности, возникают в слепой кишке, толстой кишке и кале; тем не менее, основная часть атак НПВП происходит в тонком кишечнике, что ясно продемонстрировано по крайней мере тремя статьями Боелстерли и его коллег о повреждении НПВП и его облегчении.Как изменения состава в более дистальной части желудочно-кишечного тракта влияют на патологию более проксимально?

    Обсуждение микробных сдвигов в LI и повреждений SI представлено в п. 4 выше, а также в пересмотренном разделе «Обсуждение».

    10) Какое вещество измеряется на рисунке 5 - дополнение к рисунку 1A?

    Вещества, измеряемые на фиг. 5 - приложение к рисунку 1А, помечены на каждой панели: ацил-β-D-глюкуронид индометацин на верхней панели; индометацин на средней панели; и d4-индометацин на нижней панели.

    11) Авторы отмечают истощение числа копий 16S и уменьшение микробного разнообразия после лечения антибиотиками, а также рост Proteobacteria. Влияют ли протеобактерии на токсичность индометацина для желудочно-кишечного тракта, и если да, то как?

    Автор обзора указал, что распространение Proteobacteria после лечения антибиотиками, и поставил под сомнение, повлияет ли это на токсичность индометацина для желудочно-кишечного тракта. Модель лечения антибиотиками была создана для изучения роли бактерий в метаболизме индометацина, а не токсичности желудочно-кишечного тракта, поскольку распространение Proteobacteria не было вызвано лечением индометацином.Кроме того, согласно предыдущим исследованиям, активность β-глюкуронидазы у Proteobacteria не была обнаружена (Dabek et al. 2008, Gloux et al. 2011), поэтому маловероятно, что эти бактерии будут влиять на воздействие индометацина в организме хозяина. Таким образом, текущие данные не подтверждают влияние Proteobacteria на индуцированную индометацином энтеропатию.

    12) Предположение о том, что бактерии содержат β -глюкуронидазы, наряду с одной цитатой из Roberts et al. недостаточно, чтобы связать эту работу с хорошо установленными данными Рединбо и его коллег, показывающими не только то, что бактерии имеют β

    .

    -глюкуронидазы, но эти ферменты непосредственно участвуют в повреждении желудочно-кишечного тракта, вызванном НПВП.Кроме того, они показывают, что ингибирование этих бактериальных ферментов может уменьшить это повреждение. Мы благодарим рецензента за то, что он упомянул предыдущую работу Redinbo и коллег, которая теперь цитируется. Тем не менее, наше исследование является первым, в котором фармакокинетика и фармакодинамика связываются, обеспечивая двунаправленное воздействие между кишечной микробиотой и индометацином.

    Рецензент № 3:

    Liang et al.

    представляет серию исследований, в которых проверяется влияние НПВП индометацина на микробиоту кишечника, а также роль микробиоты в фармакокинетике лекарств.Хотя у меня есть сомнения по поводу первого утверждения (см. Ниже), последний вывод довольно убедителен и был бы хорошим дополнением к литературе. Основными достоинствами этой статьи являются большой размер выборки, как с точки зрения животных, так и с точки зрения локализации в кишечнике, а также с точки зрения фармакокинетических анализов. Рукопись написана четко, а рисунки легко читаются. 1) Анализ 16S можно улучшить. Я не уверен, что лекарство изменило микробиоту кишечника гораздо больше, чем носитель (который, похоже, оказал большое влияние).

    Рецензента беспокоило влияние носителя на микробный состав. В нашем недавно проведенном эксперименте по хроническому лечению мышам давали контрольную диету или индометацин, смешанный с диетой (20 частей на миллион) в течение 7 дней, то есть дозирование производилось в отсутствие носителя PEG. Данные и интерпретация представлены в отредактированной рукописи. Вкратце, хроническое лечение вызвало распространение Peptococcaceae и Erysipelotrichaceae в желудочно-кишечном тракте и Ruminococcus и Anearoplasma в фекалиях, как и в эксперименте с острым лечением, что указывает на то, что эти изменения не зависят от эффекта носителя.Мы также заметили, что некоторые острые изменения, вызванные лечением, были менее впечатляющими в этом исследовании хронического дозирования. Об этом говорится в отредактированной рукописи.

    На рис. 2B, C показаны некоторые различия в разнообразии α , но они либо несовместимы между образцами просвета и тканей, либо между наблюдаемыми OTU и индексом Шеннона (оба из которых измеряют видовое богатство, поэтому они должны совпадать), малая величина или ограничена небольшим количеством участков кишечника.

    Автор обзора указал, что на рис. 2B, C показаны изменения в α-разнообразии вдоль желудочно-кишечного тракта, которые различаются между образцами просвета и слизистой оболочки, а также между наблюдаемыми OTU и индексом Шеннона.Количество OTU (богатство) и разнообразие не идентичны. Богатство определяет количество присутствующих типов, в то время как разнообразие учитывает не только количество присутствующих типов, но и равномерность распределения среди людей. Разница между образцами просвета и слизистой оболочки не удивительна и согласуется с опубликованной литературой (Hill et al. 2010, Albenberg et al. 2014, Looft et al. 2014). В литературе по ВЗК подчеркиваются различия между микробиотой просвета и слизистой оболочки (Carroll et al.2011 г., Lavelle et al. 2015).

    Рисунок 2D интригует, но неясно, как был обнаружен этот таксон. Были ли значения FDR скорректированы для всех таксонов на этом уровне или только для разных местоположений?

    На рисунке 2D статистика была проведена для каждого местоположения GI. Сравнения проводились с использованием скрипта group_significance.py с тестами Краскела-Уоллиса в анализе QIIME. Этот скрипт позволяет сравнивать частоты таксонов в группах образцов и возвращает значение p, скорректированное с помощью процедуры FDR Бенджамини-Хохберга для множественных сравнений.

    Фигура 2E может иметь важное значение по сравнению с носителем, но существенно не отличается от необработанных животных, что вызывает вопросы относительно его биологической значимости.

    Мы согласны с автором обзора в том, что на Рисунке 2E лечение индометацином было значимым по сравнению с носителем. Это по-прежнему указывает на лекарственный эффект, поскольку индометацин может противодействовать и обращать вспять действие носителя. В нашем эксперименте по хроническому лечению индометацин индуцировал экспансию Peptococcaceae и Erysipelotrichaceae в желудочно-кишечном тракте значительно по сравнению с контрольными животными (Рисунок 2 - рисунок в приложении 5), что указывает на то, что эти изменения не зависят от эффекта носителя.

    На рис. 3А авторы заявляют, что животные, получавшие индометацин, группируются по временным точкам, но не поддерживаются текущими цветовыми метками. Единственная четкая кластеризация относится к автомобилю, но, похоже, она не сгруппирована по временным точкам (не упоминается причина - может ли это быть из-за жилья?). Также неясно, почему все группы были представлены отдельно, вместо тестирования, изменило ли лекарство микробиоту кишечника по сравнению с контрольными обработками и исходными образцами.

    На рис. 3A в предыдущей версии представлены графики PCoA с использованием невзвешенного расстояния UniFrac.Разделение в группе PEG400 произошло из-за эффекта клетки, поэтому мы тщательно контролировали эффекты клетки в нашем статистическом анализе. Однако в новой версии мы решили использовать взвешенные расстояния UniFrac, поскольку мы обсуждаем изменения в относительной численности бактерий. Мы также выполнили тест ADONIS (Anderson 2001) и обнаружили значительную кластеризацию образцов до и после лечения. Эти результаты были представлены в пересмотренных результатах.

    На Рисунке 3B группы носитель / лекарство немного ниже перед лечением - как это объяснить?

    Автор обзора также подчеркнул уменьшение количества копий гена 16S рРНК в группе носитель / лекарство на рисунке 3B.Мы думаем, что это эффект транспортного средства, который, вероятно, связан с его слабительным действием. Одно из возможных объяснений может заключаться в том, что за счет удерживания воды, эффекта ПЭГ, бактериальное сообщество было разбавлено, оставляя меньше бактерий на единицу веса в образцах фекалий. Для понимания точных механизмов необходимы дальнейшие исследования.

    Рисунок 3C-E используется для вывода о том, что многие таксоны в значительной степени подвержены действию препарата в образцах фекалий, что поднимает вопрос, почему они не были обнаружены в предыдущем анализе содержимого толстой кишки.То же беспокойство по поводу коррекции FDR (см. 2D выше) применимо и здесь. Кроме того, почти все эти таксоны схожи в 3 группах лечения после лечения - значимость, по-видимому, связана с различием в группе, получавшей лекарство, в исходный момент времени до лечения. Хотя я ценю идею использования каждой мыши в качестве отдельного элемента управления, постоянство этих различий в исходный момент времени заставляет меня беспокоиться о том, что могло отличаться между мышами, назначенными для каждой группы лечения.

    На Рисунке 3C-E сравнения и корректировки FDR проводятся таким же образом, как и на Рисунке 2D. Одна из причин, по которой эти таксоны не были обнаружены при анализе содержимого толстой кишки, вероятно, связана с различием между продольным анализом и поперечным анализом. При анализе фекальной микробиоты каждая мышь служит своим собственным контролем, так что дизайн эксперимента контролировался с учетом различных смешивающих факторов, таких как изменчивость между мышами и эффекты клетки. Следовательно, реальные биологические изменения, вызванные лечением лекарствами, с меньшей вероятностью будут замаскированы другими переменными.Напротив, при анализе содержимого толстой кишки сравнения были сделаны между разными группами мышей, так что межсистемная изменчивость и эффект клетки могут маскировать влияния, вызванные лечением лекарствами. Автор обзора также указал на различия между мышами до лечения. Нам было известно о вариабельности у разных мышей, поэтому мы тщательно рандомизировали животных на три группы и случайным образом проводили лечение в разные дни. Все эксперименты проводились одним и тем же человеком по одной и той же процедуре, чтобы минимизировать технические переменные.Таким образом, базовая разница между мышами отражает биологическую изменчивость. Теперь мы обсудим это в исправленной рукописи.

    Более общая проблема заключается в том, что многие из сравнений 16S являются качественными и не имеют надлежащих статистических тестов. Например, параграф два «Результаты» включает множество утверждений, которые необходимо подкрепить статистикой. Также было бы полезно включить числа в текст, чтобы дать читателю представление о величине каждого изменения и разбросе внутри каждой группы.

    По запросу, теперь мы предоставляем больше числовых данных и статистических результатов в отредактированной рукописи.

    2) Данные на Рисунке 4 превосходны, а Рисунок 5C особенно поразителен. Вместе они показывают важность микробиоты кишечника в фармакокинетике индометацина. Однако у меня есть некоторые опасения относительно новизны этого открытия. Как отмечают авторы в разделе результатов , Saitta et al. , 2014 уже убедительно показали, что бактериальная β -глюкуронидаза способствует повреждению ЖКТ, вызванному индометацином. Хотя очень приятно подтвердить, что это связано с деконъюгацией, это не такой уж большой шаг вперед.

    Мы согласны с тем, что предыдущая работа продемонстрировала роль бактериальной β-глюкуронидазы в повреждении ЖКТ индометацином. Тем не менее, наше исследование является первым, в котором фармакокинетика и фармакодинамика связываются, обеспечивая двунаправленное воздействие между кишечной микробиотой и индометацином. Таким образом, мы подчеркиваем, что бактерии могут вносить вклад в индивидуальные различия в реакции на лекарства у разных людей. Учитывая, что микробный состав подвергается циркадным колебаниям во время цикла свет-темнота, влияние бактерий на фармакокинетику также может объяснять индивидуальные вариации в разное время дня.

    Большим достижением было бы подтверждение гипотезы авторов о том, что изменения в микробиоте кишечника после лекарственного лечения затем изменяют уровни лекарств или побочные эффекты. Это может быть сделано путем проведения экспериментов по трансплантации беспроблемным мышам от доноров, которых лечили индометацином или контрольным носителем с последующим медикаментозным лечением. Еще лучше, возможно, некоторые из предполагаемых связанных с лекарствами таксонов, которые идентифицировали авторы, могут быть использованы для колонизации мышей, свободных от микробов или обработанных антибиотиками, до лечения индометацином.Также можно было бы количественно оценить распространенность β -глюкуронидазы до и после обработки с помощью количественной ПЦР, ферментативных анализов или метагеномного секвенирования с дробовиком.

    Автор обзора указал, что стерильная мышь будет хорошей моделью для дальнейших исследований, включая эксперименты по лечению лекарствами и трансплантации фекалий. Мы отмечаем, что преимущество использования лечения антибиотиками состоит в том, что у изучаемых мышей разовьется нормальный кишечник и иммунная функция за счет роста с нормальной колонизацией - как известно, мыши-гнотобиоты в этом отношении имеют отклонения от нормы.Тем не менее, исследования гнотобиотиков были бы хорошим дополнением. К сожалению, во время исследования у нас не было доступа к мышам-гнотобиотикам. Но это в нашем списке будущих исследований. Кроме того, нас особенно интересовало использование антибиотиков, учитывая универсальность совместного назначения НПВП и антибиотиков, особенно пациентам-ортопедам.

    3) Я не уверен, что представляет собой «тканевая» микробиота, поскольку микробы обычно находятся в просвете и внешнем слое слизистой оболочки, и очень мало проникает в ткань у животных дикого типа.В разделе «Материалы и методы» требуется дополнительная информация, чтобы объяснить процедуру взятия пробы. Как смывали просвет? Была ли задержана слизь до гомогенизации?

    Мы более подробно объяснили процедуру взятия проб из просвета и слизистой оболочки в пересмотренном сеансе «Материалы и методы».

    https://doi.org/10.7554/eLife.08973.023

    Протокол питания для лечения дефектов кишечной проницаемости и связанных состояний

    Реферат

    В здоровых условиях слизистая оболочка кишечника позволяет абсорбировать жизненно важные питательные вещества из просвета кишечника, создавая барьер против проникновения патогенных веществ в организм.Синдром протекающей кишки описывает патологическое увеличение проницаемости слизистой оболочки кишечника, которое вызывает повышенное всасывание эндотоксина кишечного происхождения, антигенов, медиаторов воспаления и, в некоторых случаях, интактных бактерий. Эти агенты могут вызывать местные и системные реакции, связанные с широким спектром острых и хронических заболеваний. В некоторых случаях атрофические изменения в эпителии слизистой оболочки могут привести к, казалось бы, парадоксальному состоянию снижения проницаемости и мальабсорбции основных питательных веществ одновременно с повышенной проницаемостью и абсорбцией патогенных макромолекул.

    Исследования показывают, что определенные факторы питания могут помочь поддерживать здоровье слизистых оболочек и способствовать нормальной кишечной проницаемости (IP). Эти факторы включают антиоксиданты, питательные вещества для слизистых оболочек, пищеварительные ферменты, пробиотики и пищевые волокна. Также было показано, что некоторые из этих питательных веществ способствуют улучшению при заболеваниях, связанных с синдромом дырявого кишечника. В этой статье приводятся доказательства эффективности ряда этих агентов. Он также включает рекомендации по протоколу питания для лечения дефектов IP.Ряд рекомендаций в этой статье основан на двойных слепых плацебо-контролируемых клинических исследованиях, которые показывают статистически значимое преимущество определенных пищевых добавок при лечении дефектов IP и связанных с ними состояний. Однако в большинстве случаев рекомендации основаны на косвенных доказательствах эффективности, полученных в ходе исследований на людях или животных in vitro. Представленные протокол питания, формы и дозировки питательных веществ являются рекомендациями автора и не изучались в контролируемых клинических испытаниях.

    Введение

    В кишечнике человека содержится достаточно эндотоксина, медиаторов воспаления и бактерий, чтобы многократно убить хозяина. 1 Здоровая функционирующая слизистая оболочка кишечника является основной линией защиты организма от этих потенциально смертельных агентов. Катастрофическое нарушение барьера слизистой оболочки кишечника было определено как основная причина полиорганной недостаточности, ведущая причина смерти в хирургических отделениях интенсивной терапии с уровнем смертности примерно 70%. 2

    У пациентов в критическом состоянии токсины, выходящие из просвета кишечника, активируют местную воспалительную реакцию, которая приводит к дальнейшему воспалению кишечника, разрушению тканей и выработке цитокинов и медиаторов воспаления. Повреждение слизистой оболочки также вызывает увеличение IP с дальнейшим высвобождением медиаторов воспаления и транслокацией кишечных бактерий. 3 Медиаторы воспаления кишечного происхождения вызывают системный воспалительный и аутоиммунный ответ.Циркуляция медиаторов воспаления приводит к дальнейшему увеличению проницаемости кишечника и высвобождению медиаторов кишечного происхождения в порочном круге, который может привести к полиорганной недостаточности и смерти. Помимо неотложных хирургических вмешательств, полиорганная недостаточность также может наблюдаться при травмах, ожоговых травмах, сепсисе, панкреатите и шоке. 4 Синдром дырявого кишечника представляет собой менее серьезный пример патологически повышенного IP, который часто можно увидеть в клинической практике. Возникающая в результате утечка токсинов просвета и медиаторов воспаления связана с рядом хронических воспалительных, аутоиммунных и функциональных нарушений.(См. Таблицу 1.)

    ТАБЛИЦА 1

    Состояния, вызванные или наблюдаемые в связи с дефектами кишечной проницаемости

    Полиорганная недостаточность 5,6

    Синдром хронической усталости 7,8,9,10

    Язвенный колит 11,12

    Болезнь Крона 13,14,15,16,17

    Целиакия 18,19

    Синдром раздраженного кишечника с преобладанием диареи 20

    Воспалительная болезнь суставов 21,22,23,24

    Анкилозирующий спондилит 25,26,27,28

    Ювенильный артрит 29

    Псориатический артрит 30

    Пищевая аллергия 31,32,33,34

    Атопический дерматит, экзема 35

    Хроническая сердечная недостаточность 36,37

    Психологические условия 38,39

    ВИЧ / СПИД40, 41

    Химиотерапия 42,43

    Лучевая терапия таза 44,45

    Диагностика

    Тест на проницаемость лактулозы и маннита - один из наиболее широко используемых методов для диагностики дефектов IP. 46,47 Тест основан на пероральном введении лактулозы и маннита, двух неметаболизированных молекул сахара. В нормальных условиях небольшие водорастворимые молекулы, такие как маннит, легко всасываются через мембраны эпителиальных клеток слизистой оболочки путем пассивной диффузии (трансклеточного поглощения). Более крупные молекулы, такие как дисахарид лактулоза, обычно исключаются клеточными мембранами, но могут незначительно абсорбироваться через аппарат плотного соединения между клетками (параклеточное поглощение). Количество лактулозы и маннита, извлеченных с мочой через 6 часов, и соотношение между ними используются в качестве индикаторов IP и барьерной функции слизистой оболочки.

    Недавние исследования изучали чувствительность и специфичность теста лактулоза-маннит (L / M) для диагностики дефектов IP в ряде конкретных состояний. Контролируемое клиническое исследование 2008 года показало, что соотношение L / M показало 100% специфичность и 89,5% чувствительность при оценке дефектов IP у пациентов с болезнью Крона. Значения для пациентов с болезнью Крона значительно отличались от контрольной группы (P <0,0001). 48 Клиническое исследование 2009 года с участием 47 пациентов с целиакией показало, что тест L / M имел чувствительность 85%, но специфичность только 46.2% для выявления серьезных повреждений слизистой оболочки при последующем обследовании у пациентов с глютеновой болезнью. Это исследование также показало, что анализы экскреции сахарозы и сывороточных эндомизиальных антител (EMA) показали чувствительность и специфичность 60% и 52,6%, а также 50% и 77,8% соответственно. Исследователи пришли к выводу, что эти неинвазивные тесты не могут служить точной заменой биопсии при последующих обследованиях пациентов с глютеновой болезнью. 49 В группе из 22 взрослых пациентов с глютеновой болезнью, соблюдающих безглютеновую диету в течение 12 месяцев, контролируемое клиническое исследование 2007 года показало, что экскреция лактулозы с мочой и соотношение L / M были значительно меньше, чем в контрольной группе, а выведение маннита было меньше. больше, чем в контроле (P <0.0001). Исследователи пришли к выводу, что тест L / M позволил получить более точную физиологическую корреляцию, чем сывороточные антиглиадиновые антитела, и предоставил больше информации для наблюдения за пациентами. 50 Проспективное когортное исследование 261 пациента с хронической диареей показало, что L / M-тест является эффективным инструментом скрининга для дифференциации органических и функциональных причин хронической диареи. Тест L / M точно предсказал окончательный диагноз органической причины хронической диареи с отношением шансов 1.5 (95% ДИ = 1,29–1,78). 51 Исследование 2006 г. пришло к выводу, что диетическая лактоза и фруктоза могут влиять на пики газовой хроматографии при измерении лактулозы и маннита. Исследователи обнаружили, что новый метод газовой хроматографии позволяет одновременно определять количество лактулозы, маннита, сукралозы и сахарозы в моче без вмешательства пищевой лактозы и фруктозы и, следовательно, является точным методом оценки IP. 52 Тест L / M может иметь ограниченную чувствительность или специфичность в определенных условиях; тем не менее, это, по-видимому, широко используемый инструмент скрининга для диагностики синдрома протекающей кишки и может иметь значение для мониторинга клинического прогресса пациентов, проходящих лечение, по поводу состояний, которые вызваны или связаны с дефектами IP.

    Причинные факторы

    Помимо хирургического вмешательства, травм, ожогов, сепсиса, панкреатита и шока, в литературе был идентифицирован ряд других факторов риска в качестве потенциальных причин дефектов IP. (См. Таблицу 2.) В большинстве случаев нарушение функции кишечного барьера, воспаление слизистой оболочки и окислительный стресс были идентифицированы как центральные патофизиологические механизмы. 53,54,55,56

    ТАБЛИЦА 2

    Причинные факторы, связанные с развитием дефектов кишечной проницаемости

    Воспаление кишечника 57,58

    Окислительный стресс слизистой оболочки 59,60

    Напряжение 61,62

    Нестероидные противовоспалительные препараты (НПВП) 63

    Потребление алкоголя 64,65

    Непереносимость коровьего молока 66,67

    Разрастание бактерий в тонком кишечнике 68,69

    Панкреатическая недостаточность 70

    Кишечные инфекции 71

    Механическая желтуха 72

    Протокол диетического лечения

    Вмешательства, направленные на уменьшение или устранение этих причинных факторов, могут иметь значение для исправления дефектов IP.Следует отметить, что дефекты ВП характерны для воспалительных заболеваний кишечника (ВЗК), таких как язвенный колит и болезнь Крона. 73,74 Исследования показали, что воспаление кишечника и окислительный стресс слизистых оболочек являются патофизиологическими признаками, общими как для ВЗК, так и для аномально повышенного ИП в целом. 75,76,77,78 Изменение белков плотного соединения, уменьшение тяжей плотного соединения и разрывы нитей характерны для болезни Крона. 79 При язвенном колите нарушение эпителиального барьера происходит в результате изменений белков плотных контактов, микроэрозий и усиленного апоптоза эпителия. 80 Таким образом, кажется разумным постулировать, что лечебное питание, направленное на уменьшение воспаления кишечника и окислительного стресса слизистой оболочки при ВЗК, может также привести к улучшению барьерной функции слизистой оболочки и нормализации ИП при других состояниях.

    Ниже представлены данные, указывающие на то, что ряд антиоксидантов, питательных веществ для слизистых оболочек, ферментов, пробиотиков и клетчатки могут быть полезными при лечении синдрома дырявого кишечника и связанных с ним состояний. Кроме того, представлен протокол лечения, который включает предлагаемые комбинации и дозировки этих питательных веществ.Как уже отмечалось, комбинации, формы питательных веществ и дозировки являются рекомендациями автора и не изучались в контролируемых клинических испытаниях.

    Антиоксиданты

    Синдром протекающей кишки связан с воспалением кишечника, окислительным стрессом слизистых оболочек, перекисным окислением липидов и истощением запасов антиоксидантов в слизистой оболочке кишечника. 81,82,83,84,85,86 Исследования на людях и животных продемонстрировали потенциальную пользу от добавления антиоксидантных питательных веществ и экстрактов растений в предотвращении окислительного повреждения и восстановлении нормальной барьерной функции слизистой оболочки.

    Кверцетин - это встречающийся в природе флавоноид с антиоксидантными, противовоспалительными и противораковыми свойствами. 87 Было показано, что кверцетин усиливает барьерные функции кишечника в клетках кишечника человека. 88 Тучные клетки играют важную роль в патогенезе воспаления слизистой оболочки кишечника и повышении IP. 89 Кверцетин помогает контролировать воспаление кишечника, подавляя высвобождение гистамина тучными клетками кишечника человека. 90,91 Также было показано, что он ингибирует экспрессию генов и продукцию провоспалительных цитокинов, таких как фактор некроза опухоли альфа (TNF-альфа), интерлейкин (IL) 1-бета, IL-6 и IL-8. из тучных клеток человека. 92 Противоаллергический препарат динатрий кромогликат структурно связан с кверцетином. 93

    Ряд исследований продемонстрировали биодоступность кверцетина при пероральном приеме или показали значительную пользу при ряде состояний, включая систолическую гипертензию, интерстициальный цистит и хронический простатит

    Ряд исследований продемонстрировали биодоступность кверцетина при пероральном приеме или показали значительную пользу при ряде состояний, включая систолическую гипертензию, интерстициальный цистит и хронический простатит. 94,95,96 Например, в двойном слепом плацебо-контролируемом перекрестном исследовании 2009 г. изучались эффекты приема 150 мг кверцетина в день в течение 6-недельного периода лечения в группе из 93 субъектов с избыточным весом или ожирением. в возрасте 25–65 лет с признаками метаболического синдрома. Среднее значение кверцетина в плазме натощак увеличилось с 71–269 нмоль / л в течение периода лечения (P <0,001), а кверцетин снизил систолическое артериальное давление на 2,6 мм рт.ст. по сравнению с плацебо (P <0,01). LDL) концентрации. 97 Однако, похоже, что никакие опубликованные клинические исследования на людях не изучали влияние добавок кверцетина на ИП.

    Экстракт гинкго билоба (GBE) обладает антиоксидантными свойствами, улавливает свободные радикалы и оказывает цитопротекторное действие на клетки слизистой оболочки желудочно-кишечного тракта. 98,99 Было показано, что пероральные добавки с GBE уменьшают макроскопические и гистологические повреждения слизистой оболочки толстой кишки in vivo и значительно снижают провоспалительные цитокины при экспериментально индуцированном язвенном колите. 100 Гинкго, как было показано, предотвращает повышенное IP и повреждение слизистых оболочек, связанное с ишемией тонкого кишечника, дозозависимым образом на животных моделях. 101 Было обнаружено, что предварительная обработка GBE ослабляет повреждение слизистой оболочки и значительно снижает маркеры окислительного стресса при ишемии и реперфузии тонкой кишки in vivo у животных. 102 Хотя данные исследований на животных показывают, что GBE может способствовать нормальному функционированию кишечного барьера, похоже, нет опубликованных контролируемых испытаний по использованию GBE для лечения дефектов IP у людей.

    Витамины C и E играют важную роль в защите клеток слизистой оболочки кишечника от окислительного повреждения и свободнорадикальной патологии. В одном клиническом испытании пероральный прием 300 мг витамина Е привел к уменьшению воспаления слизистой оболочки толстой кишки у пациентов с язвенным колитом. 103 Исследование 1995 года с участием пациентов с ВЗК показало значительно сниженные уровни витамина С в тканях слизистой оболочки по сравнению с контрольной группой без ВЗК. 104 В свете общих патофизиологических механизмов воспаления кишечника и окислительного стресса слизистых оболочек, обнаруженных как при ВЗК, так и при ИП, как описано выше, кажется разумным постулировать, что витамины С и Е также могут способствовать нормальному функционированию ИП, однако это не так. похоже, были исследованы в опубликованных контролируемых клинических исследованиях.Было показано, что лечение витамином С (аскорбиновая кислота) и витамином Е (альфа-токоферол) снижает частоту бактериальной транслокации из просвета кишечника и снижает перекисное окисление липидов слизистой оболочки при хронической портальной гипертензии и перевязке общих желчных протоков у животных. 105

    N-ацетил-L-цистеин (NAC) представляет собой антиоксидант, детоксификатор и предшественник синтеза глутатиона при пероральном введении людям. НАК и глутатион подавляют действие свободных радикалов, которые могут способствовать окислительному повреждению слизистой оболочки кишечника.Было показано, что предварительная обработка NAC предотвращает повышение IP после кишечной ишемии и реперфузии у животных. 106 Пищевой цинк, по-видимому, играет решающую роль в поддержании нормального IP и контроле воспаления. Было показано, что дефицит цинка вызывает нарушение барьерной функции слизистых оболочек и увеличивает секрецию медиаторов воспаления эпителиальными клетками кишечника человека. 107 Цинк обладает цитопротекторной активностью в желудочно-кишечном тракте и помогает стабилизировать тучные клетки кишечника. 108 В таблице 3 представлена ​​предлагаемая комбинация антиоксидантов и диапазоны суточных доз для снижения окислительного стресса в кишечнике, модуляции высвобождения медиаторов воспаления и поддержки нормальной проницаемости слизистой оболочки.

    ТАБЛИЦА 3

    Антиоксидантная добавка

    Обеспечиваемая комбинация антиоксидантов:

    Кверцетин 400–800 мг

    Экстракт гинкго билоба (24% гликозидов флавона гинкго) 40–80 мг

    Витамин С (кальций, аскорбаты магния) 1000–2000 мг

    Витамин Е (d-альфа-токоферилсукцинат) 200–400 мг

    N-ацетил-L-цистеин (NAC) 150–300 мг Цинк (пиколинат цинка) 45–90 мг

    (Учитывайте добавку меди при 0.75–1,5 мг с учетом приема цинка.)

    Питательные вещества слизистой оболочки

    Было доказано, что некоторые питательные вещества помогают поддерживать здоровую структуру и функцию клеток слизистой оболочки и способствуют нормальному IP. К ним относятся L-глутамин, фосфатидилхолин, N-ацетил-D-глюкозамин и гамма-линоленовая кислота.

    L-глутамин является важным источником энергии для клеток слизистой оболочки кишечника и, как было показано, условно необходим для нормальной структуры и функции слизистой оболочки. 109,110,111 Глутамин, по-видимому, необходим для нормального производства секреторного иммуноглобулина А (IgA) в кишечнике. Секреторный IgA является наиболее распространенным иммуноглобулином во внешних секрециях и играет центральную роль в нормальной функции слизистой оболочки кишечника в качестве иммунного барьера. Было показано, что глутамин помогает поддерживать массу кишечника и кишечную барьерную функцию против бактерий и может иметь важное значение для выживания хозяина во время критического заболевания у людей. 112

    Добавление L-глутамина к общему парентеральному питанию (TPN) предотвращает патологическое повышение IP у людей. 113 В контролируемом исследовании 1993 года с участием 20 случайно выбранных стационарных пациентов в больницах сравнивали эффекты стандартного общего парентерального питания (STPN) и общего парентерального питания, обогащенного глутамином (Gln TPN). Образцы биопсии слизистой оболочки были взяты из нижней части двенадцатиперстной кишки, и IP был измерен с помощью теста L / M до и после 2 недель лечения. IP остался неизменным в группе Gln TPN, но увеличился в группе STPN. Высота ворсинок также не изменилась в группе Gln TPN, но уменьшилась в группе STPN.Исследователи пришли к выводу, что добавление глутамина в ППП предотвращает ухудшение проницаемости кишечника и сохраняет структуру слизистой оболочки. Обогащенное глутамином TPN также сохраняет функцию кишечной лимфоидной ткани (GALT) и уровни кишечного IgA в исследованиях на животных. 114 Контролируемое исследование на животных в 2005 году показало, что добавление глютамина в рацион приводит к значительному снижению увеличения IP и бактериальной транслокации при экспериментальной обструкции желчных путей. 115

    N-ацетил-D-глюкозамин (NAG) представляет собой встречающийся в природе аминогликан, обнаруживаемый в больших концентрациях в кишечной слизи, секреторных IgA и других иммуноглобулинах.Кишечная слизь играет решающую роль в защите хозяина, обеспечивая механический и иммунологический барьер против токсинов, антигенов и бактерий в просвете кишечника. Исследования показали, что NAG блокирует прикрепление Candida albicans к слизистой оболочке желудочно-кишечного тракта in vivo у животных и стимулирует рост полезных бифидобактерий in vitro . 116,117 Исследования показывают, что у многих пациентов с ВЗК существует дефект в составе гликоконъюгата кишечного муцина. 118,119 Одно клиническое исследование показало, что NAG имеет дефицит муцина у пациентов с ВЗК по сравнению с контрольной группой без ВЗК. Это, по-видимому, связано с дефектом биосинтеза NAG, включающим N-ацетилирование глюкозамин-6-фосфата с образованием NAG. 120 NAG может абсорбироваться из просвета кишечника и непосредственно включаться в гликозаминогликаны и гликопротеины слизистой оболочки кишечника. 121

    Пилотное исследование, проведенное в 2000 году, изучало эффективность введения NAG у детей с тяжелым язвенным колитом и болезнью Крона, которые не реагировали на обычное лечение.Пациентам давали НАГ перорально или ректально по 3–6 г в день. Гистохимическая оценка эпителиального и матричного NAG и гликозаминогликанов проводилась при наличии образцов биопсии. У восьми из 12 детей, получавших пероральный НАГ, наблюдалось явное улучшение. Из детей с симптоматической стриктурой Крона 4 из 7 показали эндоскопическое и рентгенологическое улучшение и смогли избежать хирургического вмешательства в течение среднего периода наблюдения 2,5 года. Исследователи пришли к выводу, что введение NAG может быть полезным при ВЗК со стриктурами, но для подтверждения эффективности необходимы дальнейшие испытания. 122 Никаких опубликованных контролируемых исследований, по-видимому, не проводилось для изучения влияния добавок NAG на дефекты IP у людей. Однако может быть разумным постулировать, что существуют аналогичные преимущества, которые наблюдались в вышеупомянутом исследовании у пациентов с ВЗК, из-за общих патофизиологических механизмов воспаления кишечника и оксидативного стресса слизистой оболочки, обычно обнаруживаемых как при ВЗК, так и при дефектах ИБ.

    Фосфатидилхолин (PC) является составной частью желчи человека и ключевым компонентом гидрофобного геля слизи, который защищает слизистую оболочку желудочно-кишечного тракта. 123 Воздействие липополисахаридов (ЛПС) может вызвать повреждение как желудочно-кишечных, так и не-желудочно-кишечных тканей. Контролируемое исследование на животных, проведенное в 2008 году, показало, что пероральное введение ПК до воздействия ЛПС значительно предотвращало патологическое увеличение IP. Исследователи пришли к выводу, что энтеральные составы, содержащие ПК, могут быть полезными добавками для предотвращения повреждения кишечника и повышения проницаемости от воздействия кишечных эндотоксинов. 124

    Исследования на людях in vitro показали, что введение ПК может усиливать защитный эффект конъюгированных солей желчных кислот за счет снижения IP до эндотоксина и подавления продукции воспалительных цитокинов. 125 Исследование 2009 г. показало, что добавление ПК к конъюгированным первичным солям желчных кислот может обратить вспять вызванное этанолом повышение IP до эндотоксина и предотвратить воспалительную активацию лейкоцитов. Известно, что этанол увеличивает трансэпителиальную проницаемость для эндотоксина и последующую активацию лейкоцитов человека. Эпителиальные клетки кишечника человека (Caco-2), совместно культивируемые базолатерально с мононуклеарными лейкоцитами, заражали апикально эндотоксином из E.coli K12 и инкубировали с добавлением или без добавления конъюгированных первичных солей желчных кислот (CPBS), ПК и объединенной желчи человека. в сочетании с этанолом.Исследователи обнаружили, что индуцированная этанолом трансэпителиальная проницаемость эндотоксина и трансэпителиальная стимуляция лейкоцитов были почти полностью устранены после апикального добавления CPBS с PC, но не только CPBS. 126

    Другие питательные вещества, поддерживающие целостность эпителиального барьера и нормальную проницаемость слизистой оболочки, включают полиненасыщенные жирные кислоты гамма-линоленовую кислоту (GLA), докозагексаеновую кислоту (DHA) и эйкозапентаеновую кислоту (EPA). Было показано, что GLA, DHA и EPA включаются во фракцию мембранных фосфолипидов эпителиальных клеток слизистой оболочки человека и уменьшают дефекты проницаемости слизистой оболочки, вызванные воспалительными цитокинами. 127 Таблица 4 содержит рекомендуемую комбинацию питательных веществ и диапазонов суточных доз для поддержки структуры слизистой оболочки и нормальной барьерной функции.

    ТАБЛИЦА 4

    Целевые питательные вещества для слизистых оболочек

    Комбинация питательных веществ для слизистой оболочки:

    L-глутамин 750–1 500 мг

    N-ацетил-D-глюкозамин (NAG) 375-750 мг

    Фосфатидилхолин 75–150 мг

    Гамма-линоленовая кислота (GLA) 200–400 мг

    Пищеварительные ферменты и кишечная проницаемость

    Адекватное пищеварение является предпосылкой нормальной работы желудочно-кишечного тракта и общего состояния здоровья.Дефицит пищеварительных ферментов и дисбаланс рН желудочно-кишечного тракта могут вызывать нарушение пищеварения, что может способствовать нарушению всасывания питательных веществ, пищевой непереносимости, пищевой аллергии, аутоиммунным состояниям, избыточному бактериальному росту, а также признакам и симптомам желудочно-кишечного дискомфорта. 128-134 Недостаточная активность ферментов поджелудочной железы также может вызвать повышенный IP и синдром дырявого кишечника. 135 Добавки с пищеварительными ферментами могут помочь устранить дефицит ферментов и улучшить состояния, связанные с нарушением пищеварения.

    Пероральный прием кислотоустойчивых грибковых ферментов, также известных как растительные ферменты или микробные ферменты, оказался безопасным и эффективным при лечении недостаточности поджелудочной железы у людей и животных. У пациентов с дисбалансом рН желудочно-кишечного тракта эти ферменты могут иметь преимущества по сравнению с обычными препаратами ферментов поджелудочной железы с энтеросолюбильным покрытием. 136,137,138,139,140,141

    Кислотостойкие грибковые ферменты

    Ферменты поджелудочной железы обладают оптимальной активностью в диапазоне pH от нейтрального до щелочного и нестабильны в кислых условиях.Воздействие желудочного сока может разрушить до 90% дополнительной липазы поджелудочной железы и 65% трипсина поджелудочной железы. 142 Энтеросолюбильные покрытия, предназначенные для защиты ферментов поджелудочной железы от кислотности желудочного сока, могут не растворяться надежно во всех случаях. 143,144 Некоторые пациенты с недостаточностью поджелудочной железы не могут концентрировать бикарбонат в достаточной степени, чтобы подщелачивать верхнюю часть тонкой кишки для нормального высвобождения кишечного покрытия. Возникающая в результате гиперактивность тощей кишки также может подавлять активность ферментов поджелудочной железы, даже если энтеросолюбильное покрытие растворяется должным образом. 145 146

    Исследования показывают, что некоторые кислотоустойчивые препараты грибковых ферментов являются естественно стабильными и активными как в кислых, так и в щелочных условиях pH. В результате они эффективны без необходимости в энтеросолюбильном покрытии или одновременном применении препаратов, изменяющих pH, даже у людей с желудочно-кишечным дисбалансом pH, который может ограничивать эффективность ферментов поджелудочной железы. Благодаря широкому диапазону pH они начинают переваривать пищу в желудке и продолжают работать в кишечнике. 147 148 149

    В исследованиях сравнивалась эффективность ферментов поджелудочной железы и кислотоустойчивой грибковой липазы при лечении внешнесекреторной недостаточности поджелудочной железы у людей и животных. Некоторые из этих исследований показали, что кислотоустойчивая грибковая липаза эффективна в значительно более низкой дозе, чем панкреатин, в уменьшении стеатореи и облегчении симптомов диареи и дискомфорта при пищеварении. 150,151

    В контролируемом клиническом исследовании с перекрестным дизайном у 17 пациентов с тяжелой панкреатической недостаточностью, стеатореей, диареей и дискомфортом в животе сравнивались эффекты кислотоустойчивого препарата грибковых ферментов с обычными панкреатическими ферментами и панкреатином с энтеросолюбильным покрытием.В одной группе 9 хирургических пациентов с дуоденопанкреатэктомией и резекцией кишечника (процедура Уиппла) за 3–8 месяцев до исследования имели стимулированную до исследования секрецию ферментов поджелудочной железы менее чем на 10% от нормы. В другой группе из 8 нехирургических пациентов с интактными желудочно-кишечными трактами уровни панкреатических ферментов до испытания были ниже 29% от нормы. Обе группы были переведены на диету, содержащую 100 г жира в день. Стул собирали в течение 72 часов, через 5 дней после прекращения приема всех лекарств и дополнительных ферментов.После этого всем пациентам были назначены двухнедельные периоды лечения панкреатином с энтеросолюбильным покрытием (100 000 единиц липазы [LU]), затем обычным панкреатином (360 000 LU) и, наконец, кислотоустойчивой грибковой липазой (75 000 LU). Стул собирали за последние 72 часа каждого периода лечения и анализировали на содержание жира в кале и массу стула. Все 3 протокола лечения привели к значительному снижению экскреции фекального жира в обеих группах ( P <0,05). У всех пациентов также практически исчезли симптомы диареи и дискомфорта в животе.В этом исследовании кислотостойкая грибковая липаза была эффективна при дозе фермента на 25% ниже, чем у панкреатина с энтеросолюбильным покрытием, и более чем в 4 раза ниже, чем у обычного панкреатина. 152

    В аналогичном плацебо-контролируемом рандомизированном перекрестном исследовании на собаках сравнивалась эффективность 4000 LU кислотоустойчивой грибковой липазы и 60000 LU липазы из панкреатина при лечении хирургически индуцированной панкреатической недостаточности и стеатореи. Собаки в группе плацебо имели значительную потерю веса из-за мальабсорбции наряду с патологически повышенным фекальным жиром и массой стула.У собак в обеих группах лечения наблюдалось значительное снижение фекального жира и веса стула без значительной потери веса. Кислотостойкая грибковая липаза была эффективна при дозе фермента в 15 раз ниже, чем панкреатин. 153

    Клинические исследования на людях показывают, что кишечная секреция лактазы, сахаразы и мальтазы снижается в условиях повреждения слизистой оболочки кишечника и морфологических изменений, включая целиакию и хроническую диарею. 154,155,156,157 Дефицит лактазы (бета-галактозидазы) встречается более чем у половины взрослого населения. 158 Исследование 232 детей с биопсией кишечника показало, что активность лактазы значительно снижалась с возрастом и коррелировала со степенью повреждения кишечника. 159 Непереносимость лактозы вызывает боль в животе, вздутие живота, диарею и повышенное выделение водорода из дыхания. Ряд контролируемых исследований на людях показал, что грибковая лактаза, вводимая перорально или добавляемая в молоко во время еды, эффективно предотвращает или уменьшает признаки и симптомы непереносимости у лиц, подвергающихся воздействию лактозы с пищей. 160,161,162,163

    Биодоступность минералов может быть значительно снижена диетическим фитатом. Люди и животные с однокамерным желудком производят мало эндогенной фитазы в желудке и тонком кишечнике или вообще не вырабатывают ее. 164 Контролируемое клиническое испытание на людях показало, что пищевые добавки с кислотоустойчивой грибковой фитазой из Aspergillus niger увеличивают абсорбцию железа. Исследование также показало, что фитаза грибов была стабильной и активной в широком диапазоне pH от 1.От 0 до 7,5 и что он инициировал переваривание диетических фитатов, начиная с желудка. 165 Исследования на животных показали, что добавление грибковой фитазы помогло улучшить биодоступность цинка, кальция и фосфора и увеличить прочность костей в зависимости от дозы. 166 167

    Исследования показали, что добавка грибковой целлюлазы помогает повысить питательную ценность пищевых зерен у животных. 168,169 Целлюлаза значительно улучшила усвояемость пищевых компонентов клеточной стенки и увеличила растворимость кальция, фосфора, железа, цинка и меди, связанных с клеточными стенками. 170 Исследования с использованием мультиферментных комбинаций, включая грибковую амилазу, протеазу, инвертазу, фитазу и целлюлазу, показали повышенную усвояемость питательных веществ и улучшение роста свиней и цыплят. 171,172 Таблица 5 содержит рекомендованную комбинацию кислотоустойчивых грибковых ферментов, которую следует принимать во время еды как часть протокола питания для поддержки здорового пищеварения и нормального IP.

    ТАБЛИЦА 5

    Ферменты пищеварительных растений

    Комбинация кислотоустойчивых ферментов, всего 613 мг, чтобы обеспечить:

    Протеаза 30,000 USP

    Амилаза 32000 USP

    Липаза 2100 FIP

    Лактаза 1,600 ALU

    Sucrase 300 INVU

    Мальтаза 32100 DPo

    Фитаза 1.7 УЕ

    Целлюлаза 350 у.е.

    Пробиотики

    Кишечная микрофлора была описана как постнатально приобретенный орган, состоящий из большого разнообразия бактерий, которые выполняют ряд важных функций для хозяина. 173 Пробиотики - это микроорганизмы, вводимые перорально, которые помогают поддерживать или восстанавливать полезную микрофлору кишечника и предотвращать или лечить желудочно-кишечные расстройства и связанные с ними системные состояния.В ряде обзорных статей показано, что добавление пробиотиков может быть полезным при лечении или профилактике дефектов IP и связанных с ними расстройств, включая ВЗК, синдром раздраженного кишечника, пищевую аллергию, атопический дерматит, экзему, инфекционную диарею, диарею, связанную с антибиотиками, повреждение кишечника, вызванное химиотерапией, и другие состояния у людей. 174-185 Чтобы быть эффективными, пробиотические препараты должны быть способны выжить в желудочно-кишечных условиях и колонизировать кишечник, по крайней мере временно, за счет адгезии к слизистой оболочке кишечника. 186

    Язвенный колит (ЯК) связан с дефектами ВП в дополнение к другим характерным признакам и симптомам. 187,188 Добавка Bifidobacterium longum, как было обнаружено, значительно улучшает показатели эмоциональной функции по данным опросника по воспалительному заболеванию кишечника (IBDQ) в рандомизированном контролируемом исследовании с участием 120 амбулаторных пациентов с ЯК. Дозировка B. longum в исследовании составляла 2 миллиарда колониеобразующих единиц (КОЕ) в день. Такая же дозировка B.longum в сочетании с 8 г псиллиума был даже более эффективным в улучшении качества жизни со значительным улучшением общих баллов по шкале IBDQ ( P = 0,03). Комбинация также значительно снизила уровень С-реактивного белка ( P = 0,04). 189 Двойное слепое плацебо-контролируемое перекрестное клиническое исследование показало, что B. longum также эффективен при лечении диареи, связанной с антибиотиками. Десяти здоровым взрослым добровольцам давали эритромицин 1 г перорально два раза в день в течение каждого из двух 3-дневных периодов лечения, разделенных 3-недельным периодом вымывания.Субъектам давали йогурт с B. longum (BY) или йогурт-плацебо без B. longum (PY), произвольно назначаемый в течение каждого периода лечения. Вес стула, частоту стула и наличие дискомфорта в животе регистрировали за 1 день до (D-1) и на третий день (D-3) каждого периода лечения. Субъекты, принимавшие PY, имели значительное увеличение массы стула и частоты на D-3 по сравнению с D-1 периода плацебо ( P <0,005) и значительное увеличение тех же параметров по сравнению с D-3 периода BY.Частота дискомфорта в животе также была выше в течение периода PY: 6 из 10 участников испытывали симптомы во время приема PY, по сравнению с 1 из 10 во время лечения BY. 190

    IP

    увеличивается у пациентов с синдромом раздраженного кишечника с преобладанием диареи (D-IBS). В 2008 году рандомизированное простое слепое плацебо-контролируемое исследование с участием 30 пациентов с D-IBS сравнивало эффекты добавок с пробиотическим ферментированным молоком, содержащим Lactobacillus acidophilus, B. longum и другие молочнокислые бактерии, с молочным напитком-плацебо без пробиотиков.Через 4 недели проницаемость тонкой кишки значительно снизилась ( P = 0,004), а общие баллы IBS значительно снизились ( P <0,001) в группе пробиотиков по сравнению с плацебо. 191

    Рандомизированное плацебо-контролируемое исследование, проведенное в 2009 году, изучило эффекты перорального приема добавок Bifidobacterium breve Yakult у 42 детей, проходящих химиотерапию рака. Частота лихорадки и использования внутривенных антибиотиков была ниже в группе пробиотиков по сравнению с плацебо.Частота избыточного роста Enterobacteriaceae была ниже в группе пробиотиков, и только группа пробиотиков поддерживала нормальные уровни органической кислоты и pH в кале. 192

    Рандомизированное двойное слепое плацебо-контролируемое исследование 2009 г. оценивало эффекты пренатального и послеродового приема пробиотиков с B. bifidum BGN4, B. lactis AD011 и L. acidophilus AD031 у 112 беременных женщин с семейным анамнезом. аллергического заболевания.Прием пробиотиков начинали за 4–8 недель до родов и продолжали в течение 6 месяцев после родов. Младенцев кормили исключительно грудью в течение 3 месяцев и кормили грудным или коровьим молоком с 4–6 месяцев. Через 1 год у детей в группе пробиотиков частота экземы была значительно ниже, чем в контрольной группе (18,2% против 40,0%, P = 0,048). 193

    Двойное слепое плацебо-контролируемое перекрестное исследование, проведенное в 2004 г., изучало влияние L.rhamnosus 19070-2 и L. reuteri DSM 12246 у 41 ребенка с умеренным и тяжелым атопическим дерматитом, повышенным IP и желудочно-кишечными симптомами. IP измеряли при пероральном введении лактулоза-маннит. Исследователи обнаружили положительную связь между соотношением лактулозы и маннита и тяжестью экземы. После 6 недель приема пробиотиков симптомы со стороны желудочно-кишечного тракта значительно улучшились ( P = 0,002), а соотношение лактулозы и маннита было значительно ниже ( P = 0.001). Исследователи пришли к выводу, что добавление пробиотиков может улучшить барьерную функцию кишечника и уменьшить желудочно-кишечные симптомы у детей с атопическим дерматитом. 194

    L. rhamnosus Lcr35 показал свою эффективность в сокращении продолжительности острой диареи у детей. Открытое рандомизированное исследование 2009 года с участием 23 детей с острым ротавирусным гастроэнтеритом показало, что L. rhamnosus значительно снижали концентрацию ротавируса в кале дозозависимым образом ( P = 0.012). Минимальная эффективная доза составила 0,6 миллиарда КОЕ в день в течение 3 дней. 195 Таблица 6 содержит рекомендуемую комбинацию пробиотических бактерий для поддержания здоровой микрофлоры кишечника и нормальной проницаемости слизистой оболочки.

    ТАБЛИЦА 6

    Пробиотическая микрофлора кишечника

    Комбинация пробиотиков для получения 1–5 миллиардов КОЕ:

    Лактобациллы: L. acidophilus, L. rhamnosus

    Бифидобактерии: B.bifidum, B. lactis, B. longum, B. breve

    Пищевые волокна

    Пищевые волокна играют важную роль в поддержании нормального функционирования и здоровья желудочно-кишечного тракта. Исследования показывают, что клетчатка помогает поддерживать нормальную барьерную функцию слизистой оболочки кишечника. 196-199 Растворимая клетчатка ферментируется микрофлорой толстой кишки, способствуя росту полезных бифидобактерий . Ферментация пищевых волокон микрофлорой толстой кишки является основным источником короткоцепочечных жирных кислот кишечника, включая масляную кислоту.Масляная кислота является важным источником энергии для эпителиальных клеток кишечника и играет ключевую роль в гомеостазе толстой кишки. Было показано, что бутират подавляет воспаление, снижает окислительный стресс и поддерживает нормальную барьерную функцию слизистой оболочки толстой кишки. 200,201

    Семена подорожника и льняное волокно демонстрируют преимущества как растворимых, так и нерастворимых пищевых волокон для человека. 202,203,204 В исследованиях на животных было показано, что как растворимые, так и нерастворимые пищевые волокна помогают поддерживать нормальную барьерную функцию в дистальном отделе толстой кишки. 205-207 В исследовании с участием 26 здоровых молодых взрослых добровольцев потребление 9 г льна в день в течение 2 недель привело к эффективному расслаблению и увеличению каловых масс примерно 3: 1 на каждый грамм потребленного льна. Во второй группе этого исследования 11 субъектов употребляли лен в качестве тестового обеда, испеченного в хлеб, по сравнению с хлебом без льна, получавшим плацебо. Потребление льна значительно контролировало пиковые уровни глюкозы в крови после приема пищи и площадь под кривой по сравнению с контрольным хлебом без льна ( P <0.05 и P = 0,015 соответственно). 208

    Рандомизированное контролируемое исследование, проведенное в 2009 году, изучало эффективность добавок псиллиума или отрубей по сравнению с плацебо для контроля симптомов у 275 пациентов с синдромом раздраженного кишечника. Пациенты 3 групп ежедневно принимали 10 г клетчатки, отрубей или плацебо. После 3 месяцев лечения у пациентов в группе подорожника наблюдалось значительное снижение тяжести симптомов ( P = 0,03). Пациенты, принимавшие отруби, имели незначительную тенденцию к уменьшению выраженности симптомов. 209 В ходе клинического исследования 2007 года было обнаружено, что комбинированное лечение псиллиумом и пробиотиком , бифидобактериями и , лактобациллами значительно улучшает симптомы диареи и боли в животе у пациентов с болезнью Крона. 210 Таблица 7 содержит рекомендуемую комбинацию пищевых волокон для ежедневного приема, чтобы способствовать здоровому функционированию желудочно-кишечного тракта и нормальной проницаемости слизистой оболочки.

    ТАБЛИЦА 7

    Пищевые добавки с клетчаткой

    Обеспечиваемая комбинация пищевых волокон:

    Шелуха семян подорожника 1-5 г

    Семена льна 1-5 г

    Пример лечебного питания при синдроме дырявого кишечника с болью в суставах и усталостью

    Пилотное исследование 1993 г. изучало влияние пищевых добавок и ограничений диеты на жалобы со стороны опорно-двигательного аппарата и ИП у пациентов с нетравматической воспалительной болью в суставах и утомляемостью продолжительностью не менее 60 дней.Десять пациентов, включенных в исследование, получили анкету для определения исходных симптомов и пероральный тест на лактулозу-маннит для измерения IP. Пациенты были помещены на ограниченную диету, исключающую пшеницу, молочные продукты, яйца и рафинированные углеводные продукты. Они также были включены в протокол диетических добавок, состоящий из препарата пищеварительных ферментов растений (например, кислотоустойчивой протеазы грибов, амилазы, липазы), протеазы растительных ферментов, формулы комбинации антиоксидантов и формулы комбинации пробиотика и пребиотика.Никакие другие лекарства или обезболивающие не были разрешены во время исследования.

    В конце 60-дневного периода лечения были введены анкеты для последующих исследований и повторные тесты IP. Семь пациентов завершили двухмесячный протокол исследования и последующее тестирование. В эту группу вошли 2 пациента, у которых ранее был диагностирован псориатический артрит, и 1 пациент с системной красной волчанкой. Результаты, представленные в исследовании, показали, что все 7 пациентов снизили IP при последующем тестировании.Все пациенты сообщили о снижении утомляемости: 1 - о небольшом улучшении, 4 - умеренном и 2 пациента - о значительном улучшении энергии. Шесть из семи сообщили о снижении количества жалоб со стороны опорно-двигательного аппарата от умеренного до умеренного. Ограничения исследования включали открытый, неконтролируемый дизайн, небольшой размер выборки, отсутствие количественного или статистического анализа результатов исследования и субъективное сообщение об улучшении боли в суставах и утомляемости. Автор пришел к выводу, что результаты исследования указывают на корреляцию между IP, скелетно-мышечной болью и хронической усталостью, и что программа диетических изменений и добавок может оказывать влияние на проницаемость кишечника, опорно-двигательные жалобы и утомляемость у некоторых пациентов. 211

    Заключение

    дефекта IP может вызвать тяжелое заболевание и смерть у людей с высокой степенью риска. В менее критических условиях, встречающихся в клинической практике, синдром повышенной кишечной проницаемости часто можно определить как сопутствующий или причинный фактор широкого спектра хронических заболеваний. Ряд двойных слепых плацебо-контролируемых исследований свидетельствует о том, что диетические добавки с определенными антиоксидантами, питательными веществами для слизистых оболочек, ферментами, пробиотиками и клетчаткой могут быть значительно эффективными при лечении дефектов IP и связанных с ними состояний.Однако в большинстве случаев доказательства являются косвенными и основаны на исследованиях in vitro, на людях или на животных.

    В этой статье представлены доказательства эффективности ряда питательных веществ, а также авторские рекомендации по протоколу лечения, состоящему из различных комбинаций, форм и дозировок этих питательных веществ. В статье не рассматриваются какие-либо подробности диеты или образа жизни, а также лекарственные препараты, которые могут быть важны для определенных людей с точки зрения этиологии или лечения дефектов ВП.Некоторые из предложенных комбинаций и дозировок в этом протоколе использовались эпизодически в течение почти 20 лет; однако ни один из них не оценивался на эффективность в контролируемых клинических условиях.

  • Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *