Дисбактериоз кишечника по мкб 10: Ошибка 404. Файл не найден

Содержание

симптомы у взрослых, лечение по низким ценам в СПБ, отзывы

Дисбактериоз — состояние организма, характеризующееся микробным дисбалансом на теле или внутри него (чаще всего в кишечнике). Сам по себе болезнью не является (в МКБ-10 понятие “дисбактериоз” не определено), но часто выступает как симптом другого заболевания. Это очень распространенное состояние, встречающееся примерно у 90 % взрослых (в равной степени у мужчин и женщин) и 95 % детей. Для кишечника выделяется 4 степени дисбактериоза:

  • 1 степень. Пациенты отмечают дискомфорт только при смене привычной диеты или употреблении новых продуктов.После возвращения к обычному образу питанию баланс микрофлоры восстанавливается и симптоматика исчезает.
  • 2 степень. Количества производимых ферментов недостаточно для нормального пищеварения. Симптомы включают в себя вздутие живота, диарею или запоры, периодическую тошноту.
  • 3 степень. Кишечная стенка реагирует на присутствие патогенной микрофлоры хроническим воспалительным процессом. Состояние требует медицинской помощи.
  • 4 степень. К воспалению кишечной стенки добавляются проблемы всасывания — развивается дефицит витаминов, микроэлементов и питательных веществ во всеми сопутствующими симптомами. Защитные свойства нормальной микрофлоры теряются и возникает гроза тяжелых кишечных инфекций и отравлений.

Причины появления дисбактериоза

Существует множество предпосылок к появлению дисбактериоза:

  • хронические патологии желудочно-кишечного тракта;
  • длительный прием антибиотиков;
  • неполноценная диета;
  • пожилой возраст;
  • гормонотерапия;
  • лечение онкологических заболеваний;
  • хронический стресс;
  • частые кишечные инфекции;
  • метаболические нарушения.

Дисбактериоз кишечника у женщин также может появиться после беременности, родов или аборта.

Симптомы дисбактериоза

На ранних этапах дисбактериоз кишечника может проявляться множеством признаков, но особое внимание следует обратить на:

  • отрыжку;
  • тошноту;
  • постоянное урчание в животе;
  • метеоризм;
  • периодические ноющие или режущие боли;
  • нарушения консистенции стула;
  • сухость кожи;
  • неприятные привкусы во рту и горечь;
  • расстройства сна.

Диагностика дисбактериоза

Подтверждение состояния дисбактериоза выполняется исключительно опытным специалистом с использованием специальной аппаратуры. Обследование на наличие дисбактериоза включает в себя:

  • анализ крови;
  • анализ мочи;
  • специфические ПЦР-тесты;
  • физикальные обследования кожи.

Диета при дисбактериозе

Когда дисбактериоз вызван погрешностями режима питания, на помощь приходит диета, соблюдение которой должно быть неукоснительным. Так, при дисбактериозе запрещены:

  • блюда острым вкусом и обилием приправ;
  • алкогольные напитки;
  • жирная, жареная пища;
  • необработанные фрукты и овощи;
  • некоторые злаки и бобовые;
  • белый хлеб и дрожжевая выпечка.

Диетологи при дисбактериозе рекомендуют употреблять только вареную и тушеную еду, а также блюда, приготовленные на пару. Сами приемы пищи должны быть дробными, 5-6 раз в день.

Лечение дисбактериоза

Если дисбактериоз спровоцирован применением антибиотиков или перенесенной острой кишечной инфекцией, то при своевременной диагностике и правильной коррекции этого состояния можно добиться полного восстановления равновесия кишечной микрофлоры. Если же дисбактериоз является следствием хронического заболевания, то избавиться от него нельзя, не устранив его причину, но периодически проводить терапию, направленную на нормализацию микрофлоры кишечника просто необходимо, так как изменения микрофлоры могут приводить и поддерживать обострения основного заболевания.

Лечение хронического дисбактериоза у взрослых зависит от причин и симптомов и назначается комплексно. Стандартная схема лечения включает меры, направленные на:

  • устранение избыточности патогенных микроорганизмов;
  • восстановление нормальной микрофлоры;
  • улучшение процесса пищеварения;
  • нормализацию моторики кишечника;
  • стимулирование реактивности организма.

Врачи из клиники Долголетие в Санкт-Петербурге имеют огромный опыт лечения дисбактериоза кишечника и провоцирующих его болезней. Специалисты подберут индивидуальный план лечения. Записаться на прием можно на сайте (круглосуточно), и у администратора по телефону. Для удобства наших пациентов прием осуществляется и в выходные дни.

Дисбактериоз / Новости общества Красноярска и Красноярского края / Newslab.Ru

Невероятно, но факт: в России люди лечатся от болезней, о которых ничего не знают на Западе. Нет-нет, речь идет вовсе не о тех природно-очаговых заболеваниях, которые встречаются только в определенной местности.

Я говорю о болезнях-призраках, которые иногда даже не встречаются в зарубежных источниках (например, в Международном классификаторе болезней 10го издания — МКБ-10), однако российские врачи время от времени выставляют их в качестве диагнозов нашим согражданам. И пациенты добросовестно «лечатся», сдают анализы, «выздоравливают»... Тратят деньги и здоровье, принимая сомнительные лекарства... Если уж и говорить о пользе, то крупицы ее есть разве что в профилактике — тех общих рекомендациях, которые если и не спасут от «рецидива», то хотя бы в целом подскажут, как поддержать здоровый образ жизни.

Удивительно и то, что заболевания эти — не редкие, они на слуху у каждого, и обыватель привык воспринимать их без критики. Мне показалось полезным рассказать вам про некоторые из них: информированность — лучшее оружие в борьбе с неграмотностью врачей. И первый в нашем списке -

Дисбактериоз

Эту болезнь очень «любят» диагностировать недобросовестные врачи-педиатры, да и терапевты общей практики, увы, тоже. Слишком уж «удобно» объяснять им такие симптомы, как периодическая диарея, повышенное газообразование, неприятные ощущения в кишечнике, а, кроме того, аллергию или проблемы с кожей на лице.

Между тем, если разобраться, каждое из перечисленных состояний можно объяснить реально существующими заболеваниями — такими, как синдром раздраженной толстой кишки, патология иммунитета или гормональные нарушения.

В строгом смысле слова, нарушение микрофлоры кишечника — это скорее симптом, подразумевающий под собой некую разбалансировку состава микробной среды в пищеварительном тракте. Но кишечник — как саморегулирующаяся система, способен сам восстановить нормальный баланс, если «хозяин» нормализует режим питания — введет в рацион больше фруктов и овощей.

Употребление специальных препаратов для борьбы с дисбактериозом — не обязательно, учитывая, что эффективность действия большинства из них не доказана: чуждая микрофлора из «живых» йогуртов, как правило, не приживается в кишечнике, а бактериофаги полностью перевариваются в желудке. Да и как проверить эффективность лечения, если не существует даже критериев диагностики самого заболевания? Проводить бактериологическое исследование кала? Но там содержится около 400 видов микроорганизмов, да и нет никакой «нормы» состава, не исследовано влияние на него возраста, пола, беременности, применяемых лекарств и хронических заболеваний. Потому весьма популярный во многих лабораториях «анализ микрофлоры кишечника на дисбактериоз» — неприкрытая профанация и попытка заработать на беспокойстве граждан о состоянии своего здоровья.

Даже после вынужденного приема антибиотиков то состояние, которое мы называем дисбактериозом, способно сойти на нет без помощи «извне», лишь бы общее состояние человека нормализовалось. То есть достаточно восстановить нормальный режим питания — и через некоторое время «условия проживания» в кишечнике восстановятся, и полезные бактерии размножатся до прежних количеств.

Советую почитать очень занятное интервью о детском дисбактериозе с врачом высшей категории, членом российской гастроэнтерологической ассоциации В.В.Василенко о том, почему же этот диагноз так любят выставлять некоторые отечественные «специалисты». С юмором и грустью, и очень профессионально написано.

Будем считать, что с первым обманом мы разобрались. Будут вопросы — задавайте. А продолжение следует...

Ольга Дарсавелидзе

Карта сайта

Адреса клиник г. Казань

Адрес: ул. Гаврилова, 1, ост. «Гаврилова» (пр. Ямашева)

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00

Автобус: 10, 10а, 18, 33, 35, 35а, 36, 44, 45, 46, 49, 55, 60, 62, 76

Троллейбус: 2, 13

Трамвай: 5, 6

Адрес: ул. Т.Миннуллина, 8а, (Луковского) ост. «Театр кукол»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00

Автобус: 1, 2, 31, 37, 47, 74

Троллейбус: 6, 8, 12

Метро: Суконная слобода

 

 

Адрес:
ул. Сыртлановой, 16, ст. метро Проспект Победы, ост. ул. Сыртлановой (проспект Победы)

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00 

Автобус: 5, 34, 37, 62 77

Трамвай: 5

Метро: Проспект Победы

Адрес: ул. Назарбаева, 10, ст. метро «Суконная Слобода», ост. «Метро Суконная Слобода»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: выходной

Автобус: 1, 4, 25, 43, 71

Метро: Суконная слобода

 

 

Адрес: ул. Декабристов, 180, ст. метро «Северный вокзал», ост. «Гагарина»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: выходной

Автобус: 6, 18, 29, 33, 37, 40, 43, 53, 62, 76, 78, 89

Троллейбус:

13

Трамвай: 1, 6

Метро: Северный вокзал

Адрес: пр. А.Камалеева, 28/9, (жилой комплекс «XXI век»), ост. «Новый ипподром»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00 

Троллейбус: 3

 

 

Адрес: Дербышки, ул. Мира, 20, ост. «Магазин Комсомольский», «Гвоздика»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00 

Автобус: 1, 19, 25, 34, 44, 60, 84

Адрес: ул. Серова, 22/24, ост. «ул. Серова»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00 

Автобус: 10, 10а

 

 

Адрес: ул. Беломорская, 6, ст. метро «Авиастроительная», ост. «ул. Ленинградская»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00 

Автобус: 6, 18, 33, 37, 40, 42, 43, 53, 60, 78, 89, 93

Троллейбус: 13

Трамвай: 1

Метро: Авиастроительная

Адрес: ул. Закиева, 41а, ост. «Кабельное телевидение»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00 

Автобус: 5, 18, 30, 31, 34, 45, 46, 62, 63, 77, 89

Троллейбус: 3, 5, 9, 12

 

 

Адрес: ул. Кул Гали, 27, ост. «ул. Кул Гали» (ул. Габишева)

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: выходной

Автобус: 46, 90

Адрес: ул. Рихарда Зорге, 95, м. «Дубравная», ост. «ул. Юлиуса Фучика»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00

Автобусы: 5, 18, 30, 31, 33, 34, 45, 68, 74, 77

Троллейбусы: 5, 9, 12

Трамвай: 4

Метро: Дубравная

 

Страница не найдена |

Страница не найдена |

404. Страница не найдена

Архив за месяц

ПнВтСрЧтПтСбВс

78910111213

14151617181920

21222324252627

282930    

       

       

       

     12

       

     12

       

      1

3031     

     12

       

15161718192021

       

25262728293031

       

    123

45678910

       

     12

17181920212223

31      

2728293031  

       

      1

       

   1234

567891011

       

     12

       

891011121314

       

11121314151617

       

28293031   

       

   1234

       

     12

       

  12345

6789101112

       

567891011

12131415161718

19202122232425

       

3456789

17181920212223

24252627282930

       

  12345

13141516171819

20212223242526

2728293031  

       

15161718192021

22232425262728

2930     

       

Архивы

Июл

Авг

Сен

Окт

Ноя

Дек

Метки

Настройки
для слабовидящих

Публикации в СМИ

Болезнь дивертикулярная кишечника — заболевание, характеризующееся образованием дивертикулов кишечной стенки; возможно развитие дивертикулёза (множественных дивертикулов) и дивертикулита (см. Болезнь дивертикулярная).

Частота дивертикулярной болезни толстой кишки достигает 20% в популяции; с возрастом частота растёт, достигая 40–50% среди пациентов 60–80 лет. Преобладающий возраст — 60–80 лет. До 40 лет возникает редко.

Классификация • Дивертикулы толстой кишки. Более частое поражение левой половины толстой кишки объясняют её анатомическими и функциональными особенностями — меньший диаметр, большое количество изгибов, более плотная консистенция содержимого; сигмовидная кишка обладает резервуарной функцией, поэтому давление в ней выше • Дивертикулы тонкой кишки встречают реже дивертикулов толстой. Чаще возникают дивертикулы двенадцатиперстной кишки (см. Дивертикулы желудка и двенадцатиперстной кишки), преимущественно её дистального отдела. В 3% случаев дивертикулы двенадцатиперстной кишки сочетаются с дивертикулами тощей и подвздошной кишки.

Этиология во многом спорна, возникновение заболевания обусловлено скорее сочетанием факторов, а не действием одного из них • Грыжевая теория — одна из наиболее распространённых. Причиной образования выпячиваний считают слабость соединительнотканного каркаса кишечной стенки, развивающуюся по мере старения организма. Нарушение моторной функции кишечника, также характерное для стареющего организма, ведёт к повышению внутрикишечного давления и выпячиванию слизистой оболочки в местах наименьшего сопротивления. Наиболее высокое внутрикишечное давление возникает в самом узком отделе толстой кишки — сигмовидном. По этой причине дивертикулы чаще образуются именно там. Близкое расположение кровеносных сосудов объясняет склонность дивертикулов к кровотечениям • Сосудистая теория. Основная причина появления дивертикулов — изменения в кишечной стенке вследствие нарушения кровообращения • Теория врождённой предрасположенности • Механическая, или пульсионная, теория. При повышенной активности гладкой мускулатуры кишечной стенки возникает чрезмерная сегментация кишки, приводящая к повышению внутрикишечного давления на отдельных участках. Под влиянием высокого давления происходит выпячивание слизистой оболочки через мышечную.

Генетические аспекты — см. Болезнь дивертикулярная.

Факторы риска развития дивертикулярной болезни кишечника • Возраст старше 40 лет • Диета с низким содержанием растительной клетчатки.

Факторы риска дивертикулита • Дивертикулит в анамнезе • Множественные дивертикулы ободочной кишки.

Клиническая картина • Дивертикулёз без клинических проявлений • Дивертикулёз с клиническими проявлениями характеризуется абдоминальными болями, вздутием живота, неустойчивым стулом (чередование запоров, диареи и нормального стула) • Выделяют неосложнённый и осложнённый дивертикулёз •• Клиническая картина неосложнённого дивертикулёза характеризуется периодическими болями в животе, вздутием живота, неустойчивым стулом (чередование запоров, диареи и нормального стула) •• Дивертикулёз с осложнённым течением (см. Осложнения).

Сопутствующая патология. Колит, дисбактериоз.

Возрастные особенности • Дети. Дивертикулярная болезнь возникает очень редко, чаще возможны осложнения дивертикула Меккеля • Пожилые. Возникает наиболее часто, диагностика затруднена из-за большого количества сопутствующих заболеваний.

Осложнения дивертикулёза

• Дивертикулит встречают примерно у 25% пациентов с дивертикулёзом. Основные признаки •• Острое начало — боль и напряжение мышц передней брюшной стенки в левом нижнем квадранте живота •• При прогрессировании заболевания — повышение температуры тела, озноб •• Анорексия, тошнота, рвота •• Диарея или запор •• Болезненный плотный малоподвижный инфильтрат в брюшной полости (при распространении воспалительного процесса с дивертикула на окружающие ткани) •• При вовлечении в процесс мочевого пузыря — дизурия.

• Перфорация •• При перфорации дивертикула в брюшную полость развивается клиника разлитого перитонита •• При перфорации дивертикула в забрюшинную клетчатку или пространство между листками брыжейки возникают инфильтраты или абсцессы •• При медленном прогрессировании воспаления серозная оболочка слипается с окружающими органами, возникает прикрытая перфорация •• Развитие перитонита может быть связано не только с перфорацией дивертикула, но и абсцессами, возникающими в толще кишечной стенки, при воспалении и отёке шейки дивертикула с его закупоркой.

• Кровотечение •• Возникает в 20–25% случаев, нередко — первое и единственное проявление заболевания •• Обычно кровотечение связано с изъязвлением шейки или стенки дивертикула и проходящего там сосуда в результате хронического воспаления или образования пролежня на месте калового камня •• Кровотечение из невоспалённого дивертикула может возникнуть у пациентов с эссенциальной артериальной гипертензией, атеросклерозом, заболеваниями сердца, заболеваниями крови, СД и при длительном применении ГК •• Объём кровопотери бывает различным: незначительная примесь крови в каловых массах (иногда скрытое кровотечение), массивное профузное кровотечение, сопровождающееся коллапсом и иногда приводящее к смерти.

• Кишечная непроходимость •• Причиной кишечной непроходимости могут быть воспалительный инфильтрат, сдавливающий кишку, спаечный процесс, приводящий к деформации кишки и её брыжейки, в отдельных случаях — инвагинация части кишки с дивертикулом или спазм гладкой мускулатуры •• Кишечная непроходимость при дивертикулёзе чаще носит характер обтурационной со всеми присущими этой форме проявлениями.

• Внутренние или, реже, наружные кишечные свищи •• У мужчин чаще развиваются сигмо-везикальные свищи, у женщин — сигмо-вагинальные •• При формировании внутренних свищей возможно образование сложной системы свищевых ходов, открывающихся на кожу передней брюшной стенки •• При образовании кишечно-мочепузырного свища — пневматурия, фекалурия.

• Дивертикулы тонкой кишки могут приводить к развитию синдрома мальабсорбции вследствие чрезмерного роста бактериальной флоры.

Лабораторные исследования • При дивертикулёзе количество лейкоцитов в периферической крови обычно остаётся в пределах нормы; при дивертикулите часто возникают сдвиг лейкоцитарной формулы влево, повышение СОЭ • При кровотечении развивается ЖДА • В моче возможно обнаружение лейкоцитов, эритроцитов, компонентов кишечного содержимого; при образовании кишечно-мочепузырного свища в моче обнаруживают бактерии, специфичные для кишечника • Данные копрологического исследования, подтверждающие наличие воспаления: нейтрофильные лейкоциты, примесь к слизи большого количества макрофагов, десквамированного эпителия.

Специальные исследования • Контрастное рентгенологическое исследование. Традиционную ирригографию или колоноскопию считают наиболее ценным диагностическим исследованием при дивертикулёзе. При осложнённом дивертикулёзе в первые 1–2 недели при исследовании ограничиваются только ректоромано- и колоноскопией. При подозрении на дивертикулит можно использовать водорастворимое рентгеноконтрастное вещество (например, гастрографин) • Дивертикулы толстой кишки могут быть выявлены и при пероральном контрастном исследовании через 24–72 ч после приёма бариевой взвеси внутрь • Обзорная рентгенография органов брюшной полости в горизонтальном и вертикальном положениях — при перфорации дивертикула и перитоните • Колоноскопия позволяет выявить источник кишечного кровотечения. Характерные эндоскопические признаки дивертикулёза •• Наличие единичных или множественных устьев дивертикулов (отверстий) в стенке кишки •• Часто около устья дивертикула обнаруживают кровеносный сосуд •• В зоне дивертикула — повышенный тонус и ригидность кишечной стенки; при близости дивертикула к физиологическим сфинктерам последние спазмированы, раскрываются с трудом •• Иногда можно наблюдать выделение гноя из устья дивертикула • КТ применяют в острой стадии заболевания для оценки состояния кишечной стенки и околокишечных тканей. При наличии признаков острой патологии КТ — более предпочтительный метод диагностики, чем ирригография • Цистоскопия и цистография показаны для диагностики пузырно-кишечных свищей • Внутривенная урография позволяет установить возможное вовлечение в воспалительный процесс мочеточников • Ангиография — диагностический метод, применяемый при кровотечении из дивертикула; возможно проведение терапевтических мероприятий посредством эмболизации кровоточащего сосуда • Фистулографию применяют при развитии кишечных свищей для установления их связи с кишкой.

ЛЕЧЕНИЕ

Режим • При дивертикулёзе с клиническими проявлениями, но без интоксикации, симптомов раздражения брюшины, лейкоцитоза возможно амбулаторное наблюдение и лечение • При дивертикулёзе с осложнённым течением показано стационарное лечение в специализированном отделении (колопроктологии) • При дивертикулите необходимо ограничение физической активности.

Диета • Всем больным с дивертикулёзом показана диета с повышенным содержанием растительной клетчатки • Пшеничные отруби значительно снижают внутриполостное давление и ускоряют скорость миграции содержимого кишечника, причём в большей степени этот эффект оказывают отруби грубого помола • Необходимо исключение продуктов, вызывающих метеоризм (бобовые, виноград, чечевица, лук) и запоры (черника, рис). Следует исключить также семечки, плоды с большим количеством зёрен и чрезмерно грубую клетчатку (хурма, ананасы, репа, редис, редька).

Тактика ведения • При бессимптомном дивертикулёзе кишечника, выявленном случайно, в специальном лечении необходимости не возникает. Рекомендуют богатую растительной клетчаткой диету с целью профилактики дальнейшего прогрессирования заболевания и предупреждения возможных осложнений • При дивертикулёзе с выраженными клиническими проявлениями применяют комплекс лечебных мероприятий: послабляющую диету, спазмолитики, препараты, регулирующие моторную функцию кишечника, и средства, нормализующие состав бактериальной флоры кишечника. У большинства пациентов с клинически выраженным дивертикулёзом толстой кишки консервативное лечение даёт стойкий эффект • При дивертикулите показано назначение НПВС, антибиотиков, кишечных антисептиков, средств, восстанавливающих нормальную микрофлору кишечника • При развитии кровотечения из дивертикула показано введение вазопрессина по катетеру при проведении селективной ангиографии • При решении вопроса о необходимости хирургического лечения ориентируются на клиническую картину, сочетание факторов риска.

Показания к оперативному лечению: •• Осложнения дивертикулёза, представляющие непосредственную угрозу для жизни пациента, — перфорация дивертикула в брюшную полость с развитием диффузного перитонита, кишечная непроходимость, массивное кровотечение •• Наличие свищей •• Образование хронических инфильтратов, симулирующих опухоль •• Частые обострения хронического дивертикулёза •• В настоящее время хирургическое лечение всё чаще применяют и при неосложнённом, но клинически выраженном дивертикулёзе, не поддающемся комплексному консервативному лечению.

Лекарственная терапия • Дивертикулёз •• Спазмолитические средства (папаверина гидрохлорид 2% р-р 1–2 мл п/к или в/м, бенциклан 0,05 г в/м или дротаверин 2% р-р 2–4 мл в/м ) при болевом синдроме •• Пиридостигмина бромид по 0,06 г 1–3 р/сут внутрь или 2–5 мг п/к или в/м; метоклопрамид по 10 мг 3 р/сут внутрь (до еды) или в/м — для усиления моторики желудка и кишечника •• Эшерихия коли, бифидобактерии бифидум или бификол — при выявлении дисбактериоза для восстановления нормальной кишечной микрофлоры •• Вазелиновое или оливковое масло внутрь или в микроклизмах — при постоянных запорах • Дивертикулит •• В период острого дивертикулита рекомендуют назначать антибиотики или •• производные 5-оксихинолина (хлорхинальдол) •• НПВС •• Эшерихия коли, бифидобактерии бифидум или бификол — при выявлении дисбактериоза • Альтернативные препараты. Тобрамицин и метронидазол, цефалоспорины третьего поколения.

Хирургическое лечение

• Выбор метода операции в каждом конкретном случае зависит от следующих факторов: •• Характера осложнений и распространённости процесса •• Воспалительных изменений тканей дивертикула, кишечной стенки и окружающих тканей •• Наличия перифокального воспаления или перитонита •• Немаловажное значение имеют сопутствующие заболевания, часто наблюдаемые у лиц пожилого возраста.

• Предпочтительнее выполнять резекцию толстой кишки в плановом порядке с одновременным наложением анастомоза. Операцию выполняют приблизительно через 6–12 нед после купирования острого приступа дивертикулита.

• Свищи ободочной кишки у пациентов с дивертикулярной болезнью подлежат хирургическому лечению, т.к. у большинства больных самостоятельного заживления не происходит и хроническое воспаление в окружающих тканях приводит к развитию хронической интоксикации; при формировании кишечно-пузырных свищей возникает угроза развития восходящей инфекции мочевых путей •• Оперативные вмешательства у больных со сложными свищами (имеющими несколько свищевых ходов, в т.ч. и слепо заканчивающихся) при наличии парафистулярных полостей целесообразно проводить в несколько этапов, что позволяет снизить летальность и уменьшить частоту рецидивов свища.

• При профузном кровотечении необходимо производить гемиколэктомию, чаще всего левостороннюю •• Вопрос о наложении первичного анастомоза следует решать индивидуально, исходя из общего состояния пациента, выраженности анемии, качества предоперационной подготовки толстой кишки.

• Выбор операции при перфорации кишки на фоне острого дивертикулита должен быть строго индивидуален •• Резекция сигмовидной кишки с наложением первичного анастомоза — наиболее эффективный метод лечения при возникновении местных отграниченных абсцессов. Наличие отграниченного абсцесса не считают противопоказанием для наложения первичного анастомоза, если участки кишки, участвующие в анастомозировании, не вовлечены в воспалительный процесс и отсутствует иммунодефицитное состояние •• Резекция сигмовидной кишки с наложением первичного анастомоза и выведением разгрузочной колостомы проксимального участка анастомоза (например, трансверзостома) •• Резекция вовлечённого в патологический процесс сегмента сигмовидной кишки с выведением концевой колостомы и ушиванием дистального сегмента кишки (операция типа Хартманна). После стихания воспалительного процесса (обычно через 2,5–3 мес) выполняют реконструктивную операцию, восстанавливающую анатомическую непрерывность толстой кишки •• Наложение разгрузочной двуствольной трансверзостомы и дренирование полости абсцесса (обязательно со «шпорой» и пересечением обоих концов кишки).

Амбулаторное наблюдение • Диспансерное наблюдение у колопроктолога поликлиники • Ирригография, колоноскопия каждые 3 года при дивертикулёзе с клиническими проявлениями • При стойкой периодичности рецидивов дивертикулита показаны противорецидивные курсы лечения.

Течение и прогноз • Прогноз при дивертикулярной болезни кишечника в большинстве случаев благоприятный, однако в некоторых ситуациях она может привести к развитию тяжёлых и угрожающих жизни осложнений. Это можно объяснить не только тяжестью самих осложнений, но и преимущественным поражением пожилых людей, часто имеющих сопутствующие заболевания, а также меньшей сопротивляемостью организма в этой возрастной группе • У 33% пациентов возникают рецидивы воспалительного процесса • В среднем у 20% пациентов с дивертикулёзом, осложнённым кровотечением, возникают повторные кровотечения через несколько месяцев или лет.

Профилактика. Профилактика запоров: соблюдение режима питания и диеты, активный образ жизни, ЛФК, массаж.

МКБ-10 • K57 Дивертикулярная болезнь кишечника.

Тамбовская областная клиническая больница имени В.Д. Бабенко

Даже оправданное применение антибиотиков при инфекционных заболеваниях  снижает содержание живых микроорганизмов в кишечнике в тысячу — миллион раз! При благоприятных условиях совокупность живых микроорганизмов (микробиота) самостоятельно быстро восстанавливается и это не требует вмешательства. Если же восстановление затягивается, тогда уместно говорить о дисбактериозе.

Следует особо подчеркнуть, что в Международной классификации болезней «дисбактериоз» как самостоятельное заболевание отсутствует, в то же время по данным ВОЗ более 90% жителей Земли в той или иной степени страдают дисбактериозом кишечника.

Если рассматривать проблему комплексно, то  дисбактериоз смело можно причислять к так называемым «болезням цивилизации», обусловленным образом жизни, рафинированным нерациональным питанием современного человека, преобладанием в пище мучного, острого, жирного, отсутствием достаточного количества растительной пищи и кисломолочных продуктов, использованием антибиотиков и других технологических достижений человечества. Из естественных причин, провоцирующих развитие дисбактериоза кишечника, следует упомянуть кишечные инфекции, а также заболевания органов пищеварения -  гастрит, язвенная болезнь, желчнокаменная болезнь и др. Дисбактериоз не развивается у здоровых людей, это маркёр неблагополучия.

Кишечник человека населён целыми полчищами микробов – «плохих», «хороших» и «нейтральных». Полезные микробы — бифидобактерии, лактобактерии и бактероиды  оказывают помощь в пищеварении, защищают от аллергии, поддерживают иммунную систему и даже снижают вероятность развития онкологических заболеваний, держат в узде «врагов»: стафилококков, протея, стрептококков, грибков рода кандида и множество других. Когда баланс нарушается – число «полезных» бактерий снижается,  нарастает количество вредоносных, развивается дисбактериоз. Толчком к его развитию может послужить даже смена привычного рациона питания, что нередко происходит в дальних поездках; существует даже специальный термин – «диарея путешественников». Без лечения в стенке кишки постепенно развиваются воспалительные процессы, болезнь прогрессирует. Длительно текущий дисбактериоз характеризуется нарушением всасывания витаминов, жиров, других компонентов пищи, что приводит к снижению веса, анемии в дальнейшем извращаются иммунные реакции организма, происходит аллергизация.

Восстановление микробиоты процесс сложный и длительный, для этого используют разные методы, одни уничтожают «вредные бактерии», другие добавляют «полезные», третьи помогают собственным микробам восстановиться до нормального состояния. Ни один из них не является абсолютным, но все они  дополняют друг друга и могут использоваться в различном сочетании в зависимости от конкретного случая. Что бы составить представление об этом необходимо выделить основные группы лекарственных препаратов.

Пробиотики содержат живые микробы («pro bios – для жизни», в отличие от антибиотиков,  «anti  bios — против жизни»). Они содержат  один или несколько видов живых бактерий, которые являются  нормальными представителями микрофлоры кишечника: бифидумбактерии, лактобактерии, кишечные палочки, энтерококки. Существуют пробиотики, содержащие свободноживущие во внешней среде виды, например относящиеся к роду Bacillus, безвредные для человека, но губительные для других микробов. Особенностью пробиотических микробов является выраженный антагонизм, то есть способность вытеснять другие виды. Применение пробиоиков оправдано после приёма антибиотиков. Однако в средствах массовой информации часто тиражируется заблуждение, что при приеме антибиотика, что бы защититься от вредного влияния на микробиоту и заселить кишечник «полезными» микробами надо принимать пробиотик. Это в корне неверно, так как микробы, содержащихся в пробиотиках очень чувствительны  к антибиотикам и в первую очередь погибают от них. Кроме того и сами пробиотические бактерии не приживаются в кишечнике, а лишь частично восполняют дефицит собственных микробов. Еще одним недостатком пробиотиков, является необратимый процесс отмирания: количество живых микробов к истечению срока годности препарата многократно ниже, чем при выпуске партии с завода изготовителя. Это надо учитывать при покупке пробиотиков.

Пребиотики. В их составе отсутствуют живые бактерии, но есть вещества, избирательно стимулирующие размножение нормальных видов в составе микрофлоры. Преимущество в том, что они не вступают в конфликт с собственной микрофлорой и не погибают от воздействия антибиотиков. Их нужно принимать совместно с антибиотиками, так как они помогают восстановить собственную микрофлору, а не пытаются заселить кишечник «хорошими», но «чужими» микробами.

Бактериофаги, являющиеся вирусами, уничтожают строго определённые виды бактерий. Каждому виду бактерий соответствует свой бактериофаг. Например, стафилококки разрушаются антистафилококковым бактериофагом, синегнойная палочка — антисинегнойным бактериофагом и т. д. Применение их не всегда эффективно: в агрессивной среде кишечного содержимого бактериофаги могут терять активность, а до бактерий, покрытых слоем кишечной слизи, трудно  добраться.

Распространено мнение, что «вредные бактерии» при дисбактериозе нужно удалять с помощью антибиотиков. Это категорически не приемлемо, так как наносит больше вреда, чем пользы. Применение антибиотиков оправдано только для лечения инфекционного заболевания.

Для дисбактериоза характерно длительное сохранение таких симптомы как вздутие живота, поносы, запоры, запах изо рта, тошнота, аллергические реакции на безобидные продукты. Правильнее всего обратиться к гастроэнтерологу, который направит вас на бактериологический анализ кала, а при необходимости на другие лабораторные и инструментальные исследования. После полноценного обследования будет проведена терапия, направленная на болезнь - причину дисбактериоза и на коррекцию микробиоты.

Микробиологический анализ кала на дисбактериоз поможет врачу в подборе препаратов. Следует помнить, что для получения достоверного результата необходимо придерживаться определенных правил при сборе материала на анализ. Прежде всего за 5-7 дней до сбора материала не принимать препараты, влияющие на результат. За более подробной консультацией необходимо обращаться к специалистам бактериологической лаборатории.

В ГБУЗ «ТОКБ им. В.Д. Бабенко» диагностические исследования проводят квалифицированные специалисты с большим опытом работы в клинической микробиологии, в отделении работают  врачи-бактериологи высшей и первой категории. Наличие современной аппаратуры способствует динамичному развитию лаборатории и поддержанию высокого качества исследований, что помогает установить этиологию микробных заболеваний. Через некоторое время  вы избавитесь от неприятностей со здоровьем и сможете снова радоваться жизни.

19 апреля 2019 года

Оренбургская областная клиническая больница

Мы рады приветствовать вас на страницах официального сайта нашей больницы!

Государственное автономное учреждение здравоохранения «Оренбургская областная клиническая больница» (ГАУЗ «ООКБ») свыше 140 лет занимает лидирующее место в здравоохранении области. Благодаря деятельности сотрудников нашего учреждения и бережному отношению к традициям, заложенным нашими предшественниками, мы продолжаем повышать качество и эффективность медицинской помощи. Мощная материально-техническая база, высокий кадровый потенциал, использование эффективных методов диагностики и лечения дают возможность оказывать специализированную, в том числе высокотехнологичную медицинскую помощь населению Оренбургской области и других регионов.

Мощность стационара 933 койки. С 2007 года ГАУЗ «ООКБ» входит в перечень учреждений, оказывающих высокотехнологичную медицинскую помощь по федеральным квотам. С 10 января 2013 в нашей больнице работает региональный сосудистый центр на 120 коек, а 1 января 2014 года на базе нефрологического отделения начал работать областной нефрологический центр.

Мощность консультативной поликлиники 600 посещений в смену, приём ведется по 28 специальностям.

Ежегодно в стационарных отделениях больницы лечатся свыше 24 тысяч пациентов.

Кроме того, ежедневно с выездом на места автомобильным и санитарно-авиационным транспортом специалистами отделения экстренной консультативной медицинской помощи оказывается экстренная помощь при осложнённых заболеваниях, травмах, при необходимости производятся оперативные вмешательства.

Из 404 врачей, работающих в больнице, 4 имеют учёную степень доктора медицинских наук, 33 являются кандидатами медицинских наук, высшая квалификационная категория у 159 врачей. Из 719 средних медицинских работников - у 249 высшая квалификационная категории, 26 медицинских сестёр имеют высшее сестринское образование. 7 врачей нашей больницы носят почётное звание «Заслуженный врач Российской Федерации», 6 – почётное звание «Заслуженный работник здравоохранения Российской Федерации». Нагрудным знаком «Отличник здравоохранения» награждены 31 врач и 6 средних медицинских работников. Почётную грамоту Министерства здравоохранения Российской Федерации имеют 32, почётную грамоту Министерства здравоохранения Оренбургской области – 94 работника больницы.

Совместная работа областной клинической больницы и Оренбургского государственного медицинского университета (института, академии) по подготовке медицинских кадров высшего звена имеет более чем 70-летнюю историю. В настоящее время на нашей базе работают пять кафедр ГБОУ ВПО «Оренбургский государственный медицинский университет».

Для подготовки кадров среднего звена на базе учреждения функционируют вечернее отделение и отделение последипломной подготовки специалистов со средним медицинским и фармацевтическим образованием областного медицинского колледжа.

Наше учреждение имеет лицензию на все осуществляемые виды медицинской деятельности, в том числе на работы и услуги при оказании высокотехнологичной медицинской помощи по 14 специальностям.

Мы надеемся, что наш сайт не только поможет вам найти необходимую информацию, но и оставит у вас самые приятные впечатления.

Главный  врач

ГАУЗ «Оренбургская областная клиническая больница»

 

 

 

 

 

А. В. Редюков


Решаем вместе

Не убран мусор, яма на дороге, не горит фонарь? Столкнулись с проблемой — сообщите о ней!

Сообщить о проблеме

Текущее понимание дисбактериоза при заболевании на моделях человека и животных

Резюме

Воспалительное заболевание кишечника (ВЗК) - это воспалительное заболевание кишечника, которым страдают более двух миллионов человек в Соединенных Штатах. Хотя этиология и патогенез ВЗК все еще в значительной степени неизвестны, для развития ВЗК необходимы нерегулируемые взаимодействия хозяин / кишечные микроби. До сих пор многие исследователи пытались определить точную связь между ВЗК и дисбалансом кишечной микробиоты, называемым «дисбактериозом».Несмотря на прилагаемые усилия, до сих пор практически не известно о взаимодействии между микробами, их хозяевами и окружающей их средой, а также о том, является ли дисбактериоз причинным фактором или следствием ВЗК. Недавно глубокий анализ микробиоты у пациентов с ВЗК оказался полезным для характеристики сильной связи между дисбактериозом и развитием ВЗК, хотя в большинстве случаев он все еще не позволяет выявить специфически связанные изменения на уровне видов. Основываясь на многих недавних сообщениях, дисбактериоз комменсальной микробиоты участвует в патогенезе нескольких заболеваний, включая ВЗК, ожирение и аллергические расстройства, как на моделях людей, так и на животных.

В этой обзорной статье мы сосредоточились на объяснении нескольких типов дисбактериоза, а также заболеваний, связанных с дисбактериозом, и возможных методов лечения, чтобы применить эти знания для понимания возможной причины и потенциально найти терапевтические стратегии для ВЗК, а также другие заболевания, связанные с дисбактериозом.

Ключевые слова: Дисбиоз, воспалительное заболевание кишечника, колоректальный рак, фекальная микробиота, гены восприимчивости к IBD

1. Что такое дисбиоз?

Кишечник взрослого человека содержит около 10 14 бактериальных клеток с более чем 1000 различными видами бактерий.В нормальной микрофлоре кишечника есть несколько основных подразделений бактерий, из которых наиболее доминирующими являются Bacteroidetes и Firmicutes. В кишечнике содержатся как защитные бактерии, так и некоторые бактерии, которые могут быть потенциально опасными для хозяина []. В нормальных условиях здоровых людей существуют перекрестные помехи и перекрестная регуляция между хозяином и микробиотой, находящейся в кишечнике, что создает гомеостатический баланс бактерий, так что желудочно-кишечный тракт остается здоровым и свободным от чрезмерного роста потенциально патогенных бактерий.Микробиота имеет комменсальные отношения с хозяином; бактерии процветают в богатой среде кишечника, в то время как хозяин извлекает выгоду из множества функций, обеспечиваемых бактериями.

Нормальная и дисбиотическая кишечная микробиота

A. Здоровый кишечник нормальных людей заселен широким спектром бактерий более 1000 видов. У здоровых людей эти бактерии находятся в гомеостатическом балансе между комменсальными и потенциально патогенными бактериями, и в кишечном тракте не наблюдается чрезмерного роста патогенных бактерий.Микрофлора обеспечивает хозяину защиту от чужеродных микробов, действуя как центральная линия устойчивости к колонизации этими экзогенными бактериями. Эта защита известна как «барьерный эффект» или устойчивость к колонизации [1]. Через слизистую оболочку кишечника микробиота взаимодействует с иммунной системой хозяина, обеспечивая хозяина иммунорегулирующими функциями, такими как запуск иммунной системы слизистой оболочки [1,2]. Микробиота также обладает различными метаболическими функциями, такими как расщепление сложных углеводов и выработка короткоцепочечных жирных кислот, от которых хозяин получает пользу [1, 3].Удивительно, но микробиота кишечника также способна взаимодействовать с удаленными органами, такими как мозг, что привело к исследованиям влияния микробиоты кишечника на психические расстройства, такие как аутизм, и болезни, такие как болезнь Альцгеймера [2].

B. При нарушении бактериального гомеостаза кишечника возникает дисбактериоз. Дисбактериоз определяется дисбалансом бактериального состава, изменениями метаболической активности бактерий или изменениями распределения бактерий в кишечнике.Тремя типами дисбактериоза являются: 1) потеря полезных бактерий, 2) чрезмерный рост потенциально патогенных бактерий и 3) потеря общего бактериального разнообразия. В большинстве случаев эти типы дисбиоза возникают одновременно. Зеленые цвета, представляющие патогенные бактерии, и каждая бактерия разного цвета, представляющая разные комменсальные виды, демонстрируют разнообразие или его отсутствие в каждом случае. Дисбиоз был связан с такими заболеваниями, как воспалительное заболевание кишечника (ВЗК), ожирение, диабет 1 и 2 типа, аутизм и некоторые виды рака желудочно-кишечного тракта.

Гомеостатический баланс кишечной микрофлоры чрезвычайно полезен для хозяина, однако, если есть изменение в микробном составе, которое вызывает резкий дисбаланс между полезными и потенциально патогенными бактериями, кишечник становится уязвимым для патогенного поражения с микробными изменениями кишечника. . Этот дисбаланс микробного равновесия называется «дисбиозом», который далее определяется как нарушение гомеостаза кишечной микробиоты из-за дисбаланса самой флоры, изменений их функционального состава и метаболической активности или изменений в их локальном распределении [1 , 4].В целом дисбактериоз можно разделить на три различных типа: 1) потеря полезных организмов, 2) чрезмерный рост потенциально вредных организмов и 3) потеря общего микробного разнообразия. Было обнаружено, что эти три типа не исключают друг друга и могут возникать одновременно, что чаще всего имеет место. Дисбиоз вовлечен в широкий спектр заболеваний, включая воспалительное заболевание кишечника (ВЗК), ожирение, аллергические расстройства, сахарный диабет 1 типа, аутизм, ожирение и колоректальный рак как на моделях людей, так и на животных.Этот обзор будет в основном сосредоточен на связи между дисбактериозом и воспалительными заболеваниями кишечника (ВЗК), такими как болезнь Крона (БК) и язвенный колит (ЯК), в дополнение к отдельным заболеваниям, связанным с дисбактериозом.

2. Заболевания, ассоциированные с дисбактериозом

IBD

В течение многих лет исследователи пытались обнаружить моно-ассоциированную причину IBD. В результате было обнаружено, что три основных патогена в наибольшей степени связаны с ВЗК. Эти патогены Mycobacterium avium paratuberculosis (MAP ), , которые когда-то считались потенциальным инфекционным агентом, связанным с патогенезом CD, Adherent-Invasive Escherichia coli (AIEC), который часто обнаруживался у пациентов с ВЗК. с острой / активной фазой и было предложено увеличить воспалительный ответ [2], и Clostridium difficile , который был обнаружен у пациентов с рецидивом ЯК, а также с ремиссией [5].В то время как некоторые исследования показали, что может наблюдаться увеличение сопутствующей патологии с этими бактериями и ВЗК, другие исследования показали, что эти результаты противоречивы [1,6,7]. До сих пор нет прямых доказательств того, что какие-либо из этих бактерий являются единственными причина ВЗК, и изменилось мнение, что ВЗК может быть вызвано дисбалансом комменсальной микрофлоры, связанной с более сложными взаимодействиями между хозяином и всей кишечной микробиотой [7], а не концепцией «один микроб - одно заболевание». Хотя дисбаланс микробиоты, так называемый дисбактериоз, по-видимому, является одной из основных причин патогенеза ВЗК, необходимы дальнейшие обширные исследования для подтверждения этого утверждения, поскольку до сих пор неясно, является ли дисбактериоз, наблюдаемый у пациентов с ВЗК, фактором риска или эффект болезни.

Показано, что дисбактериоз кишечника у пациентов с ВЗК имеет характерную картину уменьшения разнообразия комменсальных бактерий, при этом в основном происходит уменьшение количества Firmicutes и Bacteroides в микрофлоре кишечника, которые являются двумя наиболее распространенными группами в нормальной флоре [ 8, 9, 10]. Согласно результатам некоторых исследований, дисбактериоз при ВЗК, в частности при БК, также был связан с относительным увеличением числа энтеробактерий [1, 2, 6, 8, 9]. Сигнатура дисбактериоза при CD характеризуется пятью видами бактерий: увеличением Ruminococcus gnavus, и уменьшением Faecalibacterium prausnitzii, Bifidobacterium adolescentis, Dialister invisus, и неизвестным из кластера Clostridium XIVa [11].Также сообщалось, что здоровые родственники пациентов с БК также имели измененную кишечную микробиоту по сравнению со здоровыми людьми, а также имели повышенную деградацию муцина с повышенной проницаемостью эпителия [8, 11]. Поскольку барьер слизистой оболочки кишечника является первой линией защиты от микробиоты просвета, это разрушение может быть промежуточным шагом к дисбактериозу и CD. Исходя из этого, дисбактериоз может быть предшественником БК. Изучено множество потенциальных механизмов, которые могут описать роль дисбактериоза в патогенезе ВЗК: один из этих механизмов включает уменьшение количества бактерий, продуцирующих бутират, наряду с увеличением количества сульфатредуцирующих бактерий (SRB), что часто наблюдается в дисбактериоз больных ВЗК.У этих пациентов при дисбактериозе кишечника наблюдается серьезное снижение содержания F. prausnitzii [2, 6, 8, 9], которые являются основными бактериями, продуцирующими бутират в кишечнике. Бутират является источником энергии для эпителиальных клеток кишечника и необходим для защиты кишечного эпителиального барьера от его уязвимости для потенциальных патогенов [2]. Некоторые исследования также обнаружили увеличение SRB [10]. SRB метаболизируют сульфат в сероводород, который является токсичной молекулой, которая может блокировать утилизацию бутирата и ингибировать фагоцитоз, а также убивать бактерии.Этот предполагаемый последовательный механизм ВЗК, ассоциированного с дисбиозом, предполагает, что дисбиоз, характеризующийся уменьшением количества бутират-продуцирующих бактерий и увеличением SRB, вызывает снижение уровня бутирата, что вызывает снижение экспрессии белков плотного соединения эпителия и, следовательно, увеличение проницаемости эпителия толстой кишки, что приводит к увеличению бактериальной транслокации через эпителиальные клетки кишечника и пропию пластинки. У генетически предрасположенных людей, которые несут мутации в генах восприимчивости к ВЗК, уничтожение бактерий, которые достигают пропиационной пластинки через проницаемый эпителиальный барьер, нарушается дефектным фагоцитозом, который затем приводит к чрезмерной стимуляции Toll-подобного рецептора (TLR). секреция провоспалительных цитокинов и активация приобретенных иммунных ответов, которые усиливают воспалительные реакции кишечника [12].Другой закономерностью, замеченной при изучении состава микробиоты у пациентов с ВЗК, является потеря облигатных анаэробов, таких как Bfidobacteria, и увеличение факультативных анаэробов, таких как E. coli [13]. Эта закономерность привела к гипотезе о том, что кислород может быть основным фактором, вызывающим дисбактериоз у пациентов с ВЗК. В здоровом кишечнике обычно низкий уровень кислорода и большая популяция облигатных анаэробов. Однако при дисбактериозе уменьшается количество Firmicutes, которые являются облигатными анаэробами, и увеличивается количество факультативных анаэробов, таких как Enterobacteriaceae.Это изменение кишечника от облигатных анаэробов к факультативным предполагает нарушение анаэробиоза в кишечнике, а это означает, что кислород, а также активные формы кислорода могут быть одним из причинных факторов дисбактериоза. Это открытие предполагает, что увеличение количества активных форм кислорода вызовет нарушение анаэробной среды кишечника, что создаст селективное преимущество для факультативных анаэробов или даже некоторых аэробов, что приведет к чрезмерному росту и возникновению дисбактериоза [13].

Исследуя роль дисбактериоза как причинного фактора ВЗК, было высказано предположение, что метаболизм желчных кислот также может играть важную роль в механизме ВЗК, ассоциированного с дисбактериозом. В просвете кишечника бактерии играют определенную роль в ферментативных реакциях, которые ответственны за преобразование желчных кислот (ЖК), водорастворимых амфипатических конечных продуктов метаболизма холестерина, включая процессы деконъюгации и дегидрирования. БА выполняют множество метаболических функций, таких как абсорбция липидов, поддержание гомеостаза холестерина, и действуют как противовоспалительные молекулы, которые способны снижать синтез провоспалительных цитокинов в моноцитах и ​​макрофагах.Было обнаружено, что пациенты с ВЗК демонстрируют характерный дисбактериоз, а также нарушение метаболизма БА в кишечнике, особенно во время обострения ВЗК [14]. Было показано, что изменения микробиоты кишечника влияют на метаболизм БА, поскольку микробиота и связанные с ней метаболиты опосредуют некоторые изменения в метаболизме БА [15]. Дисбиоз, связанный с ВЗК, может изменить способность к модификации БА, что может нарушить регулируемый БА воспалительный процесс слизистой оболочки [16]. Firmicutes и Bacteroides, две основные группы, микробиота которых снижается у пациентов с ВЗК, являются наиболее мощными деконъюгированными бактериями для трансформации БА.Чем меньше этих бактерий в кишечнике во время дисбактериоза, тем меньше конъюгации БА, что приводит к усилению воспаления кишечника, что может сыграть решающую роль в обострении ВЗК. Следовательно, снижение конъюгации БА потенциально может быть надежным маркером дисбактериоза кишечника.

Ожирение

Ожирение - это болезнь, которая растет во многих странах мира. По данным Центров по контролю и профилактике заболеваний (CDC), в 2014 году около 78 миллионов взрослых и 12 миллионов детей в США страдали ожирением.Ожирение - это нарушение обмена веществ, связанное с накоплением избыточного количества жира в организме, которое, как считается, вызвано дисбалансом энергии, низким расходом энергии и увеличением потребления калорий. Однако недавние данные свидетельствуют о том, что ожирение является более сложным заболеванием, связанным с дисбактериозом кишечника как у мышей, так и у людей [17].

Подобно ВЗК, определенная характеристика микробиоты, по-видимому, связана с развитием ожирения. У лиц с ожирением наблюдается общее снижение бактериального разнообразия в кишечнике [17, 18].В большинстве исследований как на людях, так и на животных моделях ожирение, по-видимому, связано с изменением соотношения между Bacteroidetes и Firmicutes, которое показывает уменьшение Bacteroidetes, в то время как Firmicutes увеличивается [19–21]. Это соотношение коррелирует с массой тела и накоплением телесного жира, демонстрируя, что у более тучных людей более непропорционально соотношение этих бактерий. Количество Bacteroidetes, по-видимому, играет важную роль при ожирении, поскольку люди с ожирением, соблюдающие диету с ограничением калорий с потерей массы тела, показывают, что в кишечной микробиоте повышенное соотношение видов Bacteroidetes [22, 23].Хотя дебаты о том, является ли дисбиоз причинным элементом / фактором или просто следствием ожирения, все еще обсуждаются, многие эксперименты с участием мышей без зародышей (GF) предполагают, что дисбиоз, вероятно, является причинным фактором ожирения. В этих экспериментах мышей GF и мышей дикого типа (WT) кормили одной и той же диетой с высоким содержанием жиров (HFD), однако только у мышей WT развилось ожирение. Когда тучная микробиота была трансплантирована мышам GF, затем индуцировалось ожирение [20, 24, 25]. Таким же образом было обнаружено, что ожирение человека может передаваться худым мышам GF через трансплантат микробиоты [18].Трансплантация микробиоты также работает в противоположном направлении: было обнаружено, что микробиота тощих мышей, будучи перенесена на мышей с ожирением, может облегчить симптомы метаболического синдрома [26]. Эти многочисленные исследования показывают, что микробиота кишечника тесно связана с развитием ожирения.

Показано, что HFD изменяют состав микробиоты, что будет подробно обсуждаться в следующем разделе. Считается, что изменения в микробиоте, наблюдаемые при ожирении, вызывают различные эффекты, которые могут способствовать хроническому ожирению, связанному с воспалением.Сигнатура микробиоты с ожирением показывает измененное соотношение Bacteroidetes и Firmicutes, которые содержат элементы, вырабатывающие короткоцепочечные жирные кислоты (SCFA). У тучных людей уровни SCFA значительно ниже по сравнению с худыми людьми. Уменьшение SCFAs может быть связано с увеличением абсорбции SCFA, а также с измененным составом кишечной микробиоты, что свидетельствует об уменьшении количества бактерий, продуцирующих бутират [18], что может вызвать меньшую продукцию SCFA. Считается, что SCFAs ингибируют накопление жира в жировой ткани, поэтому считается, что их пониженный уровень способствует ожирению [18].

Предполагается, что наряду с измененной продукцией SCFA измененная микробиота ожирения влияет на баланс иммунной системы хозяина, что может привести к усилению транслокации бактериального антигена, что приводит к хроническому воспалению и нарушению метаболических функций, таких как резистентность к инсулину. Как на людях, так и на животных, ожирение связано с повышенной кишечной проницаемостью, что вызывает снижение барьерной функции кишечника [17]. Это снижение функции может вызвать прохождение молекул, таких как липополисахариды (ЛПС), которые представляют собой липогликаны, состоящие из липида и полисахарида, и обычно обнаруживаются во внешней мембране грамотрицательных бактерий.ЛПС действует как эндотоксин, защищая бактерии от солей желчных кислот, а также от липофильных антибиотиков. Кроме того, ЛПС может вызывать эндотоксемию, то есть присутствие эндотоксинов в крови, что может привести к септическому шоку и усилению хронического воспаления. Также считается, что ЛПС играет ключевую роль в патогенезе хронического воспалительного состояния, наблюдаемого у лиц с ожирением. Многие исследования подтверждают идею о том, что связанный с ожирением дисбиоз может вызывать повышение уровня ЛПС и проникновение через «протекающий» эпителиальный барьер в кровоток, вызывая эндотоксемию, которая приводит к хроническому воспалению, которое вызывает состояние ожирения [27].

Сахарный диабет

По данным Американской диабетической ассоциации, в 2012 году 9,3%, или около 29,1 миллиона, американцев страдали диабетом. Эта болезнь находится на подъеме в Соединенных Штатах, и ежегодно регистрируется около 1,7 миллиона новых диагнозов. Сахарный диабет - это нарушение углеводного обмена, которое характеризуется недостаточной выработкой или использованием инсулина, который необходим для преобразования сахаров и крахмалов в энергию для функционирования организма. Существует два основных типа диабета: тип 1 и тип 2.Сахарный диабет 1 типа или инсулинозависимый сахарный диабет (IDDM) - это аутоиммунное заболевание, обычно диагностируемое у детей или молодых людей, и вызываемое нарушением выработки инсулина бета-клетками поджелудочной железы. Сахарный диабет 2 типа или инсулиннезависимый сахарный диабет (NIDDM) обычно диагностируется у взрослых и характеризуется инсулинорезистентностью, то есть сниженной чувствительностью тканей к инсулину, в результате чего организм не реагирует на инсулин, который производится.NIDDM может усугубляться ожирением, а также является наиболее частой диагностируемой формой диабета. Несмотря на то, что IDDM и NIDDM вызываются разными механизмами в организме, исследования показали, что оба типа имеют дисбактериоз кишечной микробиоты, что может способствовать патогенезу заболевания [28].

IDDM-ассоциированный дисбиоз характеризуется уменьшением количества бактерий, разлагающих муцин, Bfidobacteria, Lactobacillus и Prevotella, с увеличением количества Bacteroidetes и Clostridium [29, 30].Напротив, дисбиоз, связанный с NIDDM, характеризуется уменьшением Clostridium, увеличением Lactobacillus и увеличением Bacteroidetes при NIDDM, не связанном с ожирением [31]. И IDDM, и NIDDM связаны с уменьшением общего микробного разнообразия, включая уменьшение количества бактерий, продуцирующих бутират, и Firmicutes, а также с нарушением целостности эпителиального барьера кишечника и повышенной проницаемостью кишечника [28, 31, 32, 33]. Повышенная транслокация ЛПС и эндотоксемия также наблюдаются при NIDDM, что, как и при ожирении, может способствовать слабому воспалению, которое способствует развитию инсулинорезистентности, связанной с NIDDM [27].

Как и при других заболеваниях, связанных с дисбактериозом кишечника, неясно, является ли несбалансированная микробиота причинным фактором или следствием диабета; однако различные исследования на людях и животных предполагают, что изменения в микробиоте могут предшествовать началу IDDM. Было обнаружено, что у мышей с диабетом без ожирения (NOD) с диабетом уже в возрасте отъема состав микробиоты отличается от состава мышей NOD, у которых диабет не развивается [34]. Также было замечено, что распространенность IDDM зависит от общей бактериальной среды, в которой они содержатся.У мышей NOD в учреждениях GF развивается болезнь, в то время как у мышей в учреждениях, свободных от специфических патогенов (SPF), нет [29]. Когда кишечная микробиота мышей, содержащих SPF, переносится в мышей, размещенных в GF, диабет ослабляется [30]. Причина этих результатов связана со сниженной экспрессией MyD88 (первичный ответ миелоидной дифференцировки 88), универсального адапторного белка почти для всех Toll-подобных рецепторов (TLR). Было показано, что у мышей MyD88 - / - NOD в условиях SPF наблюдается изменение состава кишечной микробиоты и последующая потеря развития сахарного диабета по сравнению с таковыми в условиях GF.Это показывает, что развитие сахарного диабета зависит от состава комменсальных бактерий в кишечнике [30]. MyD88 также жизненно важен для бактериального восприятия и передачи сигналов о врожденном иммунном ответе, и предполагается, что подавление этого фактора может прервать развитие IDDM, предполагая, что микробные антигены и врожденная иммунная система связаны с патогенезом IDDM [30].

Расстройства аутистического спектра

Расстройства аутистического спектра (РАС) - это группа расстройств, которые включают аутизм и синдром Аспергера, которые характеризуются социальным и коммуникативным дефицитом, повторяющимся поведением и иногда когнитивными задержками [35].Точная причина РАС до сих пор в значительной степени неизвестна; однако есть серьезные основания полагать, что дисбактериоз кишечника может играть роль в патогенезе РАС, особенно при аутизме. Эта связь между РАС и дисбактериозом усиливается различными исследованиями, показывающими, что микробиота кишечника и ее метаболиты, по-видимому, влияют на центральную нервную систему (ЦНС) через ось кишечник-мозг (GBA), которая может сообщаться с ЦНС через нервную, эндокринную и нервную системы. и иммунные пути, влияющие на функции мозга и измененное поведение [36].Многочисленные эксперименты на моделях мышей показали, что измененная микробиота кишечника может вызывать синтез нейротоксинов, которые могут мешать развитию нервной системы, вызывая изменения в химии мозга, а также в поведении. Впоследствии эти связанные с дисбиозом нейрональные изменения приводят к таким поведенческим изменениям, как повышенная тревожность, депрессия и когнитивная дисфункция, которые являются характерными чертами РАС [35]. Эксперименты с использованием отдельных антибиотиков показали, что пробиотики, которые, как считается, помогают нормализовать микрофлору кишечника, также имеют тенденцию уменьшать беспокойство и улучшать когнитивные функции и поведение [37, 38], что показывает, что микробиота играет важную роль в развитии РАС.

У детей с аутизмом существует сильная корреляция между тяжестью заболевания и желудочно-кишечными расстройствами [39]. Общие желудочно-кишечные проблемы у аутичных детей включают боль в животе, диарею, вздутие живота, дисбактериоз кишечника и повышенную проницаемость кишечной мембраны [39]. Изучая ассоциированный с дисбиозом РАС, многочисленные исследования показали, что наблюдалось снижение количества Firmicutes и полезных бактерий, таких как Bfidobacteria и Prevotella, с увеличением количества Bacteroidetes и потенциально патогенных бактерий, таких как Proteobacteria и Clostridiales [38].Во многих исследованиях увеличение количества бактерий Clostridiales, предположительно некоторых избранных кластеров Clostridia, кажется, играет важную роль в развитии аутизма. Настоятельно предложенный механизм, в котором Clostridiales может способствовать распространению патогенеза аутизма, - это выработка пропионовой кислоты, одного из членов SCFA, которая может преодолевать физиологический барьер между кишечником и кровью и проникать через гематоэнцефалический барьер, где может изменяют функции в нескольких частях мозга, вызывая когнитивные нарушения и симптомы, обычно приписываемые аутизму [40].

Рак

Дисбактериоз кишечника также был связан с колоректальным раком (CRC), который является третьим по распространенности раком и второй по значимости причиной смерти от рака (для обоих полов вместе взятых) в Соединенных Штатах по данным Американского общества рака. CRC имеет несколько факторов риска, включая ВЗК, ожирение, диабет и диету с высоким содержанием жиров и белков, все из которых также связаны с дисбактериозом кишечника. Это предполагает, что дисбактериоз также может играть ключевую роль в патогенезе CRC.

У пациентов с CRC была обнаружена общая картина дисбиоза, которая включает уменьшение количества бактерий, продуцирующих бутират, наряду с увеличением доли некоторых потенциально патогенных бактерий.В различных литературных источниках было обнаружено уменьшение Proteobacteria, Bfidobacteria, Prevotella и снижение уровня продукции SCFA, в то время как наблюдается увеличение Firmicutes, Bacteroidetes, Enterobacteriaceae и Fusobacteria [41]. Различные исследования также показали, что два конкретных вида бактерий, Akkermansia muciniphila и Fusobacterium nucleatum , увеличиваются в тканях CRC [42]. Оба этих вида бактерий связаны с сильными местными воспалительными реакциями, которые могут быть связаны с заболеваниями, связанными с воспалением, и могут быть репрезентативными для высокого риска CRC. F. nucleatum также связан с повышенным количеством опухолей CRC, а также с метастазами в лимфатические узлы [42]. Также было обнаружено, что состав и количество в просвете доминирующих видов микробов, наблюдаемых при CRC-ассоциированном дисбиозе, различаются в зависимости от тяжести заболевания и стадии / статуса опухоли. Значительные различия наблюдались в микробных составах слизистой и фекалий между пациентами с CRC с полипами и пациентами с опухолями, причем наиболее значительным изменением было Enterobacteriaceae, которое было увеличено в слизистой оболочке пациентов с CRC с опухолями по сравнению с пациентами с полипами, и Bacteroidetes , который был увеличен в тканях CRC с опухолями, чем в тканях без опухолей [43].

Существуют убедительные доклинические экспериментальные данные, указывающие на то, что дисбактериоз играет причинную роль в патогенезе CRC и онкогенезе у пациентов, чувствительных к CRC. Когда микробиота кишечника мышей с опухолями была трансплантирована мышам C57BL / 6 в установке GF, скорость онкогенеза в толстой кишке значительно увеличилась [44]. Манипуляции с кишечной микробиотой с помощью лечения антибиотиками также продемонстрировали важность микробиоты в статусе опухоли, показывая уменьшение количества и размера опухолей у чувствительных к CRC мышей при введении антибиотиков [41, 44].Эксперименты на мышах с дефицитом MyD88 показали снижение прогрессирования опухоли и неопластического развития [41] и предполагают, что MyD88 может передавать канцерогенный сигнал, который может быть одним из основных причинных факторов онкогенеза CRC.

Эксперименты с участием мышей GF, а также эксперименты с антибиотиками показывают, что изменения микробиоты кишечника во время дисбактериоза связаны с онкогенезом и, по-видимому, в значительной степени способствуют этому процессу. Различные исследования, изучающие роль дисбактериоза в развитии CRC, предложили несколько механизмов того, как это может происходить.Один из таких механизмов включает отсутствие SCFAs, количество которых в фекальной микробиоте значительно снижается в ходе развития CRC [41]. Когда бутират вводили в качестве добавки генетически восприимчивым мышам K-ras G12Dint , получавшим HFD, частота опухолей значительно снижалась [41], что позволяет предположить, что этот SCFA важен для защиты от онкогенеза. Другой предполагаемый механизм включает перепроизводство α-дефенсинов, которые представляют собой небольшие, богатые цистеином катионные белки, связанные с врожденным иммунитетом, которые важны для защиты от патогенов, включая многие грамотрицательные и грамположительные бактерии, грибы и вирусы в оболочке. а также участвует в передаче сигналов клеток и формировании кишечной микробиоты.У спорадических пациентов с CRC с аденоматозными полипами перепроизводство α-дефенсинов может вызывать дисбактериоз, поскольку существует корреляция, включающая уменьшение количества полезных бактерий, прикрепляющихся к слизистой оболочке, включая Bfidobacterium infantis , наряду с увеличением продукции α-дефенсина в этих пациенты [45]. Этот дисбиоз может привести к снижению регулирующей пролиферации эпителия толстой кишки, что является одним из преканцерогенных факторов, указывающих на потенциальную роль дисбактериоза в развитии CRC.Считается, что измененный метаболизм микробиоты, присутствующий при дисбактериозе, высвобождает токсичные метаболиты, что может быть связано с неопластическими изменениями в эпителиальных клетках кишечника. Считается, что дисбактериоз кишечника способствует обострению хронического воспаления, которое считается основной причиной развития колит-ассоциированного CRC [46]. Было высказано предположение, что усиленный иммунный ответ на антигены дисбиотической микробиоты кишечника может привести к этому хроническому, потенциально вызывающему CRC, воспалению [47].

3. Диета и микробиом

Диета является одним из наиболее важных факторов, влияющих на гомеостаз микробиоты кишечника, и важна с рождения, как показали исследования, показывающие различный микробный состав кишечника у младенцев, находящихся на грудном вскармливании, и на искусственном вскармливании [ 48]. Конкретные продукты питания и диетические компоненты были исследованы, чтобы определить тип воздействия, которое они оказывают на весь организм. В течение многих лет многие исследователи во всем мире находили влияние между диетой и заболеваниями, связанными с дисбактериозом, такими как ожирение, диабет и аллергические расстройства, однако недавние исследования показывают, что диета также может влиять на такие заболевания, как ВЗК, и определенные типы рака, такие как CRC.

При сравнении «западной» диеты, которая в основном состоит из животного белка с высоким содержанием сахара и насыщенных жиров, с аграрной диетой, которая в основном состоит из низкого животного белка и насыщенных жиров, а также высоких углеводов и простых сахаров, состав кишечника микробиота показала резкие различия: при анализе микробиоты людей, потребляющих западную диету, наблюдалось увеличение количества Firmicutes и Proteobacteria, а также некоторых Bacteroides, в то время как у людей, потребляющих аграрную диету, было повышенное количество актинобактерий, в основном Prevotella [49].У мышей было обнаружено, что диета с высоким содержанием жира / сахара приводит к дисбактериозу у мышей с измененной функцией барьера хозяина [2]. У людей, придерживающихся аграрной диеты, наблюдалось повышение уровня SCFA и снижение SCFA у людей, придерживающихся западной диеты [49]. SCFA или летучие жирные кислоты синтезируются в толстой кишке в процессе ферментации пищевых волокон. Наиболее распространенные SCFAs включают уксусную, пропионовую и масляную кислоты. Считается, что SCFAs, в частности масляная кислота, защищают от появления потенциально патогенных кишечных бактерий, что указывает на то, что SCFAs могут быть регуляторным фактором возникновения дисбактериоза.Таким образом, показано, что диеты с высоким содержанием клетчатки имеют более высокое микробное разнообразие кишечника, в основном это комменсальные бактерии, что ограничивает колонизацию потенциально патогенных бактерий, которые были связаны с различными заболеваниями, такими как ВЗК и CRC.

Недавние исследования показали, что витамин D является вероятным химиопротектором и снижает риск ВЗК и колита. Было показано, что у мышей с DSS-индуцированным колитом введение витамина D приводит к лучшему восстановлению веса, а также к уменьшению кровавой диареи [50].Витамин D способствует устойчивости эпителиальных клеток к травмам и подавляет воспалительные реакции, что важно для пациентов с ВЗК [50]. Также считается, что витамин D является фактором регуляции бактериального гомеостаза кишечника. Исследования на мышах с дефицитом как витамина D, так и рецепторов витамина D (VDR) показали изменения состава кишечной микробиоты с уменьшением Lactobacilli и Firmicutes и увеличением Clostridium и Bacteroidetes в фекальном стуле по сравнению с мышами WT [51– 54].Лактобациллы - это грамположительные ферментативные бактерии, которые продуцируют молочную кислоту, которая оказывает противовоспалительное и противоопухолевое действие, балансируя гомеостаз кишечника [51]. Дефицит витамина D с уменьшением количества бактерий, продуцирующих молочную кислоту, и увеличением количества потенциально патогенных бактерий может увеличить риск хронического воспаления и последующего развития CRC, связанного с колитом. Витамин D также показал, что у мышей защищает от колонизации патогенными бактериями, поддерживая барьерную функцию кишечного эпителия [52, 53].У мышей с дефицитом витамина D возникает дисфункция кишечного эпителиального барьера, что позволяет патогенным бактериям, таким как AIEC, колонизировать кишечник, вызывая дисбактериоз и способствуя развитию воспаления, связанного с дисбактериозом, что увеличивает риск CD [52, 54].

Высокое потребление цельнозерновых и пищевых волокон показывает сильную обратную корреляцию с риском КРР, наряду с уменьшением воспаления и снижением риска других заболеваний, таких как сердечно-сосудистые заболевания (ССЗ), диабет, прогрессирующий КРР и заболевания, связанные с ожирением [55 ].В 2011 году Всемирный фонд исследований рака / Американский институт исследований рака (WCRF / AICR) пришел к выводу, что клетчатка «вероятно» уменьшит колоректальную неоплазию, при этом клетчатка обратно пропорциональна CRC [56]. Цельное зерно богато фенольными соединениями, наиболее распространенным из которых является феруловая кислота (ФК). Волокно в цельнозерновых продуктах доставляет ЖК в кишечник, где они медленно и непрерывно высвобождаются микробиотой кишечника, которая также превращает ЖК в циркулирующую дигидроферуловую кислоту (ДГФА) [55].Считается, что ЖК и ДГК защищают от неопластических изменений эпителиальных клеток толстой кишки [57], а также от повышения иммунного ответа, и было показано, что они, возможно, снижают риск заболеваний, связанных с ожирением, при длительном употреблении цельного зерна. . Повышенный уровень ЖК может иметь прямое противомикробное действие в отношении потенциально патогенных бактерий [55]. Наряду с этими кислотами, потребление цельного зерна снижает выработку TNFα наряду с увеличением количества Bacteroides и Lactobacillus, что помогает уменьшить субклиническое воспаление [55].

Уменьшение количества клетчатки связано с более высоким риском прогрессирующего CRC [58]. Было показано, что у пациентов с прогрессирующим CRC в микробиоте кишечника уменьшилось количество бактерий, продуцирующих бутират, что вызывает меньшую ферментацию SCFA в кишечнике, что может привести к образованию продвинутого CRC. Напротив, повышенное потребление клетчатки показало увеличение количества бактерий, продуцирующих бутират, и в целом сбалансированную микробиоту кишечника по сравнению с людьми с пониженным содержанием клетчатки, что указывает на важную роль клетчатки в снижении риска КРР, а также на ее роль в поддержании микробного гомеостаза кишечника [ 56, 58].Было показано, что бутират, один из наиболее важных SCFAs, обладает противоопухолевым действием, ингибируя пролиферацию неопластических клеток, ограничивая ангиогенез опухоли и индуцируя апоптоз [59]. Рацион с высоким содержанием цельного зерна и клетчатки может влиять на микробиоту кишечника на уровне филума, в частности, вызывая уменьшение Bacteroides при длительном потреблении и увеличение Bfidobacteria и Roseburia , оба из которых являются бактериями, продуцирующими бутират, влияют на иммунитет и воспалительные функции на животных моделях.В исследованиях, посвященных изучению роли диеты с высоким содержанием белка / низким содержанием углеводов (ВЭЖХ) по сравнению с диетами с высоким содержанием белка / умеренным содержанием углеводов (НРМС), присутствие клетчатки и неперевариваемых углеводов способствует предотвращению развития CRC [57]. Полагают, что это частично связано с повышенной ферментацией SCFA, которая может влиять на толстую кишку, способствуя секреции слизи и модулируя воспалительный иммунный ответ. Эти исследования также показали, что диета с ГПМЦ модулирует образование потенциально канцерогенного N-нитрозосоединения (NOC), на которое ранее считалось, что на него влияет только повышенное потребление мяса и белка, однако эти исследования показывают, что величина эффектов NOC зависит от количество съеденных углеводов; с повышенным потреблением углеводов происходит меньшее образование NOC и, следовательно, снижается риск образования CRC.Некоторые исследования показали, что влияние пищевых волокон на снижение риска колоректальной неоплазии может иметь половые различия, показывая, что мужчины могут получить больше пользы от воздействия клетчатки, чем женщины. Предполагается, что у женщин клетчатка снижает уровень эстрогена, что может защищать от неопластических изменений эпителиальных клеток [60]. Другая гипотеза относительно того, почему могут быть половые различия в влиянии клетчатки, заключается в том, что женщины более склонны к развитию чисто правосторонних (проксимальных) полипов, чем мужчины. Если волокно более эффективно предотвращает появление левосторонних (дистальных) полипов, это может объяснить, почему произошли эти различия [60, 61].

Было показано, что увеличение потребления клетчатки из фруктов и овощей обладает химиозащитным действием и связано с увеличением микробного разнообразия кишечника и снижением риска колоректального рака [56]. Было показано, что у людей, придерживающихся диеты с высоким содержанием овощей, меньше вероятность развития ВЗК, а также повышенного риска КРР [58, 59]. Большинство исследований показывают, что овощи обратно пропорциональны риску рака, однако некоторые исследования показывают, что только вареные листовые овощи имеют этот эффект, но не все овощи [62].Существует также различие между полами в потреблении фруктов и овощей, причем эти две группы продуктов обратно пропорциональны риску КРР у мужчин, но не у женщин [62]. Потребление красного вина также было изучено, чтобы показать, что его потребление может значительно изменить микробное разнообразие кишечника у людей, показывая увеличение пробиотических бактерий, таких как Prevotella, Proteobacteria и Bfidobacteria, и уменьшение потенциально патогенных бактерий, таких как Clostridium [63], которые являются результат присутствия полифенолов в вине.Полифенолы присутствуют во многих продуктах питания, таких как вино, чай, фрукты, овощи и шоколад, и обычно попадают в толстую кишку неповрежденными, где они могут выполнять регулирующие функции и антимикробные свойства, которые изменяют микробиоту кишечника [63]. Помимо снижения риска рака, полифенолы также связаны со снижением артериального давления и уровня холестерина, а также со снижением риска сердечно-сосудистых заболеваний, включая сердечно-сосудистые заболевания, инсульт и аневризму аорты.

4. Генетика и дисбиоз

Наряду с факторами окружающей среды, такими как диета, генетические компоненты также сильно связаны с развитием дисбиоза.Это наиболее распространено при дисбактериозе, связанном с CD. Используя общегеномные исследования ассоциации (GWAS), в настоящее время существует более 160 локусов, связанных с ВЗК, однако в этом обзоре рассматриваются только варианты IL-10 / IL-10R, которые были связаны с ранним началом ВЗК, а также варианты. NOD2 и ATG16L1, двух наиболее изученных генов восприимчивости к IBD и связанных с ними белков, которые, как было обнаружено, увеличивают риск CD через измененное взаимодействие с микробиотой кишечника.

NOD2

Первый идентифицированный ген восприимчивости к CD, домен нуклеотидной олигомеризации 2 (NOD2), также известный как NOD2 / CARD15 (белок 15, содержащий домен рекрутирования CAspase), расположен на хромосоме человека 16q12 и синтезирует белок NOD2, который действует как тип белка. патоген-ассоциированный молекулярный паттерн (PAMP) и специфически распознает мурамилдипептид (MDP), который является компонентом клеточной стенки бактериального пептидогликана, присутствующего как у грамположительных, так и у грамотрицательных бактерий.NOD2 экспрессируется во многих типах клеток, включая дендритные клетки, макрофаги, клетки Панета, а также кишечные эпителиальные клетки и эпителиальные клетки в легких и полости рта [64]. Белок NOD2 важен для врожденного иммунитета и микробной регуляции, где он участвует в распознавании патогенов и защите от этих организмов [65]. MDP связывает и активирует NOD2, который затем локализуется на плазматической мембране и инициирует сигнальные каскады, рекрутируя рецептор-взаимодействующий белок 2 (RIP2), с последующей активацией митоген-активируемой протеинкиназы (MAPK) и ядерного фактора каппа B (NF-κB). каскады, приводящие к высвобождению провоспалительных молекул, помогающих убить патогенные бактерии [66].NOD2 также необходим для экспрессии дефенсинов специализированными эпителиальными клетками, называемыми клетками Панета, которые расположены в криптах тонкого кишечника [65]. Более того, NOD2 важен для индукции аутофагии в эпителиальных клетках, направляя белок ATG16L1 (связанный с аутофагией 16-like 1) на плазматическую мембрану, чтобы индуцировать образование аутофагосом [66] []. Функционирование NOD2 необходимо как для грамположительной, так и для -отрицательной регуляции бактерий и помогает предотвратить колонизацию патогенными бактериями и дисбактериоз.

Нормальные и измененные функции NOD2

A. Нормальные функции NOD2. Нормальный вариант NOD2 активируется мурамилдипептидом, который является компонентом стенок бактериальных клеток. Активированный NOD2 рекрутирует взаимодействующий с рецептором белок 2 (PIP2), который затем активирует каскады митоген-активированной протеинкиназы (MAPK) и ядерного фактора каппа B (NFκB). Это приводит к высвобождению провоспалительных молекул, которые помогают убить патогенные бактерии ( Left ). Активированный NOD2 также направляет связанный с аутофагией 16-подобный 1 (ATG16L1) белок из цитоплазмы к плазматической мембране, чтобы инициировать образование аутофагосом ( Right ).

B. Мутировавшие варианты NOD2 вызывают ухудшение восприятия и распознавания MDP. Без этой активации не происходит RIP2 и результирующего высвобождения цитокинов ( Left ). Без активного NOD2 ATG16L1 не направляется к плазматической мембране и остается в цитозоле, что нарушает образование аутофагосом и приводит к нарушению уничтожения вторгающихся бактерий ( Right ). Варианты NOD2 и их нарушение клеточных функций могут приводить к дисбактериозу кишечного эпителия и связаны с более ранним началом болезни Крона подвздошной кишки.

Существует три варианта гена NOD2, которые связаны с повышенным риском восприимчивости к CD: две миссенс-мутации (R702W и G908R) и одна мутация сдвига рамки считывания (L1007fsinsC) [66]. Эти вариации изменяют домен богатого лейцином повтора (LRR) или соседнюю область, что вызывает значительное снижение или полную потерю функции NOD2 [67]. NOD2 играет важную роль в регулировании кишечной микробиоты в кишечнике, регулируя колонизацию и подавляя условно-патогенные микроорганизмы. Было показано, что мыши NOD2 WT быстро очищают патогены, такие как Helicobacter hepaticus , однако у мышей NOD2 KO клиренс этого патогена был задержан и увеличилось количество H.hepaticus в терминальном отделе подвздошной кишки был значительно выше, чем у мышей WT [68]. Без NOD2 нарушается восприятие и распознавание бактериального MDP, и эти бактерии не могут быть нейтрализованы, поэтому они продолжают расти в кишечнике, вызывая дисбактериоз. Этот дисбактериоз изменяет микробные взаимодействия хозяина в слизистой оболочке подвздошной кишки, что приводит к усилению воспалительной реакции, которая может привести к БК. У людей мутации NOD2, в частности мутация NOD2 со сдвигом рамки считывания, тесно связаны со снижением экспрессии α-дефенсина в клетках Панета, что ухудшает его антибактериальную функцию, увеличивает риск инфекции и приводит к усилению воспаления, связанного с CD [ 64].Мутации NOD2 также могут нарушать аутофагию: вариант NOD2 со сдвигом рамки считывания (L1007fsinsC) и белок ATG16L1, его проводники, остаются в цитозоле и никогда не локализуются на плазматической мембране для инициации образования аутофагосом [66]. У людей, гомозиготных по одному из трех основных вариантов NOD2 (R702W, G908R и L1007fsinsC), риск БК увеличивается в 20 раз, однако менее двадцати процентов пациентов с БК гомозиготны по варианту NOD2 [69], что показывает, что Варианты NOD2 не являются единственными причинными факторами CD.Однако эти три варианта NOD2 связаны с возникновением фибростенотической CD тонкой кишки [70].

NOD2 и комменсальные бактерии регулируют друг друга. У мышей без микробов (GF) экспрессия NOD2 в терминальном отделе подвздошной кишки была ниже по сравнению с мышами SPF [71]. После того, как мышей GF восстановили комменсальными бактериями, уровни экспрессии NOD2 в подвздошной кишке значительно увеличились, что указывает на то, что комменсальные бактерии положительно регулируют NOD2, в то время как функция NOD2 отрицательно регулирует комменсальную флору [71].Без этих отношений нарушается гомеостаз кишечника или дисбактериоз. У мышей с нокаутом NOD2 (- / -) обнаружен дисбактериоз в терминальном отделе подвздошной кишки с увеличением количества комменсальных бактерий наряду с повышением восприимчивости к патогенным бактериям. Это связано с неспособностью регулировать комменсальные бактерии и предотвращать колонизацию патогенных бактерий. У мышей NOD2 - / - измененная микробиота кишечника наблюдалась в слизистой оболочке терминальной части подвздошной кишки, в основном состоящая из увеличения Bacteroides и Firmicutes по сравнению с мышами NOD2 WT, у которых было едва обнаруживаемое количество этих родов бактерий [68, 72].Эти данные также коррелируют с тем, что наблюдалось у людей с дефицитом NOD2 [60]. Было также показано, что у мышей с CD-ассоциированными вариантами NOD2 увеличилось количество Enterobacteriaceae [73]. Существует также эффект дозировки аллелей, который наблюдается при дефиците NOD2, со значительной корреляцией между количеством аллелей риска NOD2 и повышенным количеством присутствующих Enterobacteriaceae [73]. Пациенты с CD, у которых есть мутации NOD2, показали неэффективное распознавание Mycobacterium avium paratuberculosis (MAP), патогенной бактерии, которая обнаружена у значительного меньшинства пациентов и может быть связана с образованием гранулемы [74].

ATG16L1

Ген ATG16L1 кодирует белок ATG16L1, который важен для аутофагии и образования аутофагосом [66]. ATG16L1 экспрессируется в кишечном эпителии, антигенпрезентирующих клетках, Т-клетках и В-клетках [65]. Обычно он обнаруживается в цитозоле до тех пор, пока он не рекрутируется NOD2 и не направляется к плазматической мембране, где он рекрутирует 1A / 1B-легкую цепь 3 (LC3) для инициации образования аутофагосом [66]. Также было показано, что ATG16L1 играет роль как у мышей, так и у людей, регулируя секрецию гранул в клетках Панета, что может влиять на состав микробиоты кишечника [75].

Однонуклеотидный полиморфизм (SNP) в гене ATG16L1, который изменяет треонин на аланин (T300A), вызывает снижение или отсутствие экспрессии белка ATG16L1 [66]. Как у людей, так и у мышей, гомозиготных по аллелю риска, не было аномалий морфологии подвздошной кишки, но были выявлены аномалии секреции гранул клеток Панета [75]. С истощением ATG16L1 в клетках Панета значительно уменьшилось количество антибактериальных гранул, которые он обычно секретирует, что вызывает нарушение регуляции микробиоты в кишечнике и может привести к CD-ассоциированному дисбиозу.Уменьшение или отсутствие ATG16L1 также вызывает нарушение роли NOD2 в формировании аутофагосом, которая является ATG16L1-зависимой для этого процесса. Без ATG16L1 происходит отсутствие бактериально-инфицированной цитоплазматической аутофагии, что дает вторгающимся бактериям возможность чрезмерно колонизировать и приводить к дисбактериозу эпителия кишечника, что может привести к воспалению и повышенному риску развития БК.

Подобно полиморфизму NOD2, варианты ATG16L1 связаны с нарушением бактериального клиренса посредством аутофагии против внутриклеточных бактерий, а также имеют эффект дозировки аллелей на кишечную микробиоту [76].Было показано, что дефицит ATG16L1 связан с увеличением восприимчивости к штамму Helicobacter pylori s1m1, что приводит к хроническому воспалению, которое может создавать проканцерогенную среду [77]. Также было замечено, что в клетках с дефицитом ATG16L1 наблюдалось значительное увеличение адгезивно-инвазивного штамма LF82 E. coli (AIEC), который был выделен из илеоцекальных поражений пациентов с БК с активным воспалением [78]. Другая работа показала, что снижение аутофагии подвздошных бактерий в ATG16L1-дефицитных клетках не является патоген-специфичным [76, 78].Следует отметить, что дефицит ATG16L1 связан с повышенной инвазией условно-патогенных микроорганизмов, некоторые из которых были протестированы, это Mycobacterium tuberculosis и Streptococcus pyrogenes [78]. Повышенное количество внутриклеточных патогенных бактерий вызывает дисбаланс в микробиоте кишечника, этот дисбиоз затем может привести к хроническому воспалению, которое увеличивает риск развития таких заболеваний, как ВЗК, и может стать канцерогенной средой.

IL-10 / IL-10R

IL-10 (интерлейкин-10) представляет собой противовоспалительный цитокин, который секретируется в основном моноцитами / макрофагами, но также может продуцироваться лимфоцитами, такими как клетки Th3 и некоторые регуляторные Т-клетки. / В-клетки.Экспрессия IL-10 важна для иммунного гомеостаза слизистых оболочек в желудочно-кишечном тракте как мышей, так и людей, где он инициирует каскад, чтобы в конечном итоге ограничить чрезмерные иммунные ответы и воспаление кишечника. Этот каскад инициируется, когда IL-10 связывается с IL-10R (рецептор IL-10), который представляет собой белок, состоящий из двух альфа (IL-10RA) и двух бета (IL-10RB) субъединиц. Когда IL-10 связывается с этими рецепторами, активация JAK1 и TYK2 приводит к фосфорилированию STAT3, который затем перемещается в ядро ​​и подавляет экспрессию провоспалительных генов [79].Этот каскад важен для ограничения избыточного количества клеток Th27 (Т-хелперов 17) в слизистой оболочке, чрезмерное размножение которых связано с CD [79, 80]. IL-10 также ограничивает секрецию провоспалительных цитокинов, таких как TNFα и IL-12, которые способствуют вредному воспалению в кишечнике [81].

Генетические мутации в генах IL-10 и IL-10R приводят к потере функциональных мутаций в белках IL-10 и IL-10R, соответственно, и были связаны с ранним началом IBD (EO-IBD), которые может поражать детей в возрасте от нескольких месяцев до восемнадцати лет.Наряду с ВЗК и воспалением толстой кишки у пациентов с ЭО-ВЗК могут также развиться перианальные заболевания, респираторные заболевания, артрит, а также могут быть абсцессы, свищи и язвы слизистой оболочки кишечника [82, 83]. Сообщалось о большом количестве мутаций белковых субъединиц IL-10R, начиная от аминокислотных замен, делеций, точечных мутаций и мутаций сдвига рамки считывания, приводящих к преждевременному стоп-кодону [79, 83]. Эти мутации вызывают дефект IL-10-опосредованного противовоспалительного сигнального каскада как у мышей IL-10R - / -, так и у людей, что приводит к тяжелому воспалению кишечника и увеличению провоспалительных цитокинов, особенно к увеличению TNFα, из периферической крови. мононуклеарные клетки [81, 84].Отсутствие противовоспалительного ответа и последующее увеличение провоспалительных цитокинов особенно сильно проявляется в кишечнике, где присутствие комменсальных бактерий приводит к сильному нерегулируемому иммунному ответу, который вызывает гипервоспалительное состояние и приводит к развитию раннего воспалительного процесса. начало ВЗК [79–81, 83]. Потеря сигнального каскада IL-10 на врожденных клетках также может нарушать перекрестные помехи с Т-клетками, что приводит к дальнейшему нарушению иммунного баланса слизистых оболочек и способствует воспалению кишечника [80].

Пациенты с ЭО-ВЗК обычно не реагируют на иммуносупрессивные препараты, такие как кортикостероиды и талидомид [81, 82], однако, поскольку дефекты у пациентов с метаболическим путем IL-10 / IL-10R связаны с клетками гемопоэтического происхождения, аллогенными гемопоэтическими стволовыми клетками. Трансплантация (ТГСК) была предпочтительным вариантом лечения. Как от семейных, так и от неродственных доноров, ТГСК до сих пор показала себя успешной, у пациентов с ЭО-ВЗК наступала ремиссия [81, 82]. Этот вариант лечения представляется многообещающим, однако один обзор показал, что частота отторжения первичного трансплантата была высокой, и предполагает, что пациенты с ЭО-ВЗК имеют режим трансплантации гаплоидентичного костного мозга с Т-клетками и посттрансплантационным циклофосфамидом для снижения частоты. отказа [83].

5. Симбиотическое вмешательство

Значительный прогресс, достигнутый за последние годы в понимании перекрестных помех между хозяином и микробами, профилей / сигнатур микробиома и молекулярных методов исследования кишечной микробиоты, облегчил разработку и проведение мероприятий по обращению вспять побочных эффектов, опосредованных микробиотой. во время болезненного состояния. Классические вмешательства включают такие соединения, как диета (как описано в разделе выше) и антибиотики, которые оказывают прямое воздействие на гомеостаз микробиома кишечника.Альтернативно, можно также прямо или косвенно ввести экзогенные бактерии для воздействия на эндогенную кишечную бактериальную флору и ее изменения в организме хозяина. Они могут проявляться в форме пробиотиков, трансплантации фекальной микробиоты и изменений окружающей среды в бактериальной флоре, которые создают симбиотическое вмешательство со своими преимуществами и недостатками []. Они могут оказывать сильное воздействие на хозяина и микробное сообщество кишечника, такое как 1) облегчение образования биопленки за счет усиления микробной коагрегации, 2) выработка бактериоцинов, обладающих избирательным антимикробным действием, 3) стимуляция иммунитета хозяина и 4) усиление барьерной функции кишечника через эпителиальные клетки хозяина.

Преимущества и недостатки различных симбиотических вмешательств микробной флоры кишечника

Экзогенные бактерии могут влиять на дисбиотический кишечник для восстановления здоровой флоры. Эти экзогенные бактерии могут быть введены в виде пробиотиков или трансплантации фекальной микробиоты, что имеет свои преимущества и недостатки. Микробы, присутствующие в окружающей среде, также могут изменять состав эндогенного микробиома кишечника и обеспечивать восприимчивость к болезням или защиту.

Пробиотики

Пробиотики - это живые, в основном грамположительные бактерии (например, Bifidobacteriaum spp ., Lactobacillus spp ., Lactococcus spp ., Pediococcus spp . И другие непатогенные штаммы E и другие непатогенные штаммы E. coli ). Обычно они способствуют целостности кишечного барьера, предотвращают бактериальную транслокацию в кишечнике и уменьшают воспалительную реакцию. Однако было высказано предположение, что эффекты пробиотиков могут быть временными, поскольку было показано, что введение Lactobacillus plantarum может привести к увеличению количества Lactobacillus в кале с течением времени, но не в биопсии кишечника [ 85].Тем не менее, хотя и временный, ответ in vivo человека показал, что эффекты L. plantarum могут быть драматичными для хозяина, чтобы установить иммунную толерантность путем изменения профиля экспрессии гена слизистой оболочки кишечника, в основном с участием NF-kB-зависимого пути [ 86]. Помимо изменений в транскриптоме гена-хозяина, пиросеквенирование фекалий здоровых людей, получавших пробиотики (три пробиотических штамма: Lactobacillus rhamnosus CNCM I-4036, Lactobacillus paracasei CNCM I-4034 и Bifidobacterium breve CNCM I-4035). сообщили об изменении общей численности кишечной флоры в здоровых условиях [87].

В контексте болезни пробиотики в форме ферментированного молока могут вызывать увеличение веса у людей с тяжелым острым недоеданием, модулируя эндогенную микробиоту кишечника [88]. Это будет полезно для развивающихся стран с высоким риском недоедания, особенно у детей. Однако введение других определенных штаммов пробиотиков может иметь эффект против ожирения. Например, потребление L. plantarum и L. gasseri приведет к потере веса за счет подавления нескольких гормональных путей [88].Это означает, что разные штаммы пробиотиков могут оказывать разные эффекты, и поэтому тип бактерий, которые нужно добавлять, необходимо тщательно охарактеризовать и выбрать для достижения желаемого эффекта. Этим Шен и др. Недавно продемонстрировали доказательную концепцию, в которой определенный консорциум из 8 бактерий (измененная флора Шадлера; АЧС) может снизить нейротоксичность и энцефалопатию, связанные с гипераммонемией [89]. Эти АЧС обладают минимальным действием уреазы, и заселение этого консорциума способствовало созданию нового сообщества бактерий, которое способствует долгосрочному снижению активности уреазы и выработке аммиака.Это приводит к снижению выработки аммиака и диоксида углерода в результате метаболизма мочевины, полученной из организма хозяина, уреазой бактериального происхождения. Аналогично, при воспалении кишечника, молочный продукт с пятью бактериальными штаммами, как сообщается, улучшает степень колита у мышей T-bet - / - × Rag2 - / - за счет изменения состава эндогенных бактерий кишечника [90]. Недавние последующие исследования той же группы впоследствии идентифицировали Lactococcus lactis I-1631 одного достаточно для облегчения колита, что было проверено на трех доклинических моделях колита на мышах [91].Колонизация L. lactis в кишечнике не является необходимой для лечения колита, скорее, опосредованный лизоцимом лизис хозяина во время колита приводит к высвобождению супероксиддисмутазы L. lactis , что снижает окислительный стресс во время воспаления. Это говорит о том, что бактерии могут приносить пользу хозяину, но для проявления этих полезных эффектов потребуются определенные производные от хозяина факторы.

Недостаток пробиотиков более количественный. Пероральные дозы пробиотиков значительно меньше (обычно в 3-4 раза), чем те, которые присутствуют в толстой кишке, и количество, которое в конечном итоге достигнет толстой кишки, будет еще больше уменьшаться при прохождении через тяжелые условия желудка и тонкой кишки.Кроме того, большинство используемых штаммов пробиотиков происходит из кишечника (например, Lactobacilli , Bifidobacteria и Escherichia ). Эти штаммы могли потерять свою адаптацию к кишечной среде во время культивирования ex vivo .

Трансплантация фекальной микробиоты

Трансплантация фекальной микробиоты (FMT; также известна как фекальная бактериотерапия или инфузия фекалий) - новый метод лечения пациентов с дисбактериозом. В этом методе используется принцип прививки микробиоты от здоровых доноров пациенту-реципиенту для повторного введения или восстановления стабильной среды, которая влияет как на эндогенные микробы, так и на хозяина.Отношения между донором и пациентом, по-видимому, не влияют на результат [92,93]. Первоначально FMT проводился с помощью фекальных клизм, впоследствии также с помощью назодуоденальных трубок (1991 г.) и колоноскопии (2000 г.). Недавние сообщения продемонстрировали разработку капсулированного замороженного инокулята, который можно вводить перорально без явных побочных эффектов и, таким образом, избежать ненужных инвазивных желудочно-кишечных процедур (2012) [94].

Примечательно, что лучший пример того, как FMT может облегчить течение болезни, - это инфекция Clostridium difficile (CDI), показатель излечения которого превышает 90–95% во всем мире [95].Пациенты с ИКД обычно продолжают принимать противомикробные препараты до 2–3 дней до FMT. Донорский стул, который обычно обрабатывают и используют в течение 8 часов после пассажа, суспендируют в небактериостатическом солевом растворе и фильтруют для удаления крупных твердых частиц. Пост-FMT приводит к размножению и восстановлению бактерий, полученных от донора, у пациента в течение от 2 недель до 1 месяца [96]. В настоящее время FMT рассматривается при других заболеваниях, таких как инсулинорезистентность, а также IBD [26, 97]. У пациентов с ВЗК, получающих FMT, может развиться лихорадка и временное снижение уровня С-реактивного белка [98].Временная характеристика FMT у пациентов с ВЗК показала сдвиг в сторону донорских филотипов у реципиента, включая Faecalibacterium prausnitzii , Rosebura faecis и Bacteroides ovatus , которые продуцируют противовоспалительные и / или короткоцепочечные жирные кислоты. Этот эффект может проявиться через 3 дня после трансплантации и сохраняться до 12 недель [98]. Таким образом, такой анализ микробного профиля после FMT с временным разрешением может быть использован для определения эффективности колонизации и мониторинга успешности FMT.

Однако вероятность успеха FMT при ВЗК намного ниже, чем при сравнении с ИКД: 62–71% пациентов с ВЗК достигают разрешения или уменьшения симптомов [97]. Данные, собранные для FMT при ВЗК, обычно выполняются на небольших когортах и, следовательно, также не имеют стандартизированных процедур, включая отбор доноров и подготовку образцов. Другой проблемой для FMT при ВЗК является способ введения, который будет зависеть от типа дисбактериоза. Например, Bacteroidetes может быть разрушен желудочной кислотой, и, таким образом, использование более низкого пути введения будет предпочтительным при выполнении FMT.Напротив, переход через верхние отделы желудочно-кишечного тракта необходим для того, чтобы определенные спорообразующие Firmicutes были эффективны функционально [99]. Другие общие проблемы, связанные с FMT, включают безопасность, стоимость, этическое принятие и риски, включая возможную передачу инфекционных агентов.

Экологические вмешательства

Окружающая среда оказывает глубокое влияние на микробиоту кишечника, обеспечивая общий гомеостаз, который начинается сразу после рождения. Состав / профиль микробиома детей, родившихся с помощью кесарева сечения, отличался от тех, которые родились естественным путем; первые сначала подвергаются воздействию бактерий из больничной среды, тогда как вторые сначала колонизируются материнскими фекальными и вагинальными бактериями [100].Было показано, что у детей, рожденных после кесарева сечения, отсутствует видов бифидобактерий, видов, которые важны для развития постнатального иммунитета, по сравнению с младенцами, родившимися через естественные родовые пути, у которых наблюдается преобладание этих видов [101].

Постнатально «гипотеза гигиены» впоследствии определяет развитие и изменения гомеостаза кишечника. Он основан на необходимости для развивающихся младенцев подвергаться воздействию большого количества как патогенных, так и комменсальных микроорганизмов, чтобы их иммунная система развивалась и функционировала должным образом.Это, очевидно, подтверждается многими исследованиями с использованием моделей на животных, демонстрирующих, как отсутствие воздействия микробов в раннем возрасте влияет не только на развитие иммунитета, но также контролирует созревание и функцию других органов, включая центральную нервную систему. Воздействие микробов в раннем возрасте оказывает стойкое воздействие на инвариантные естественные Т-клетки-киллеры (iNKT) и реакцию на такие заболевания, как ВЗК и астма [102]. У поросят микробное разнообразие окружающей среды влияет на количество CD4 + , CD4 + CD25 + эффекторных Т-клеток и CD4 + CD25 + Foxp3 + регуляторных Т-клеток, а также сыворотки. Ответ антител IgG [103].Вклад микробов окружающей среды в развитие болезни также очевиден во многих спонтанных моделях ВЗК, таких как α-цепь Т-клеточного рецептора (TCR-α) - / - мышей, у которых заболевание развивается не в условиях GF, а, скорее, в SPF и CV среды [102]. Помимо контроля иммунного ответа, микробы окружающей среды также влияют на развитие и функцию клеток-хозяев. Недавно Erny et al. Сообщили, что мыши GF обнаруживают глобальные дефекты в микроглии, а также в морфологии и нарушают клеточные сети [104].Они определили, что микробная продукция SCFA и продукты ферментации микробиоты присутствуют у мышей SPF, но не GF, и являются ключевыми детерминантами этой причины, поскольку повторное введение этих компонентов в мыши GF может спасти фенотип.

В более позднем возрасте такой образ жизни также может способствовать развитию дисбактериоза, связанного с окружающей средой. Например, кишечная микробиота людей и мышей демонстрирует суточные колебания, на которые могут влиять ритмы кормления или индукция смены часовых поясов.Смена часовых поясов вызывает дисбактериоз как у человека, так и у мышей и приводит к непереносимости глюкозы и ожирению [105]. Перенос аберрантной флоры через FMT мышам GF приведет к тому же фенотипу. В совокупности все эти примеры показывают, что изменение микробного статуса окружающей среды может либо способствовать развитию болезни, либо обеспечивать защиту. Улучшение нашего понимания всех этих факторов, а также создание основных исследовательских групп микробиома, таких как Проект человеческого микробиома, поддерживаемый Национальными институтами здравоохранения (NIH) в США, и проект MetaHIT (Метагеномика кишечного тракта человека), учрежденный Международный консорциум микробиома человека (IHMC) в Европе поможет лучше облегчить разработку плана вмешательства против дисбактериоза.

Дисбактериоз кишечной микробиоты при заболевании

Microb Ecol Health Dis. 2015; 26: 10.3402 / mehd.v26.26191.

Саймон Кардинг

1 Институт пищевых исследований, Норвич, Великобритания

2 Норвичская медицинская школа, Университет Восточной Англии, Норвич, Великобритания

Кристин Вербеке

3 Трансляционные исследования желудочно-кишечных расстройств, KU Левен, Левен, Бельгия

Daniel T. Vipond

1 Институт пищевых исследований, Норвич, Великобритания

2 Норвичская медицинская школа, Университет Восточной Англии, Норвич, Великобритания

Бернард М.Corfe

4 Исследовательская группа молекулярной гастроэнтерологии, Отделение онкологии, Университет Шеффилда, Шеффилд, Великобритания

5 Insigneo Институт in silico медицины, Университет Шеффилда, Шеффилд, Великобритания

Лорен Дж. Оуэн

6 Отделение питания человека, Отделение онкологии, Университет Шеффилда, Шеффилд, Великобритания

1 Институт пищевых исследований, Норвич, Великобритания

2 Норвичская медицинская школа, Университет Восточной Англии, Норвич, Великобритания

3 Трансляционные исследования желудочно-кишечных заболеваний, KU Leuven, Leuven, Belgium

4 Исследовательская группа молекулярной гастроэнтерологии, Отделение онкологии, Университет Шеффилда, Великобритания

5 Insigneo Institute for in silico Medicine, Университет Шеффилда , Шеффилд, Великобритания

6 Отделение питания человека, Департамент онкологии, Университет Шеффилда , Шеффилд, Великобритания

* Для корреспонденции: Бернарда М.Корф, Исследовательская группа молекулярной гастроэнтерологии, Отделение онкологии, Университет Шеффилда, Бич Хилл Роуд, Шеффилд, S10 2RX, Великобритания, электронная почта: [email protected]

Это статья в открытом доступе, распространяемая в соответствии с условиями Лицензия Creative Commons Attribution-Noncommercial 3.0 Unported, разрешающая любое некоммерческое использование, распространение и воспроизведение на любом носителе при условии правильного цитирования оригинальной работы.

Эта статья цитируется в других статьях в PMC.

Abstract

Появляется все больше доказательств того, что дисбактериоз кишечной микробиоты связан с патогенезом как кишечных, так и внекишечных заболеваний.Кишечные расстройства включают воспалительное заболевание кишечника, синдром раздраженного кишечника (СРК) и целиакию, в то время как внекишечные расстройства включают аллергию, астму, метаболический синдром, сердечно-сосудистые заболевания и ожирение.

Во многих из этих состояний механизмы, ведущие к развитию заболевания, включают в себя основную взаимозависимость между микробиотой толстой кишки, продуктами их метаболизма и иммунной системой хозяина. Установление «здоровых» отношений в раннем возрасте, по-видимому, имеет решающее значение для поддержания гомеостаза кишечника.Хотя у нас еще нет четкого понимания того, что представляет собой «здоровая» микробиота толстой кишки, картина вырисовывается из многих недавних исследований, идентифицирующих определенные виды бактерий, связанных со здоровой микробиотой. В частности, виды бактерий, проживающие в слизистом слое толстой кишки, либо посредством прямого контакта с клетками-хозяевами, либо посредством непрямого взаимодействия через бактериальные метаболиты, могут влиять на то, сохраняется ли гомеостаз клеток-хозяев или запускаются ли воспалительные механизмы.Помимо воспаления, есть некоторые свидетельства того, что нарушения микробиоты кишечника связаны с развитием колоректального рака. В этом случае дисбактериоз может быть не самым важным фактором, а скорее продуктом взаимодействия диеты и микробиома. Считается, что диета с высоким содержанием белка приводит к выработке канцерогенных метаболитов из микробиоты толстой кишки, что может привести к индукции неоплазии в эпителии толстой кишки.

Все более чувствительные методологии метаболомики выявляют набор небольших молекул, продуцируемых в микробиоме, которые имитируют или действуют как нейросигналеры или нейротрансмиттеры.В сочетании с доказательствами того, что пробиотические вмешательства могут изменять психологические конечные точки как у людей, так и на моделях грызунов, эти данные предполагают, что сопутствующие заболевания ЦНС, часто связанные с заболеванием ЖКТ, могут возникать в кишечнике в результате микробного дисбиоза.

В этом обзоре представлены текущие данные, показывающие, в какой степени кишечная микробиота способствует развитию заболеваний. Основываясь на имеющихся на сегодняшний день данных, мы можем оценить потенциал положительного изменения состава микробиоты толстой кишки и улучшения активности заболевания посредством бактериального вмешательства.

Ключевые слова: Микробиом, короткоцепочечные жирные кислоты, здоровье кишечника, метаболом толстой кишки, ось кишечник – мозг, воспаление

Микробиота кишечника человека состоит из триллионов микроорганизмов, большинство из которых имеют бактериальное и вирусное происхождение. считаются непатогенными (1, 2). Микробиота функционирует в тандеме с защитой хозяина и иммунной системой для защиты от колонизации и вторжения патогенов. Он также выполняет важную метаболическую функцию, действуя как источник необходимых питательных веществ и витаминов и помогая извлекать энергию и питательные вещества, такие как короткоцепочечные жирные кислоты (SCFA) и аминокислоты, из пищи.В конечном итоге хозяин зависит от своей кишечной микробиоты для ряда жизненно важных функций, и, таким образом, кишечная микробиота может способствовать здоровью. Однако трудно описать точное влияние кишечной микробиоты на здоровье человека и участие в заболеваниях человека.

Изменения в микробиоте могут быть результатом воздействия различных факторов окружающей среды, включая диету, токсины, лекарства и патогены. Из них кишечные патогены обладают наибольшим потенциалом вызывать микробный дисбиоз, что видно на экспериментальных моделях животных, где вирусные патогены пищевого происхождения могут вызывать как местное, так и системное воспаление, изменяя состав микробиоты и барьерную функцию, как механизм развития аутоиммунитета, как показано. при диабете 1 типа и опосредованном Т-клетками разрушении инсулин-продуцирующих β-клеток поджелудочной железы (3–5).Документирование дисбактериоза традиционно основывалось на классических микробиологических методах и способности культивировать чистые изоляты для идентификации и классификации, что обязательно ограничивается «культивируемыми» микроорганизмами. Появление высокопроизводительной технологии пиросеквенирования на основе ДНК для классификации бактерий и архей в соответствии с отдельными последовательностями 16S рРНК непосредственно из образцов человека (обычно фекального происхождения) без необходимости культивирования теперь обеспечивает быстрые и подробные средства профилирования сложных сообществ микроорганизмов.С момента первого применения этой технологии было показано, что состав кишечной микробиоты существенно различается у разных людей (6). Частично это можно объяснить генетическими различиями между хозяевами с положительной взаимосвязью между сходством доминирующих фекальных микробных сообществ и генетическим родством наблюдаемого хозяина (7). На уровне филума доминируют Bacteroidetes и Firmicutes , также присутствуют Proteobacteria , Actinobacteria , Fusobacteria , Spriochaetes , Verrucomicrobia и Lentisphaerae (8, 9, 9).Используя метагеномный анализ для исследования функциональной способности генома кишечной микробиоты (микробиома), было показано, что почти 40% микробных генов, присутствующих у каждого человека, являются общими, по крайней мере, с половиной населения в целом, что свидетельствует о существовании функциональных генов. core, или стержневой микробиом (10). Основной подход к изучению изменений в составе кишечной микробиоты в связи с заболеванием основывается, прежде всего, на филогенетической характеристике микробиоты больных людей по сравнению с внешне здоровыми людьми.Однако, поскольку помимо возрастных изменений в составе кишечной микробиоты существуют существенные межиндивидуальные и внутрииндивидуальные различия, трудно установить точную взаимосвязь между здоровьем человека и наличием и относительной численностью конкретных микробных сообществ. Возможно, в будущем можно будет использовать конкретные изменения в разнообразии композиций или даже в функциональном разнообразии в качестве биомаркеров здоровья или конкретных заболеваний. Однако важно отметить, что сомнительно, являются ли изменения филогенетического состава причиной или следствием данного заболевания.

Вероятно, наиболее убедительные доказательства прямого участия кишечной микробиоты в патогенезе заболевания или потребности в нем получены из исследований с использованием стерильных мышей моделей аутоиммунного заболевания человека, в которых требуется воздействие и колонизация микроорганизмами окружающей среды при возникновении и прогрессировании заболевания. можно определить (). В большинстве, но не во всех моделях болезни, тяжесть и / или частота заболевания снижается в условиях отсутствия микробов, что соответствует микробиоте, являющейся «спусковым крючком» для прогрессирования заболевания.Однако попытки идентифицировать представителей «патогенной» микробиоты (патобионтов), которые могут воспроизводить эффект микробиоты в целом, до сих пор не увенчались успехом.

Таблица 1

Кишечная микробиота и аутоиммунитет

Без микробов 9458 Неудивительно, что дисбактериоз кишечника чаще всего связан с заболеваниями, связанными с желудочно-кишечным трактом, при которых изменения во взаимодействии хозяина (иммунной системы) со стимулами и антигенами просвета вызывают и / или сохраняют неконтролируемое воспаление в слизистой оболочке кишечника, а в некоторых случаях вне.

Метаболомическое влияние взаимодействия диеты и микробиома на здоровье человека

Компоненты пищи, которые не перевариваются в тонком кишечнике, а также эндогенные соединения, такие как пищеварительные ферменты и выделяющие эпителиальные клетки и связанную с ними слизь, попадают в толстую кишку и становятся доступными для ферментации кишечной микробиотой. Бактериальное превращение этих соединений приводит к появлению большого количества метаболитов, находящихся в тесном контакте с клетками хозяина. Таким образом, эти метаболиты могут влиять на метаболический фенотип хозяина и влиять на риск заболевания (11).

Непереваренные углеводы и белки являются основными субстратами в распоряжении микробиоты. Ферментация этих субстратов приводит к образованию ряда метаболитов, включая SCFA, жирные кислоты с разветвленной цепью, аммиак, амины, фенольные соединения и газы, включая водород, метан и сероводород. Кроме того, кишечная микробиота участвует в производстве витаминов, активации или инактивации биоактивных компонентов пищи, таких как изофлаваноиды и растительные лигнаны, превращении пролекарств в их биоактивные формы и преобразовании желчных кислот и ксенобиотиков (12, 13 ).

Механистическое влияние метаболитов на здоровье хозяина

SCFA ацетат, пропионат и бутират являются основными анионами в толстой кишке и в основном образуются в результате бактериальной ферментации непереваренных углеводов. До 95% продуцируемых SCFA легко абсорбируются колоноцитами для использования в качестве энергетических субстратов. Поскольку колоноциты получают до 60–70% своей потребности в энергии за счет окисления SCFA (14), SCFA обеспечивают около 10% суточной потребности в калориях человека (15). Фракция, которая не потребляется колоноцитами, транспортируется через базолатеральную мембрану в печень через портальный кровоток.Помимо своей локальной роли в качестве энергетических субстратов в толстой кишке, SCFA действуют как сигнальные молекулы, участвующие в системном метаболизме липидов и регуляции глюкозы / инсулина (16). Эти эффекты, по крайней мере частично, опосредованы взаимодействием с двумя специфическими рецепторами, связанными с G-белками - GPR41 и GPR43 (позже переименованные в FFAR3 и FFAR2 соответственно) (17), которые широко распространены в организме человека, включая тонкий кишечник. и толстая кишка (18). Внутри клеток SCFA могут действовать как ингибиторы гистоновых деацетилаз, вызывая гиперацетилирование гистонов, что влияет на экспрессию генов и приводит к противовоспалительным свойствам, индукции остановки роста и апоптозу (19).Однако комплексное понимание влияния SCFA на метаболизм хозяина требует большего количества количественных данных о потоках SCFA в различных компартментах тела. Из-за его недоступности имеется мало информации о скорости продукции in vivo SCFA и кинетике абсорбции в толстом кишечнике.

Полифенолы растений были связаны с преимуществами для здоровья, включая противовоспалительные, антиэстрогенные, кардиозащитные, химиозащитные и нейрозащитные эффекты (10).Однако механистические доказательства in vivo еще полностью не изучены. Большинству полифенолов растений требуется метаболическая трансформация (включая дегликацию и гидролиз), чтобы сделать их биологически активными. Внутри толстой кишки они расщепляются микробиотой на множество небольших фенольных соединений, физиологическое значение которых недостаточно хорошо известно (20). Кроме того, недавние исследования указывают на избирательную модуляцию состава микробиоты после потребления полифенолов (21).Например, потребление полифенолов красного вина значительно увеличивает количество Enterococcus , Prevotella , Bacteroides , Bifidobacterium , Bacteroides uniformis , Eggerthella lenta и Blautia coccoides-Eubacterium rectale ). Следовательно, польза для здоровья, связанная с полифенолами, должна быть связана не только с их биоактивными метаболитами, но и с модуляцией кишечной микробиоты.

Другие продукты бактериального метаболизма связаны с заболеваниями печени, сердечно-сосудистой системы и почек.

В последние годы все большее внимание уделяется оси кишечник – печень и влиянию кишечной микробиоты на функцию печени. Печень подвергается интенсивному воздействию метаболитов, образующихся при внутриполостной ферментации, поскольку она получает 70% своего кровоснабжения из кишечника через воротную вену (23). В начале 1980-х годов была высказана предположение о возможной причинной роли микробиоты в развитии неалкогольной жировой болезни печени (НАЖБП).У пациентов, перенесших операцию шунтирования кишечника, стеатоз печени развивался параллельно с избыточным бактериальным ростом. Интересно, что стеатоз регрессировал после лечения антибиотиком метронидазолом (24). Одним из механизмов, связывающих микробиоту с НАЖБП, является бактериальный метаболизм холина. У мышей, восприимчивых к НАЖБП и получавших диету с высоким содержанием жиров, холин все больше метаболизировался до метиламинов, что приводило к высокой экскреции с мочой диметиламина (DMA) и триметиламина (TMA) и, соответственно, к низким уровням фосфатидилхолина в сыворотке (25).

Из-за превращения холина в метиламины микробиотой биодоступность холина снижается, что приводит к невозможности синтеза фосфатидилхолина с последующим накоплением триглицеридов в печени. Это имитирует диету с дефицитом холина, которая постоянно ассоциируется со стеатозом печени (26).

Бактериальный метаболит ТМА абсорбируется слизистой оболочкой кишечника и транспортируется в печень через воротную вену, где он окисляется до триметиламина N -оксид (ТМАО) ферментным комплексом флавинмонооксигеназа (FMO).В метаболомическом исследовании плазмы пациентов, проходящих плановую кардиологическую оценку, было выявлено и подтверждено, что ТМАО является прогностическим фактором сердечно-сосудистых заболеваний (ССЗ). Последующие эксперименты на мышах подтвердили облигатную роль кишечной микробиоты в образовании ТМАО и указали на проатерогенную природу ТМАО за счет увеличения нагруженных холестерином макрофагов и образования пенистых клеток (27). Точно так же метаболизм кишечной микробиотой диетического L-карнитина, ТМА, который содержится в большом количестве в красном мясе, также продуцирует ТМАО и ускоряет атеросклероз у мышей (28).

Дисбиоз при заболевании

Дисбиоз и расстройства, связанные с желудочно-кишечным трактом

Воспалительное заболевание кишечника

Болезнь Крона (БК) и язвенный колит (ЯК) являются наиболее распространенными формами воспалительного заболевания кишечника (ВЗК), характеризующимися хроническим рецидивом воспаление, поражающее слизистую кишечника. Хотя этиология обоих заболеваний неизвестна, появляется все больше доказательств того, что микробный дисбиоз кишечника играет роль в патогенезе ВЗК (29). В целом, у пациентов наблюдается снижение микробной популяции, функционального разнообразия и стабильности кишечной микробиоты со снижением специфического Firmicutes и сопутствующим увеличением Bacteroidetes и факультативных анаэробов, таких как Enterobacteriaceae . (30).Также были отмечены значительные различия в микробиоте пациентов с БК и ЯК (31, 32). При БК преобладающий дисбиоз связан с пятью видами бактерий, среди которых изменение численности Faecalibacterium prausnitzii связано с продлением ремиссии заболевания (32, 33), причем эта бактерия оказывает терапевтический эффект в экспериментальных условиях. модели колита (34). Напротив, адгезивно-инвазивные E. coli и Mycobacterium paratuberculosis были вовлечены в патогенез БК, хотя причинно-следственная связь еще не продемонстрирована (35, 36).Действительно, до сих пор неясно, является ли микробный дисбиоз кишечника прямой причиной воспаления при ВЗК или просто результатом нарушения среды в желудочно-кишечном тракте. Одним из исследований, направленных на определение статуса микробиоты при ранней диагностике случаев БК, является исследование Gevers et al. (Cell Host Microbe 2014) (37). Это исследование проанализировало микробиоту большой когорты недавно диагностированных педиатрических пациентов с CD и обнаружило четкие различия в бактериальных популяциях между CD и здоровыми пациентами контрольной группы.У пациентов с БК было увеличено количество Enterobacteriaceae , Pasteurellaceae , Veillonellaceae и Fusobacteriaceae , и уменьшилось количество Erysipelotrichales , Bacteroidales и Clostridiales по сравнению со здоровыми контрольными пациентами. Интересно, что эти различия были выявлены только при анализе образцов слизистой оболочки (а не образцов фекалий), что указывает на то, что бактерии, находящиеся в слое слизистой оболочки, могут иметь большее значение для этиологии заболевания.

Дисбиоз и другие расстройства желудочно-кишечного тракта

Помимо ВЗК, метаболических нарушений, ожирения и диабета 2 типа (СД2), кишечная микробиота также вовлечена в несколько других (хронических) заболеваний и расстройств, связанных с желудочно-кишечным трактом, таких как как синдром раздраженного кишечника (СРК), целиакия и колоректальный рак (CRC). При СРК изменения в составе микробиоты были описаны при различных подтипах заболевания по сравнению со здоровыми людьми (38, 39), хотя изменения не являются однородными (40).Целиакия и CRC также были связаны с изменениями в составе микробиоты с повышенным разнообразием и богатством, наблюдаемым по сравнению с контрольными субъектами (41, 42). Однако при всех этих заболеваниях не наблюдается последовательного изменения микробиоты. Однако в случае целиакии недавнее исследование пролило свет на взаимодействие между генетикой хозяина и составом микробиоты в отношении развития болезни. Экспрессия лейкоцитарного антигена DQ2 является сильным фактором риска развития целиакии.Дети с этим гаплотипом имеют измененный состав микробиоты (по сравнению с людьми без HLA DQ2) до клинически очевидного заболевания (43). Глютеновая болезнь возникает в результате реактивности CD4 Т-клеток на пищевой глиадин, при этом некоторые виды бактерий способны переваривать глиадин и, возможно, поэтому снижают иммунопатогенность принимаемого глиадина.

Дисбиоз при системном заболевании

Нарушения обмена веществ

Увеличение относительной численности Firmicutes и снижение уровня Bacteroidetes наблюдались как у мышей с ожирением (44), так и у людей (45), хотя эти данные не были воспроизведены во всех исследованиях (46–52).Следует отметить, что дисбактериоз кишечника в настоящее время не используется в качестве фактора для диагностики или прогнозирования начала метаболического заболевания, такого как ожирение или сахарный диабет 2 типа. Более тонкие изменения в составе кишечной микробиоты были описаны у лиц с ожирением с меньшим микробным разнообразием состава по сравнению с худыми людьми (7). Дополнительные доказательства причастности кишечной микробиоты к ожирению получены от мышей с ожирением (o b / ob ), у которых отсутствует экспрессия гена, кодирующего лептин, продукт которого способствует насыщению.В подтверждение участия микробиоты в развитии ожирения у этих мышей лечение антибиотиками вызвало изменения в микробиоте кишечника, снизив частоту метаболической эндотоксемии, воспаления и некоторых параметров, связанных с ожирением (53). В человеческих популяциях очевидно, что диета с высоким содержанием жиров и чрезмерное потребление пищи ответственны за более широкую распространенность ожирения и СД2 на Западе, тем самым способствуя изменению метаболизма хозяина и иммунного гомеостаза через вызванные диетой изменения в кишечнике микробиота.Действительно, роль микробиоты в метаболизме и, в частности, ее способность собирать энергию из пищи, подчеркивает значительный экологический фактор, влияющий на риск метаболических заболеваний. Прямая связь между составом кишечной микробиоты и массой тела проистекает из исследований с использованием стерильных мышей, чтобы показать, что отсутствие кишечных микробов защищает от ожирения, вызванного диетой, и что кишечная микробиота участвует в регулировании накопления жира. (54–56). Эти и аналогичные исследования привели к предположению, что люди с ожирением более эффективно превращают пищу в полезную энергию и накапливают эту энергию в жире, чем худые люди, что связано с функциональностью кишечной микробиоты и может быть ее следствием. .Поэтому основное понимание различий между различными физиологическими состояниями организма-хозяина, например, у людей с ожирением и у худых, должно быть получено путем изучения функционального микробного разнообразия в дополнение к филогенетическому разнообразию. Действительно, было обнаружено, что измененное представление бактериальных генов и метаболических путей, включая те, которые участвуют в сборе питательных веществ, связано с ожирением (7). Кроме того, количество SCFA, продуцируемых кишечной микробиотой, а не изменения в составе микробиоты, играет важную роль в развитии ожирения (51).Возможно, неудивительно, что сдвиги в типах микробиоты также были описаны при СД2 (57), а исследования, основанные на метагеномике, выявляли дискриминантные метагеномные маркеры, которые могут различаться у разных этнических групп пациентов (58, 59). Остается вопрос, является ли дисбактериоз кишечной микробиоты прямой причиной какого-либо нарушения обмена веществ, или же изменения в кишечных микробных сообществах у пораженных и страдающих ожирением людей являются адаптацией к изменению диеты хозяина. Два наблюдения, имеющих отношение к ответу на этот вопрос: одно: передача микробиоты от худых доноров людям с метаболическим синдромом может повысить чувствительность к инсулину и общее улучшение симптомов метаболического заболевания (60), и второе, диетические изменения у людей приводят к быстрым и обратимым последствиям. изменения относительной численности доминантных представителей кишечной микробиоты (61).

Потенциальное взаимодействие между физиологией, поведением, микробиомом и диетой хозяина подтверждается исследованиями как на животных, так и на людях, показывающими быстрые изменения в составе микробиоты после операции шунтирования желудка по Ру (RYGB) (52, 62), хотя влияние на уровне метаболитов менее изучен. Тем не менее, в модели крыс, не страдающих ожирением, операция RYGB привела к глубоким метаболическим нарушениям (63). Помимо более низких концентраций олигосахаридов и более высоких концентраций SCFA, в образцах фекалий, полученных после операции, были обнаружены повышенные уровни метаболитов ферментации белков толстой кишки.Эти результаты могут указывать на неполное переваривание белков в тонком кишечнике в результате обхода, ведущего к увеличению поступления белка в толстую кишку с усилением ферментации белка. Интересно, что образцы фекальной воды, полученные через 2 и 8 недель после операции, показали значительно большую цитотоксичность по сравнению с образцами, полученными от ложнооперированных животных (64). Необходимо исследовать, включает ли наблюдаемая связь между повышенными уровнями метаболитов ферментации аминокислот и повышенной цитотоксичностью причинно-следственную связь.У здоровых субъектов с нормальным весом повышенная ферментация белка после диеты с высоким содержанием белка не была связана с повышенной цитотоксичностью фекальной воды (65).

Кроме того, между толстой кишкой и почкой существует двунаправленная функциональная связь. Уремия влияет на метаболизм микробов в толстой кишке, тогда как метаболиты, связанные с микробами, участвуют в прогрессировании заболевания почек (66). п-Крезилсульфат и индоксилсульфат изучены наиболее широко и считаются прототипами так называемых уремических токсинов.Они получены в результате бактериальной ферментации ароматических аминокислот тирозина и триптофана, соответственно, с последующей сульфатацией в слизистой оболочке толстой кишки или печени. В плазме они сильно связываются с белками и накапливаются при нарушении функции почек. Свободные, несвязанные уровни этих растворенных веществ увеличиваются больше, чем их общие уровни в плазме из-за конкуренции за сайты связывания с белками плазмы (67). У пациентов с хроническим заболеванием почек уровни п-крезилсульфата и индоксилсульфата связаны с общей смертностью, сердечно-сосудистыми заболеваниями и прогрессированием заболевания почек (68).

Дисбактериоз и расстройства, связанные с ЦНС

Кишечный микробный дисбактериоз также наблюдался при внекишечных заболеваниях и, в частности, тех, которые могут воздействовать на «ось кишечник – мозг», влияя на ЦНС, поведение и когнитивные функции.

Несколько исследований были сосредоточены на возможности того, что кишечная микробиота может влиять на когнитивные функции и поведение путем прямого перепрограммирования оси гипоталамус-гипофиз-надпочечники (HPA), общего пути, активируемого в ответ на инфекцию и нарушенного психологическими стрессорами.Известно, что кишечные инфекции могут вызывать беспокойство, депрессию и когнитивную дисфункцию; У беспроблемных мышей, у которых нет кишечной микробиоты, наблюдаются изменения в стрессореактивности, центральной нейрохимии и поведении, свидетельствующие о снижении тревожности по сравнению с обычными мышами (43). Например, у мышей, свободных от микробов, повышенное тревожное поведение было связано с изменениями в продукции нейротрофических факторов и гормонов и экспрессии их рецепторов (69).У мышей, инфицированных патогенами (70–73), Campylobacter jejuni (частая причина гастроэнтерита) может вызывать у мышей тревожное поведение и активацию ствола головного мозга (солитарное ядро ​​и латеральное парабрахиальное ядро). Комменсальные бактерии могут влиять на изменения в головном мозге через ГАМК, которая может напрямую влиять на рецепторы как иммунные, так и нервные в ENS и CNS (74, 75). ГАМК является основным тормозным нейромедиатором ЦНС и участвует в регуляции физиологических и психологических процессов.Изменения экспрессии центрального рецептора ГАМК участвуют в патогенезе тревоги и депрессии (76).

Известно, что ранняя колонизация кишечного тракта микробами важна для постнатального развития кишечной нервной системы (77). Соответственно, кишечная микробиота может влиять на развитие и функцию ЦНС (78, 79).

Доказательства возможной причинной роли кишечной микробиоты в развитии расстройства аутистического спектра (РАС) получены на модели мышей с активацией материнского иммунитета (МИА), в которой беременным животным после введения вирусного миметика, уловка (I: C) , проявляют повышенную кишечную проницаемость и развивают стереотипные отклонения в поведении, социальных способностях и общении, напоминающие РАС (80).У потомков с МИА наблюдается дисбактериоз кишечника и измененный метаболомный профиль сыворотки, характеризующийся чрезмерным уровнем 4-этилфенилсульфата (4EPS), полученного из микробиоты, по сравнению с контрольным потомством, с восстановлением функции кишечного барьера и облегчением симптомов, подобных РАС, после введения пробиотических бактерий. Особо следует отметить, что экзогенно вводимый 4EPS, который структурно связан с токсичной сульфатированной формой p -крезола, вызывал тревожное поведение у наивных мышей, что свидетельствует о том, что аутизм и, возможно, другие поведенческие состояния затрагивают желудочно-кишечный тракт. в конечном итоге влияя на иммунную, метаболическую и нервную системы.

С появлением доклинических данных и показаний к нарушениям развития, возможно, не случайно, что расстройства желудочно-кишечного тракта, включая ВЗК и СРК, являются частыми сопутствующими заболеваниями при изнурительных расстройствах, связанных со стрессом, включая депрессию и тревогу (81, 82). Недавние исследования показали, что кишечная проницаемость и бактериальная транслокация могут управлять иммуновоспалительными, окислительными и нитрозативными путями стресса (IO&NS) при депрессии и, таким образом, играть роль в ее патофизиологии.Было показано, что хроническая депрессия у людей сопровождается повышенным иммунным ответом (сывороточные ответы IgM и IgA), направленным против липополисахаридных (ЛПС) продуктов грамотрицательных кишечных энтеробактерий, то есть Hafnia alvei , Pseudomonas aeruginosa , Morganella morganii, Pseudomonas putida , Citrobacter koseri и Klebsiella pneumonia (83). Были предприняты попытки изучить потенциальное влияние бактериотерапии на ЦНС и поведение на стерильных и инфицированных патогенами грызунах.Свободные от зародышей мыши проявляют гиперчувствительную активность оси HPA после стресса по сравнению с мышами, свободными от специфических патогенов (78), и этот гиперответ оси HPA был отменен с помощью Bifidobacterium infantis (84). B. infantis повышал уровень триптофана в плазме, снижал концентрацию метаболита серотонина во фронтальной коре и концентрацию метаболита дофамина в миндалевидной коре (85), оба из которых участвовали в депрессии (86, 87). У людей эффективность пробиотиков для регуляции настроения была предложена в исследовании Lactobacillus casei , которое показало, что у субъектов с самыми низкими показателями депрессии / приподнятого состояния на исходном уровне наблюдалось значительное улучшение показателей настроения после приема пробиотика по сравнению с группой плацебо. (88).Комбинация L. helveticus и B. longum уменьшала тревожность и оказывала положительный психологический эффект за счет снижения уровня кортизола в сыворотке у здоровых добровольцев (89).

Функциональная активность мозга, измеренная с помощью функционального магнитного резонанса (фМРТ), показала, что пробиотический состав снижает внутреннюю связь мозга и реакцию на эмоциональные стимулы и изменения в связности среднего мозга (90).

Однако следует отметить, что в нескольких исследованиях не удалось наблюдать влияние пробиотических добавок на показатели тревожности в клинических популяциях, включая СРК (91, 92), шизофрению (93) и ревматоидный артрит (94).Частично это можно объяснить спектром доз, видами (и их комбинациями) и сроками, используемыми в пробиотических вмешательствах, а также отсутствием стандартного дизайна испытаний.

Будущие подходы: восстановление кишечной микробиоты с помощью бактериотерапии

Существует огромный потенциал для манипулирования микробиотой для поддержания, улучшения или восстановления микробиоты у лиц из группы риска или больных.

Важным предварительным условием для бактериальной терапии (бактериотерапии) является определение того, что составляет «здоровую» микробиоту в течение и на протяжении всей жизни, что может быть определено по-разному на уровне популяции и индивидуума.Необходимы дополнительные исследования для изучения разнообразия видов и штаммов в желудочно-кишечном тракте, разнообразия микробных генов (микробиома) и их функций в желудочно-кишечном тракте на протяжении всего человеческого развития - от колыбели до могилы! В терапевтическом плане подходы на основе пробиотиков использовались с некоторым успехом на протяжении веков (95, 96), как и более радикальный и грубый подход к оптовым стратегиям замещения микробиоты, основанным на трансплантации фекалий (97). Применение этих процедур более подробно обсуждается в отдельном обзоре в этом дополнении - «Манипулирование кишечной микробиотой для поддержания здоровья и лечения болезней».Разработка и использование этих и других более совершенных подходов с использованием химически определенных бактериальных продуктов в клинике будет зависеть от понимания их молекулярных механизмов действия и конкретных характеристик хозяина, требующих персонализации подхода, чтобы позволить бактериальной / пробиотической терапии полностью раскрыть свой потенциал. в лечении и управлении здоровьем человека.

Благодарности

Авторы благодарят доктора Ника Чедвика за его поддержку и критический обзор во время создания этой рукописи.Авторы выражают признательность Европейскому научному фонду (ESF) за поддержку в рамках программы исследовательской сети Европейской сети исследований здоровья желудочно-кишечного тракта.

Примечания

Этот документ является частью Proceedings from the 2013 ENGIHR Conference in Valencia, Spain . Еще документы из этого приложения можно найти на http://www.microbecolhealthdis.net

Конфликт интересов и финансирование

Авторы не получали никакого финансирования или льгот от промышленности или других источников для проведения этого исследования.

Ссылки

1. Savage DC. Микробная экология желудочно-кишечного тракта. Ann Rev Microbiol. 1977; 31: 107–33. [PubMed] [Google Scholar] 2. Рейес А., Хейнс М., Хэнсон Н., Энгли Ф.Э., Хит А.С., Ровер Ф. и др. Вирусы фекальной микробиоты однояйцевых близнецов и их матерей. Природа. 2010; 466: 334–8. [Бесплатная статья PMC] [PubMed] [Google Scholar] 3. Камада Н., Со Су, Чен Г. Ю., Нуньес Г. Роль кишечной микробиоты в иммунитете и воспалительных заболеваниях. Nat Rev Immunol. 2013; 13: 321–35.[PubMed] [Google Scholar] 5. Вен Л., Лей Р.Е., Волчков П.Ю., Странджес ПБ, Аванесян Л., Стоунбрейкер А.С. и др. Врожденный иммунитет и микробиота кишечника в развитии диабета 1 типа. Природа. 2008; 455: 1109–13. [Бесплатная статья PMC] [PubMed] [Google Scholar] 6. Зоетендал Э.Г., Аккерманс А.Д., Де Вос ВМ. Анализ гель-электрофореза в градиенте температуры 16S рРНК из образцов фекалий человека выявляет стабильные и специфичные для хозяина сообщества активных бактерий. Appl Environ Microbiol. 1998; 64: 3854–9. [Бесплатная статья PMC] [PubMed] [Google Scholar] 7.Тернбо П.Дж., Хамади М., Яцуненко Т., Кантарел Б.Л., Дункан А., Лей Р.Э. и др. Основной микробиом кишечника у тучных и худых близнецов. Природа. 2009. 457: 480–4. [Бесплатная статья PMC] [PubMed] [Google Scholar] 8. Rajilic-Stojanovic M, Smidt H, de Vos WM. Пересмотр разнообразия микробиоты желудочно-кишечного тракта человека. Environ Microbiol. 2007; 9: 2125–36. [PubMed] [Google Scholar] 9. Зоетендал Э.Г., Раджилич-Стоянович М, де Вос ВМ. Высокопроизводительный анализ разнообразия и функциональности микробиоты желудочно-кишечного тракта.Кишечник. 2008; 57: 1605–15. [PubMed] [Google Scholar] 10. Qin J, Li R, Raes J, Arumugam M, Burgdorf KS, Manichanh C и др. Каталог микробных генов кишечника человека, созданный путем метагеномного секвенирования. Природа. 2010; 464: 59–65. [Бесплатная статья PMC] [PubMed] [Google Scholar] 11. Николсон Дж. К., Холмс Э., Кинросс Дж., Берселин Р., Гибсон Дж., Джиа В. и др. Метаболические взаимодействия микробиоты кишечника и хозяина. Наука. 2012; 336: 1262–7. [PubMed] [Google Scholar] 12. Блаут М., Клавель Т. Метаболическое разнообразие кишечной микробиоты: последствия для здоровья и болезней.J Nutr. 2007; 137: 751С – 5С. [PubMed] [Google Scholar] 13. Марчези Дж., Шанахан Ф. Нормальная кишечная микробиота. Curr Opin Infect Dis. 2007. 20: 508–13. [PubMed] [Google Scholar] 14. Roediger WEW. Использование питательных веществ изолированными эпителиальными клетками толстой кишки крысы. Гастроэнтерология. 1982; 83: 424–9. [PubMed] [Google Scholar] 15. Бергман ЭН. Энергетический вклад летучих жирных кислот из желудочно-кишечного тракта у различных видов. Physiol Rev.1990; 70: 567–90. [PubMed] [Google Scholar] 16. ден Бестен Г., ван Ойнен К., Гроен А. К., Венема К., Рейнгуд Д. Д., Баккер Б. М..Роль короткоцепочечных жирных кислот во взаимодействии между диетой, кишечной микробиотой и энергетическим обменом хозяина. J Lipid Res. 2013; 54: 2325–40. [Бесплатная статья PMC] [PubMed] [Google Scholar] 17. Браун А.Дж., Голдсуорси С.М., Барнс А.А., Эйлерт М.М., Чанг Л., Дэниэлс Д. и др. Рецепторы GPR41 и GPR43, связанные с белками G-сирот, активируются пропионатом и другими карбоновыми кислотами с короткой цепью. J Biol Chem. 2003. 278: 11312–19. [PubMed] [Google Scholar] 18. Layden BT, Angueira AR, Brodsky M, Durai V, Lowe WL.Короткоцепочечные жирные кислоты и их рецепторы: новые метаболические мишени. Перевод Рез. 2013; 161: 131–40. [PubMed] [Google Scholar] 19. Schilderink R, Verseijden C, de Jonge WJ. Диетические ингибиторы гистоновых деацетилаз в кишечном иммунитете и гомеостазе. Фронт Иммунол. 2013; 4: 226. DOI: 10.3389 / fimmu.2013.00226. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 20. Сельма М.В., Эспин Ю.С., Томаш-Барберан Ф.А. Взаимодействие фенольных соединений и микробиоты кишечника: роль в здоровье человека. J. Agric Food Chem. 2009; 57: 6485–501.[PubMed] [Google Scholar] 21. Cardona F, Andrés-Lacueva C, Tulipani S, Tinahones FJ, Queipo-Ortuño MI. Польза полифенолов для микробиоты кишечника и их влияние на здоровье человека. J Nutr Biochem. 2013; 24: 1415–22. [PubMed] [Google Scholar] 22. Queipo-Ortuno MI, Boto-Ordonez M, Murri M, Gomez-Zumaquero JM, Clemente-Postigo M, Estruch R, et al. Влияние полифенолов красного вина и этанола на экологию кишечной микробиоты и биохимические биомаркеры. Am J Clin Nutr. 2012; 95: 1323–34. [PubMed] [Google Scholar] 23.Арон-Висневски Дж., Габорит Б., Дютур А., Клемент К. Микробиота кишечника и неалкогольная жировая болезнь печени: новые идеи. Clin Microbiol Infect. 2013; 19: 338–48. [PubMed] [Google Scholar] 24. Дреник Э.Дж., Фислер Дж., Джонсон Д. Стеатоз печени после кишечного обходного анастомоза - профилактика и устранение метронидазолом, независимо от белково-калорийной недостаточности. Гастроэнтерология. 1982; 82: 535–48. [PubMed] [Google Scholar] 25. Дюма М.Э., Бартон Р.Х., Той А., Клорек О., Бланшер С., Ротвелл А. и др. Метаболическое профилирование показывает вклад микробиоты кишечника в фенотип жировой дистрофии печени у инсулинорезистентных мышей.Proc Natl Acad Sci USA. 2006; 103: 12511–16. [Бесплатная статья PMC] [PubMed] [Google Scholar] 26. Корбин KD, Zeisel SH. Метаболизм холина позволяет по-новому взглянуть на неалкогольную жировую болезнь печени и ее прогрессирование. Курр Опин Гастроэнтерол. 2012; 28: 159–65. [Бесплатная статья PMC] [PubMed] [Google Scholar] 27. Ван З., Клипфелл Э., Беннетт Б.Дж., Коэт Р., Левисон Б.С., Дугар Б. и др. Метаболизм фосфатидилхолина в кишечной флоре способствует развитию сердечно-сосудистых заболеваний. Природа. 2011; 472: 57–63. [Бесплатная статья PMC] [PubMed] [Google Scholar] 28.Koeth RA, Wang Z, Levison BS, Buffa JA, Org E, Sheehy BT и др. Метаболизм L-карнитина, питательного вещества красного мяса, микробиоты кишечника способствует развитию атеросклероза. Nat Med. 2013; 19: 576–85. [Бесплатная статья PMC] [PubMed] [Google Scholar] 29. Баумгарт, округ Колумбия, Кардинг SR. Воспалительное заболевание кишечника: причины и иммунобиология. Ланцет. 2007; 369: 1627–40. [PubMed] [Google Scholar] 30. Хансен Дж., Гулати А., Сартор РБ. Роль иммунитета слизистой оболочки и генетики хозяина в определении кишечных комменсальных бактерий. Курр Опин Гастроэнтерол.2010; 26: 564–71. [Бесплатная статья PMC] [PubMed] [Google Scholar] 31. Франк Д. Н., Сент-Аманд А. Л., Фельдман Р. А., Boedeker EC, Harpaz N, Pace NR. Молекулярно-филогенетическая характеристика дисбаланса микробного сообщества при воспалительных заболеваниях кишечника человека. Proc Natl Acad Sci USA. 2007; 104: 13780–5. [Бесплатная статья PMC] [PubMed] [Google Scholar] 32. Sokol H, Pigneur B, Watterlot L, Lakhdari O, Bermudez-Humaran LG, Gratadoux JJ, et al. Faecalibacterium prausnitzii - это противовоспалительная комменсальная бактерия, идентифицированная анализом кишечной микробиоты пациентов с болезнью Крона.Proc Natl Acad Sci USA. 2008. 105: 16731–6. [Бесплатная статья PMC] [PubMed] [Google Scholar] 33. Joossens M, Huys G, Cnockaert M, De Preter V, Verbeke K, Rutgeerts P и др. Дисбиоз фекальной микробиоты у пациентов с болезнью Крона и их здоровых родственников. Кишечник. 2011; 60: 631–7. [PubMed] [Google Scholar] 34. Микель С., Мартин Р., Росси О., Бермудес-Хумаран Л.Г., Шатель Дж. М., Сокол Н. и др. Faecalibacterium prausnitzii и здоровье кишечника человека. Curr Opin Microbiol. 2013; 16: 255–61. [PubMed] [Google Scholar] 35.Darfeuille-Michaud A, Boudeau J, Bulois P, Neut C, Glasser AL, Barnich N и др. Высокая распространенность адгезивно-инвазивной кишечной палочки, связанной со слизистой оболочкой подвздошной кишки, при болезни Крона. Гастроэнтерология. 2004; 127: 412–21. [PubMed] [Google Scholar] 36. Розенфельд Г., Бресслер Б. Mycobacterium avium paratuberculosis и этиология болезни Крона: обзор противоречий с точки зрения клинициста. Можно J Гастроэнтерол. 2010; 24: 619–24. [Бесплатная статья PMC] [PubMed] [Google Scholar] 37. Геверс Д., Кугатасан С., Денсон Л.А., Васкес-Баеза И., Ван Треурен В., Рен Б. и др.Микробиом, ранее не получавший лечения, при впервые возникшей болезни Крона. Клеточный микроб-хозяин. 2014; 15: 382–92. [Бесплатная статья PMC] [PubMed] [Google Scholar] 38. Carroll IM, Chang YH, Park J, Sartor RB, Ringel Y. Микробиота кишечника, связанная с просветом и слизистыми оболочками, у пациентов с синдромом раздраженного кишечника с преобладанием диареи. Gut Pathog. 2010; 2:19. [Бесплатная статья PMC] [PubMed] [Google Scholar] 39. Крогиус-Курикка Л., Лира А., Малинен Е., Арникуннас Дж., Туймала Дж., Паулин Л. и др. Анализ микробного сообщества выявляет филогенетические изменения высокого уровня в общей микробиоте желудочно-кишечного тракта у людей, страдающих синдромом раздраженного кишечника с преобладанием диареи.BMC Gastroenterol. 2009; 9: 95. [Бесплатная статья PMC] [PubMed] [Google Scholar] 40. Салонен А., де Вос В.М., Палва А. Желудочно-кишечная микробиота при синдроме раздраженного кишечника: современное состояние и перспективы. Микробиология. 2010; 156: 3205–15. [PubMed] [Google Scholar] 41. Де Пальма Дж., Надаль И., Медина М., Донат Е., Рибес-Конинккс С., Калабуиг М. и др. Дисбактериоз кишечника и уменьшение количества бактерий, покрытых иммуноглобулином, связанных с глютеновой болезнью у детей. BMC Microbiol. 2010; 10: 63. [Бесплатная статья PMC] [PubMed] [Google Scholar] 42.Шен XJ, Ролз JF, Randall T., Burcal L, Mpande CN, Jenkins N, et al. Молекулярная характеристика бактерий, прикрепленных к слизистой оболочке, и ассоциации с колоректальными аденомами. Кишечные микробы. 2010; 1: 138–47. [Бесплатная статья PMC] [PubMed] [Google Scholar] 43. Olivares M, Neef A, Castillejo G, Palma GD, Varea V, Capilla A и др. Генотип HLA-DQ2 выбирает ранний состав кишечной микробиоты у младенцев с высоким риском развития глютеновой болезни. Кишечник. 2014 г. DOI: 10.1136 / gutjnl-2014-306931. [PubMed] [CrossRef] [Google Scholar] 44.Ley RE, Backhed F, Turnbaugh P, Lozupone CA, Knight RD, Gordon JI. Ожирение изменяет микробную экологию кишечника. Proc Natl Acad Sci USA. 2005. 102: 11070–5. [Бесплатная статья PMC] [PubMed] [Google Scholar] 45. Ley RE, Turnbaugh PJ, Klein S, Gordon JI. Микробная экология: микробы кишечника человека, связанные с ожирением. Природа. 2006; 444: 1022–3. [PubMed] [Google Scholar] 46. Collado MC, Isolauri E, Laitinen K, Salminen S. Отличный состав кишечной микробиоты во время беременности у женщин с избыточным и нормальным весом. Am J Clin Nutr.2008; 88: 894–9. [PubMed] [Google Scholar] 47. Дункан С.Х., Лобли Г.Е., Холтроп Дж., Инс Дж., Джонстон А.М., Луис П. и др. Микробиота толстой кишки человека связана с диетой, ожирением и потерей веса. Int J Obes. 2008. 32: 1720–4. [PubMed] [Google Scholar] 48. Каллиомаки М., Колладо М.К., Салминен С., Изолаури Э. Ранние различия в составе фекальной микробиоты у детей могут предсказать избыточный вес. Am J Clin Nutr. 2008; 87: 534–8. [PubMed] [Google Scholar] 49. Надаль I, Сантакруз А., Маркос А., Варнберг Дж., Гарагорри Дж. М., Морено Л. А. и др.Изменения клостридий, бактероидов и фекальных бактерий, покрывающих иммуноглобулин, связанные с потерей веса у подростков с ожирением. Int J Obes. 2009. 33: 758–67. [PubMed] [Google Scholar] 50. Сантакрус А., Маркос А., Варнберг Дж., Марти А., Мартин-Матиллас М., Кампой С. и др. Взаимодействие между потерей веса и составом микробиоты кишечника у подростков с избыточным весом. Ожирение. 2009; 17: 1906–15. [PubMed] [Google Scholar] 51. Schwiertz A, Taras D, Schafer K, Beijer S, Bos NA, Donus C и др. Микробиота и SCFA у здоровых людей с худым и избыточным весом.Ожирение. 2010; 18: 190–5. [PubMed] [Google Scholar] 52. Zhang H, DiBaise JK, Zuccolo A, Kudrna D, Braidotti M, Yu Y и др. Микробиота кишечника человека при ожирении и после желудочного обходного анастомоза. Proc Natl Acad Sci USA. 2009; 106: 2365–70. [Бесплатная статья PMC] [PubMed] [Google Scholar] 53. Cani PD, Bibiloni R, Knauf C, Waget A, Neyrinck AM, Delzenne NM, et al. Изменения микробиоты кишечника контролируют воспаление, вызванное метаболической эндотоксемией, при ожирении и диабете, вызванном диетой с высоким содержанием жиров. Сахарный диабет. 2008; 57: 1470–81.[PubMed] [Google Scholar] 54. Turnbaugh PJ, Ley RE, Mahowald MA, Magrini V, Mardis ER, Gordon JI. Микробиом кишечника, связанный с ожирением, с повышенной способностью собирать энергию. Природа. 2006; 444: 1027–31. [PubMed] [Google Scholar] 55. Бэкхед Ф., Манчестер Дж. К., Семенкович К. Ф., Гордон Дж. Механизмы, лежащие в основе устойчивости к ожирению, вызванному диетой, у стерильных мышей. Proc Natl Acad Sci USA. 2007. 104: 979–84. [Бесплатная статья PMC] [PubMed] [Google Scholar] 56. Ридаура В.К., Фейт Дж. Дж., Рей Ф. Е., Ченг Дж., Дункан А. Э., Кау А. Л. и др.Микробиота кишечника близнецов, не согласных с ожирением, модулирует метаболизм у мышей. Наука. 2013; 341: 1241214. [Бесплатная статья PMC] [PubMed] [Google Scholar] 57. Ларсен Н., Фогенсен Ф.К., ван ден Берг Ф.В., Нильсен Д.С., Андреасен А.С., Педерсен Б.К. и др. Микробиота кишечника взрослых людей с диабетом 2 типа отличается от взрослых людей, не страдающих диабетом. PLoS One. 2010; 5: e9085. [Бесплатная статья PMC] [PubMed] [Google Scholar] 58. Цинь Дж., Ли И, Цай З., Ли С., Чжу Дж., Чжан Ф. и др. Метагеномное ассоциативное исследование микробиоты кишечника при диабете 2 типа.Природа. 2012; 490: 55–60. [PubMed] [Google Scholar] 59. Карлссон Ф. Х., Тремароли В., Нукау И., Бергстром Дж., Бехре С. Дж., Фагерберг Б. и др. Метагеном кишечника у европейских женщин с нормальным, нарушенным и диабетическим контролем уровня глюкозы. Природа. 2013; 498: 99–103. [PubMed] [Google Scholar] 60. Vrieze A, Van Nood E, Holleman F, Salojarvi J, Kootte RS, Bartelsman JF и др. Перенос кишечной микробиоты от худых доноров увеличивает чувствительность к инсулину у людей с метаболическим синдромом. Гастроэнтерология. 2012; 143: 913–16, e7.[PubMed] [Google Scholar] 61. Уокер А.В., Инс Дж., Дункан С.Х., Вебстер Л.М., Холтроп Дж., Зе Х и др. Доминирующие и зависимые от диеты группы бактерий в микробиоте толстой кишки человека. ISME J. 2011; 5: 220–30. [Бесплатная статья PMC] [PubMed] [Google Scholar] 62. Kong LC, Tap J, Aron-Wisnewsky J, Pelloux V, Basdevant A, Bouillot JL и др. Микробиота кишечника после обходного желудочного анастомоза при ожирении человека: повышенное богатство и ассоциации родов бактерий с генами жировой ткани. Am J Clin Nutr. 2013; 98: 16–24. [PubMed] [Google Scholar] 63.Ли СП, Ашрафиан Х., Буэтер М., Кинросс Дж., Сэндс С., Ле Ру К.В. и др. Метаболическая хирургия сильно влияет на обмен веществ между кишечными микробами и хозяевами. Кишечник. 2011; 60: 1214–23. [Бесплатная статья PMC] [PubMed] [Google Scholar] 64. Ли СП, Решат Р., Ву Кью, Ашрафиан Х., Буэтер М., Ле Ру К.В. и др. Экспериментальная бариатрическая хирургия у крыс создает цитотоксическую химическую среду в содержимом кишечника. Front Microbiol. 2011; 2: 183. [Бесплатная статья PMC] [PubMed] [Google Scholar] 65. Windey K, De Preter V, Louat T, Schuit F, Herman J, Vansant G.Модуляция белковой ферментации не влияет на токсичность фекальной воды: рандомизированное перекрестное исследование на здоровых людях. PLoS One. 2012; 7: e52387. DOI: 10.1371 / journal.pone.0052387. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 66. Evenepoel P, Meijers BKI, Bammens BRM, Verbeke K. Уремические токсины, происходящие из кишечного микробного метаболизма. Kidney Int Suppl. 2009; 76: S12 – S9. [PubMed] [Google Scholar] 67. Сирич Т.Л., Мейер Т.В., Гондуин Б., Брюне П., Нива Т. Молекулы, связанные с белками: большая семья с плохим характером.Семин Нефрол. 2014; 34: 106–17. [PubMed] [Google Scholar] 68. Поесен Р., Мейерс Б., Эвенепоэль П. Ободочная кишка: пропущенное место для лечения пациентов на диализе. Semin Dial. 2013; 26: 323–32. [PubMed] [Google Scholar] 69. Neufeld K, Kang N, Bienenstock J, Foster J. Снижение тревожного поведения и центральных нейрохимических изменений у мышей без микробов. Нейрогастроэнтерол Мотил. 2011; 23: 255–64, e119. [PubMed] [Google Scholar] 70. Gaykema R, Goehler LE, Lyte M. Ответ мозга на инфекцию слепой кишки с помощью Campylobacter jejuni: анализ с помощью иммуногистохимии Fos.Иммунное поведение мозга. 2004; 18: 238–45. [PubMed] [Google Scholar] 71. Goehler LE, Gaykema R, Opitz N, Reddaway R, Badr N, Lyte M. Активация афферентов блуждающего нерва и центральных вегетативных путей: ранние реакции на кишечную инфекцию с помощью Campylobacter jejuni. Иммунное поведение мозга. 2005; 19: 334–44. [PubMed] [Google Scholar] 72. Goehler LE, Park SM, Opitz N, Lyte M, Gaykema R. Инфекция Campylobacter jejuni усиливает тревожное поведение в дырочной доске: возможные анатомические субстраты для висцеросенсорной модуляции исследовательского поведения.Иммунное поведение мозга. 2008. 22: 354–66. [Бесплатная статья PMC] [PubMed] [Google Scholar] 73. Lyte M, Li W, Opitz N, Gaykema R, Goehler LE. Индукция тревожного поведения у мышей на начальных этапах заражения возбудителем гиперплазии толстой кишки мышей Citrobacter rodentium. Physiol Behav. 2006; 89: 350–7. [PubMed] [Google Scholar] 74. Ли Х, Цао Ю. Фабрики молочнокислых бактериальных клеток для гамма-аминомасляной кислоты. Аминокислоты. 2010; 39: 1107–16. [PubMed] [Google Scholar] 75. Лайт М. Пробиотики механически действуют как средства доставки нейроактивных соединений: микробная эндокринология при разработке и использовании пробиотиков.Биологические исследования. 2011; 33: 574–81. [PubMed] [Google Scholar] 76. Bravo JA, Forsythe P, Chew MV, Escaravage E, Savignac HM, Dinan TG и др. Проглатывание штамма Lactobacillus регулирует эмоциональное поведение и экспрессию центрального рецептора ГАМК у мыши через блуждающий нерв. Proc Natl Acad Sci USA. 2011; 108: 16050–5. [Бесплатная статья PMC] [PubMed] [Google Scholar] 77. Коллинз Дж., Бороевич Р., Верду Э. Ф., Хейзинга Дж. Д., Ратклифф Э. М.. Кишечная микробиота влияет на раннее постнатальное развитие кишечной нервной системы.Нейрогастроэнтерол Мотил. 2014; 26: 98–107. [PubMed] [Google Scholar] 78. Судо Н., Чида Й., Айба Й., Сонода Дж., Ояма Н., Ю XN и др. Послеродовая микробная колонизация программирует гипоталамо-гипофизарно-надпочечниковую систему на стрессовую реакцию у мышей. J Physiol. 2004; 558: 263–75. [Бесплатная статья PMC] [PubMed] [Google Scholar] 79. Diaz Heijtz R, Wang S, Anuar F, Qian Y, Bjorkholm B, Samuelsson A, et al. Нормальная микробиота кишечника регулирует развитие и поведение мозга. Proc Natl Acad Sci USA. 2011; 108: 3047–52. [Бесплатная статья PMC] [PubMed] [Google Scholar] 80.Hsiao EY, McBride SW, Hsien S, Sharon G, Hyde ER, McCue T. и др. Микробиота модулирует поведенческие и физиологические аномалии, связанные с нарушениями развития нервной системы. Клетка. 2013; 155: 1451–63. [Бесплатная статья PMC] [PubMed] [Google Scholar] 81. Камара Р.Дж., Зиглер Р., Бегре С., Шёпфер А.М., фон Канель Р. Роль психологического стресса в воспалительном заболевании кишечника: оценка качества методов 18 проспективных исследований и предложения для будущих исследований. Пищеварение. 2009. 80: 129–39. [PubMed] [Google Scholar] 82.Модсли Дж., Рэмптон Д. Психологический стресс при ВЗК: новые взгляды на патогенные и терапевтические последствия. Кишечник. 2005; 54: 1481–91. [Бесплатная статья PMC] [PubMed] [Google Scholar] 83. Маес М., Кубера М., Леунис Дж.С., Берк М. Повышенные ответы IgA и IgM против кишечных комменсалов при хронической депрессии: дополнительные доказательства повышенной бактериальной транслокации или повышенной проницаемости кишечника. J влияют на Disord. 2012; 141: 55–62. [PubMed] [Google Scholar] 84. О’Махони Л., Маккарти Дж., Келли П., Херли Дж., Луо Ф., Чен К. и др. Lactobacillus и bifidobacterium при синдроме раздраженного кишечника: реакции симптомов и взаимосвязь с профилями цитокинов.Гастроэнтерология. 2005; 128: 541–51. [PubMed] [Google Scholar] 85. Десбонне Л., Гарретт Л., Кларк Дж., Кили Б., Крайан Дж., Динан Т. Эффекты пробиотика Bifidobacterium infantis в модели депрессии с разделением матерей. Неврология. 2010; 170: 1179–88. [PubMed] [Google Scholar] 86. Мьинт А.М., Ким Ю.К., Веркерк Р., Шарпе С., Стейнбуш Х., Леонард Б. Путь кинуренина при большой депрессии: свидетельства нарушения нейрозащиты. J влияют на Disord. 2007. 98: 143–51. [PubMed] [Google Scholar] 87. Песня C, Ван Х.Цитокины опосредуют воспаление и снижение нейрогенеза на животных моделях депрессии. Prog Neuropsychopharmacol Biol Psychiatry. 2011; 35: 760–8. [PubMed] [Google Scholar] 88. Бентон Д., Уильямс С., Браун А. Влияние употребления молочного напитка, содержащего пробиотик, на настроение и познание. Eur J Clin Nutr. 2006. 61: 355–61. [PubMed] [Google Scholar] 89. Messaoudi M, Lalonde R, Violle N, Javelot H, Desor D, Nejdi A, et al. Оценка психотропных свойств пробиотического препарата (Lactobacillus helveticus R0052 и Bifidobacterium longum R0175) на крысах и людях.Br J Nutr. 2011; 105: 755–64. [PubMed] [Google Scholar] 90. Тиллиш К., Лабус Дж., Килпатрик Л., Цзян З., Пятна Дж., Эбрат Б. и др. Потребление кисломолочного продукта с пробиотиком модулирует деятельность мозга. Гастроэнтерология. 2013; 144: 1394–401. [Бесплатная статья PMC] [PubMed] [Google Scholar] 91. Dapoigny M, Piche T., Ducrotte P, Lunaud B, Cardot J-M, Bernalier-Donadille A. Профиль эффективности и безопасности полной лиофилизированной культуры LCR35 при синдроме раздраженного кишечника: рандомизированное двойное слепое исследование. Мир Дж. Гастроэнтерол.2012; 18: 2067. [Бесплатная статья PMC] [PubMed] [Google Scholar] 92. Уорвелл П.Дж., Альтрингер Л., Морел Дж., Бонд И., Шарбонно Д., О’Махони Л. и др. Эффективность инкапсулированного пробиотика Bifidobacterium infantis 35624 у женщин с синдромом раздраженного кишечника. Am J Gastroenterol. 2006; 101: 1581–90. [PubMed] [Google Scholar] 93. Дикерсон Ф. Б., Сталлингс С., Оригони А., Кацафанас Е., Сэвидж К. Л., Швайнфурт Л. А. и др. Влияние пробиотических добавок на симптомы шизофрении и связь с функционированием желудочно-кишечного тракта: рандомизированное плацебо-контролируемое исследование.Компаньон по первичной помощи при расстройстве ЦНС. 2014; 16: pii, PCC.13m01579. [Бесплатная статья PMC] [PubMed] [Google Scholar] 94. Vaghef-Mehrabany E, Alipour B, Homayouni-Rad A, Sharif S-K, Asghari-Jafarabadi M, Zavvari S. Добавление пробиотиков улучшает воспалительный статус у пациентов с ревматоидным артритом. Питание. 2014; 30: 430–5. [PubMed] [Google Scholar] 95. Gismondo MR, Drago L, Lombardi A. Обзор пробиотиков, доступных для изменения желудочно-кишечной флоры. Int J Antimicrob Agents. 1999; 12: 287–92. [PubMed] [Google Scholar] 96.Вильгельм С.М., Брубакер С.М., Варчак Е.А., Кале-Прадхан ПБ. Эффективность пробиотиков при лечении синдрома раздраженного кишечника. Фармакотерапия. 2008. 28: 496–505. [PubMed] [Google Scholar] 97. Brandt LJ, Aroniadis OC. Обзор трансплантации фекальной микробиоты: техники, показания и результаты. Gastrointest Endosc. 2013; 78: 240–9. [PubMed] [Google Scholar] Дисбиоз

- обзор | Темы ScienceDirect

36.5.2 Дисбиоз

Дисбиоз часто определяют как «дисбаланс» микробного сообщества кишечника, связанный с заболеванием.Этот дисбаланс может быть вызван приростом или потерей членов сообщества или изменениями в относительной численности микробов. Эта теория в первую очередь фокусируется на изменениях в таксономическом составе микробного сообщества и функциях, связанных с отдельными членами или подмножествами членов сообщества. 126 Характеристика дисбиоза традиционно основывалась на таксономических каталогах кишечных микробов, созданных у разных людей в отдельные моменты времени с использованием секвенирования 16S или 18S рРНК. 127 Более поздние попытки были попытаться каталогизировать не виды микробов, а скорее микробные гены в кишечнике с использованием метагеномики дробовика. 128,129 Таксономическая характеристика или генетический состав сообщества затем используется для вывода его функций на основе литературных данных исследований с использованием эталонных штаммов микробов. Обычно эти модельные микробы изучаются как отдельные организмы и часто in vitro, чтобы получить эти функциональные данные.

Огромное количество исследований выявило значительные различия в таксономическом составе кишечных микробных сообществ между пациентами с ВЗК и здоровыми людьми из контрольной группы. 130 Эти различия были выявлены в бактериальном, грибковом и вирусном компонентах сообщества. 131,132 Однако конкретные таксономические различия микробов широко варьируются в зависимости от исследований, и окончательная структура сообщества, связанного с заболеванием, не установлена. Это может быть связано с большими различиями в составе микробного сообщества кишечника среди людей и / или с техническими различиями между исследованиями. Поэтому пока неясно, как определить дисбактериоз и диагностировать «дисбиотическое сообщество».Также неясно, является ли дисбактериоз причиной, следствием или одновременно причиной и следствием заболевания, поскольку воспаление само по себе может приводить к изменениям в составе микробного сообщества в кишечнике. 133

Дисбиоз может вызывать или способствовать развитию ВЗК несколькими способами. Это может привести к появлению одного или нескольких микробов с функциями, вредными для хозяина, или потере одного или нескольких микробов с функциями, полезными для хозяина. Поскольку многие микробы в кишечном сообществе имеют важные функциональные отношения друг с другом, изменения небольшого числа микробов и / или их функций могут иметь широкое влияние на сообщество.Конкретные функции, которые могут представлять интерес, включают изменения доступности ниш или характеристик, которые влияют на принятие или устойчивость колонизации, изменения микробных продуктов или физических характеристик, которые изменяют взаимодействия между бактериями или с хозяином, и изменения в сообществе, которые активируют механизмы вирулентности в в противном случае комменсальные микробы. Наиболее устойчивой характеристикой микробных сообществ больных пациентов является потеря таксономического разнообразия. 134 Однако снова неясно, является ли потеря биоразнообразия в кишечнике причиной или следствием заболевания.Также в настоящее время неясно, как такая потеря разнообразия сама по себе может привести к болезни, тем более что животные-гнотобиоты, колонизированные одним или небольшим количеством микробов, не проявляют болезни, связанной с колонизацией только ограниченным сообществом. Это говорит о том, что конкретные микробы в сообществе и их функции имеют первостепенное значение.

Состав и поведение микробного сообщества чрезвычайно чувствительны к окружающей среде. 9 Среда кишечного микробного сообщества состоит как из компонентов, полученных из организма хозяина, так и из проглоченных веществ.Каждый из этих факторов может иметь огромное влияние на состав и поведение кишечного микробного сообщества. Компоненты, производные от хозяина, определяются генетикой хозяина и, возможно, воздействием диеты или других потребляемых веществ непосредственно на хозяина. Наиболее хорошо охарактеризованными детерминантами состава и поведения микробного сообщества-хозяина являются системы противомикробной защиты хозяина. Когда эти системы нарушаются из-за генетического нокаута отдельных компонентов у модельных животных, возникает дисбиоз. 135 Проглоченное содержимое просвета кишечника в основном происходит с пищей. Вклад диеты в микробный дисбиоз представляет особый интерес для многих исследователей, поскольку ВЗК распространяется вместе с распространением западного образа жизни по всему миру, а западная диета сильно отличается от традиционных диет в незападнических обществах. 136 Пищевые компоненты состоят из макроэлементов, таких как жиры и сахар, микроэлементов, таких как витамины и минералы, и непитательных компонентов, таких как диетические эмульгаторы.Западная диета, как правило, сильно переработана и содержит большое количество насыщенных жиров и простых сахаров. Было показано, что этот тип диеты способствует выработке метаболитов, вредных для тканей хозяина. 137 И наоборот, диета с низким содержанием субстратов, необходимых микробам для выработки метаболитов, способствующих здоровью тканей хозяина, также может способствовать развитию болезней. Например, неперевариваемые пищевые волокна используются микробами для производства короткоцепочечных жирных кислот, а пищевой триптофан используется для производства лигандов арилуглеводородных рецепторов, которые способствуют здоровью кишечника. 95,138 Наконец, диетические эмульгаторы часто добавляют в обработанные пищевые продукты для улучшения их текстуры или стабильности. In vitro эти соединения активируют образование фибр в E. coli , что приводит к прилипанию и повреждению тканей этими обычно комменсальными бактериями. 139 Было показано, что потребление пищевых эмульгаторов in vivo вызывает дисбактериоз и обострение колита у мышей IL-10 - / - . 140 Другие типы экологического стресса, такие как введение антибиотиков, также могут привести к изменениям в микробном сообществе посредством прямого уничтожения микробов или горизонтального переноса генов. 141,142 Экологический стресс также может определять, ведут ли бактериофаги лизогенный или литический образ жизни. 143 Фаг-индуцированный лизис не только убивает бактерии, но и потенциально приводит к инфицированию новых бактериальных мишеней с изменением поведения этих бактерий.

Открытым вопросом в области дисбактериоза является важность того, когда происходят дисбиотические изменения в микробном сообществе. Кесарево сечение приводит к изменениям в ранних стадиях колонизации, а раннее введение антибиотиков может значительно нарушить развивающиеся сообщества. 144 Оба эти фактора были связаны с рядом иммуноопосредованных заболеваний в более позднем возрасте, но окончательных доказательств причинно-следственной связи или понимания механизмов все еще нет. 145 Кроме того, у многих пациентов развивается ВЗК без событий в раннем возрасте, которые могли бы вызвать дисбактериоз. Таким образом, дополнительные неизвестные события могут способствовать раннему, давнему дисбактериозу на момент постановки диагноза ВЗК, или более острые дисбиотические события также могут способствовать развитию ВЗК. Также ожидается, что тип дисбиотического события будет ключевым фактором в том, как дисбактериоз способствует развитию ВЗК.Остается определить, являются ли это широкими изменениями в сообществе или небольшими кардинальными изменениями в конкретных микробах. Эта неопределенность, по крайней мере частично, связана с техническими проблемами, которые могут переоценивать значимость очень распространенных микробов и недооценивать функциональную важность менее многочисленных членов сообщества. Технические ограничения доступных в настоящее время методов и данных также могут переоценить важность известных микробов с установленными функциональными данными по сравнению с неизвестными микробами, которые могут быть столь же важны для болезни.Наконец, до сих пор неизвестно, как дисбактериоз вызывает или способствует развитию ВЗК. Есть некоторые свидетельства того, что определенные дисбиотические микробные сообщества могут вызывать заболевание у нормальных хозяев. 146 Однако есть гораздо более убедительные доказательства того, что дисбактериоз работает в сочетании с дополнительными факторами, такими как лежащая в основе генетическая предрасположенность или повреждение кишечника, вызывающее заболевание. Например, перенос микробных сообществ от пациентов с ВЗК стерильным мышам не вызывает спонтанного колита. 69,70,146 Однако он, по-видимому, способствует развитию заболевания на моделях мышей, предрасположенных к заболеванию, таких как мыши IL-10 - / - или с химической индукцией колита. 69,70,146 Кроме того, дисбактериоз, связанный с диетами западного типа, по-видимому, допускает колонизацию организмами, ассоциированными с ВЗК. Свободные от зародышей мыши, колонизированные микробами от мышей, получавших диету с высоким содержанием жиров и сахара, имеют повышенную восприимчивость к колонизации AIEC. 147 Следовательно, дисбактериоз может по-разному влиять на разных хозяев в зависимости от природы дисбиотического сообщества и лежащих в основе генетической предрасположенности к заболеванию у хозяина.Независимо от того, возникает ли дисбактериоз первым и вызывает заболевание или он является результатом болезни, однажды возникнув, он почти наверняка способствует сохранению болезни.

Микробный дисбиоз тонкого кишечника лежит в основе симптомов, связанных с функциональными желудочно-кишечными расстройствами

Этическое одобрение исследований на людях

Все исследования на людях были одобрены IRB клиники Майо [тестовые образцы (16–006388 и 15–003235), здоровые контрольные (14– 002382 и 15–003603)], и мы соблюдаем все соответствующие этические нормы.Исследование диетического вмешательства было зарегистрировано на сайте ClinicalTrials.gov (NCT03266536). Все субъекты исследования питания дали информированное согласие, тогда как аспираты тонкой кишки были получены из лаборатории клинической микробиологии в соответствии с отказом от согласия IRB для протокола 15–003235. Биологические материалы, полученные от пациентов, не могут быть переданы на основании протокола, одобренного институциональным IRB.

Сбор аспиратов тонкой кишки

Последовательные образцы аспиратов тонкой кишки от пациентов с симптомами после диагностической ФГДС были получены непосредственно из микробиологической лаборатории с мая по декабрь 2016 года.Образцы дуоденального аспирата собирали во время EGD после прямого прохождения в двенадцатиперстную кишку с минимальным раздуванием в желудке с использованием стандартного однопросветного аспирационного катетера, пропущенного через всасывающий порт эндоскопа. Были включены образцы, связанные с пациентами, которые ранее дали согласие на просмотр электронных медицинских карт. Всего за этот промежуток времени было получено 143 аспирата от пациентов с симптомами. После исключения образцов из-за отсутствия согласия или низкой глубины считывания при секвенировании (<1000) было включено в общей сложности 126 пациентов с симптомами.Дуоденальные аспираты, полученные от 38 здоровых добровольцев, участвовавших в других исследованиях и собранные аналогичным образом, также были получены и обработаны аналогичным образом. Клинические метаданные были получены ретроспективным обзором электронной медицинской карты, включая демографическую информацию, ИМТ, клинические показания для тестирования SIBO, количественные результаты аэробных и анаэробных аспиратных культур, курс антибиотиков для лечения SIBO, клинический ответ на антибиотики, необходимость повторного приема антибиотиков, недавние лекарства включая использование антибиотиков и ИПП, операции на желудочно-кишечном тракте, сопутствующие заболевания и т. д.

Критерии диагностики SIBO на основе количественных культур

Аспираты тонкой кишки (10 мкл) наносили штрихами на RBAP (кровяной агар), REMB (грамотрицательная селекционная среда), RBAPA (предварительно восстановленный кровяной агар) и инкубировали в аэробных условиях при 35 ° C, 5% CO. 2 , RIMA (дрожжевая селективная среда) и инкубировали при комнатной температуре и на RCDC (анаэробный кровяной агар), RLKC (замороженная кровь, канамицин, ванкомицин - Prevotella , селекция), RPEA (фенол-спиртовой агар - грамположительный селективный) и инкубировали анаэробно либо в клинической лаборатории, либо в исследовательской лаборатории.Общее количество бактерий (анаэробное плюс аэробное количество) было меньше или больше 10 5 КОЕ / мл, а диагноз SIBO был основан на культуре дуоденального аспирата, демонстрирующей рост бактерий (аэробный, анаэробный) ≥ 10 5 КОЕ / мл или оба) более 48 ч 15,16,17 .

Сравнение культур и секвенирование 16S рРНК

Бактериальная ДНК была извлечена из аспиратов и биопсий двенадцатиперстной кишки с использованием фенол-хлороформа и из стула с использованием набора для экстракции фекальной ДНК MoBio с последующей амплификацией 16 S рРНК с использованием праймеров, совместимых с библиотекой Nextera, фланкирующих V4 гипервариабельная область ([прямое выступание] + 515 F: [TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG] GTGCCAGCMGCCGCGGTAA; и [обратный выступ] + 806 R: [GTCTCGTGGGCTCGGAGATGTGTATA протокол секвенирования 900 с использованием протокола 900 и двойного секвенирования 900 с использованием протокола 900 GGACT и 900).Все образцы секвенировали вместе в режиме парных концов 2 × 300 на приборе Illumina MiSeq с использованием реагентов v3, разработанных Центром геномики Университета Миннесоты.

Сырые последовательности с парными концами были отфильтрованы по качеству, обрезаны адаптером и сшиты с использованием конвейера контроля качества SHI7 35 , с порогом обрезки> 32 и средним показателем качества> 35. Предварительно обработанные считывания анализировались закрытым подбором ссылок с ускоренным механизмом оптимального выравнивания с зазором BURST 36,37 в режиме CAPITALIST против баз данных NCBI RefSeq Targeted Loci Project, посвященных бактериальным и архейным 16 S (https: // www.ncbi.nlm.nih.gov/refseq/targetedloci/) с 97-процентной идентичностью. После фильтрации образцов с низкой глубиной считывания мы приступили к анализу 126 пациентов с симптомами и 38 здоровых людей из контрольной группы. Анализ разнообразия проводился с использованием QIIME v1.9.1 38 , а другие анализы данных, статистические тесты и визуализации были выполнены в R. Для сравнения разнообразия различных типов образцов желудочно-кишечного тракта в исследовании диетических вмешательств последовательности были разрежены до средней глубины. сайта с наименьшим количеством чтений, CLR (центрированное логарифмическое соотношение) - преобразовано после мультипликативной замены и проанализировано с помощью пользовательских сценариев R и пакета «vegan ».

Дифференциальный анализ численности между здоровыми и имеющими симптомы субъектами был выполнен на нормализованных данных численности 39 для каждого таксономического ранга с использованием теста перестановки (1000 перестановок) с t-статистикой в ​​качестве статистики критерия. Перед тестированием к нормированным данным о численности применялось преобразование квадратного корня. Таксоны с распространенностью <10% или максимальной долей <0,2% были исключены из тестирования. Контроль FDR (процедура Бенджамини – Хохберга) выполнялся для каждого таксономического ранга для корректировки множественного тестирования.SI был сгенерирован с использованием классификации случайных лесов на основе нормализованных данных уровня OTU (пакет randomForest в R). Шкала индекса была определена как вероятность отсутствия симптомов классификации пациентов на основе сгенерированной модели. Этот метод предотвращает перетренированность, удерживая выборку для классификации и прогнозируя на основе оставшегося набора данных n -1. Функция Boruta 40 Выбор (пакет Boruta в R) использовался для определения OTU, которые вносят значительный вклад в классификацию.Связи с семью демографическими или клиническими переменными были протестированы с использованием моделей линейной регрессии и скорректированы для множественного тестирования с использованием контроля FDR.

Мы сгенерировали DI с помощью метода CLOUD 24 . Вкратце, матрица расстояний Эйчисона здоровых образцов использовалась в качестве эталонного облака, и расстояние от каждого здорового образца до здорового облака было рассчитано для каждого образца в наборе данных. Затем этот расчет расстояния был повторен для каждой выборки пациентов с симптомами относительно здорового облака; расстояния, превышающие два стандартных отклонения (SD) от среднего значения расстояния до здорового человека, считаются «дисбиотическими»; те, кто находится в пределах 2 SD от среднего значения расстояния до здорового человека, считаются «подобными здоровью».Затем эта оценка дисбактериоза CLOUD была подтверждена с использованием ортогонального подхода, основанного на показателях SI: мы подгоняли показатели SI здоровых людей к распределению шкалы логит (значения SI здорового контроля приблизительно нормальны по шкале logit; p = 0,41, нормальность Шапиро-Уилка контрольная работа). Мы снова применили правило 2 SD, классифицируя образцы с более чем 2 SD от среднего значения распределения здоровых как «дисбиотические», а образцы в пределах 2 SD как «аналогичные здоровым». Чтобы сгенерировать DI здесь, мы затем повторно классифицировали выборки по случайному лесу с использованием новых групповых классификаций и использовали OOB вероятность «дисбиотической» классификации в качестве показателя индекса.Эти два независимых метода находятся в тесном согласии, что оценивается по высокой степени корреляции между показателями ОБЛАЧНОГО дисбиоза в образцах и их индексной оценкой, основанной на вероятности ( r = 0,7, p = 2 × 10 −16 , Корреляции Пирсона). Оценка расстояния в облаке использовалась во всех последующих анализах. Для сравнения мы также сгруппировали данные с использованием спектральной кластеризации, реализованной в пакете R «kernlab» v0.9.27, с использованием двух центров кластеров и настроек по умолчанию 41 .

Вмененные функции из состава микробиоты

Для прогнозирования микробных функций предварительно обработанные считывания ДНК были сопоставлены с версией 13_8 базы данных GreenGenes 16 S рРНК с использованием BURST с идентичностью 97%. Полученные таблицы OTU использовались для создания прогнозируемых аннотаций KEGG с использованием PICRUSt v1.1.3 42 . Размер эффекта линейного дискриминантного анализа (LDA) (LEfSe; Galaxy Version 1.0) 43 затем использовался для выявления предполагаемых функций, которые значительно различались (оценка LDA> 2.0) между группами.

Исследование диетических вмешательств на здоровых добровольцах

Это было пилотное проспективное одноцентровое исследование диетических вмешательств на здоровых добровольцах, изначально потреблявших диету с высоким содержанием клетчатки. Исследование было зарегистрировано на сайте clinictrials.gov под номером NCT03266536. Подходящими участниками были здоровые взрослые (≥ 18 лет) с исходным потреблением клетчатки ≥ 11 г / 1000 калорий / день; <10% дневных калорий из добавленного сахара; ≥ 5 порций фруктов и овощей в день; и ≤ 13% дневных калорий из насыщенных жиров на основе заполненного опросника по частоте приема пищи.Пациенты были исключены из исследования, если они не соответствовали вышеуказанным диетическим требованиям, имели известный диагноз воспалительного заболевания кишечника, микроскопический колит, глютеновую болезнь или другие воспалительные состояния, наличие абдоминальных симптомов на основании исходного анкетного опроса, использование пероральных антибиотиков или пробиотиков в течение последние 4 недели, беременность или планы забеременеть в рамках периода исследования, или любые другие заболевания, состояния или привычки, которые могут помешать завершению исследования. Диетические инструкции и выбор продуктов питания обсуждались на предварительном визите лицензированного диетолога.

Все субъекты прошли скрининг лично или по телефону и заполнили анкету по частоте приема пищи, чтобы убедиться, что они соответствуют критериям включения и исключения. При первичном и последующем посещении им была проведена ФГДС с седацией в сознании. Дуоденальный аспират получали через стандартный отсасывающий катетер, пропускаемый через отсасывающий порт с минимальным надуванием в желудке; аликвота была отправлена ​​в клиническую лабораторию для тестирования на SIBO, а оставшаяся часть хранилась для анализа микробиома при -80 ° C.Было получено восемь биопсий двенадцатиперстной кишки для исследований камеры Уссинга, анализа микробиома и последовательности РНК хозяина. При первоначальном и последующем посещении участники заполнили симптоматическую и демографическую анкету и предоставили образец стула. Симптомы, оцениваемые с помощью анкет, включали: частоту стула, натуживание, неполное опорожнение, твердый / комковатый стул, боль в животе, связанную с дефекацией, диарею / жидкий водянистый стул, вздутие живота, затруднения глотания, тошноту / рвоту, изжогу, усталость и аппетит.Ответы записывались в двоичном формате (да / нет). В рамках вмешательства все участники соблюдали 7-дневную стандартизированную диету с типичным для США распределением макроэлементов калорий: 50% из углеводов, 35% из жиров и 15% из белка. Диета была с низким содержанием клетчатки (<10 г / 1000 калорий / день) и высоким содержанием простого сахара (≥ 50% дневных углеводов).

Статистический анализ мощности

Мы выполнили апостериорный расчет мощности для сравнения микробиома между здоровыми и симптоматическими субъектами, сосредоточив внимание на силе дифференциального анализа численности, где у нас была гораздо более низкая статистическая мощность по сравнению с анализами альфа- и бета-разнообразия. , из-за многократной коррекции тестирования.Мы использовали сетевой калькулятор мощности микробиома для проведения анализа мощности (http://fedematt.shinyapps.io/shinyMB/), который был основан на моделировании Монте-Карло и тесте Уилкоксона – Манна – Уитни 44 . Мы использовали коэффициент ложного обнаружения 5%, чтобы исправить множественное тестирование. Предполагая, что мы тестируем 65 родов, при этом численность 10 родов с умеренной численностью (6–15 ранги) снижается на 50% у пациентов с симптомами (по сравнению с 26 дифференциальными родами со средним снижением на 59% в наблюдаемых данных), мы имели средняя мощность 75% для обнаружения этих 10 дифференциальных родов и мощность 100% для обнаружения хотя бы одного значимого рода при текущем размере выборки.Таким образом, исследование было достаточно мощным, чтобы обнаружить умеренную разницу таксонов при сравнении здоровых субъектов и субъектов с симптомами.

Ex vivo функция эпителиального барьера

Исследования камеры Уссинга были выполнены для измерения барьерной функции слизистой оболочки двенадцатиперстной кишки и секреторных ответов, как было описано ранее 45 . Вкратце, биопсии двенадцатиперстной кишки помещали в камеры Уссинга объемом 4 мл (Physiologic Instruments, Сан-Диего, Калифорния), экспонируя 0,031 см области 2 в течение 45 минут после сбора.Камеры были заполнены Кребсом с 10 мм маннитом (сторона слизистой оболочки) и Кребсом с 10 мм глюкозы (подслизистая сторона). Базовое трансэпителиальное сопротивление и ток короткого замыкания каждой ткани измеряли с использованием пары электродов Ag / AgCl с агар-солевыми мостиками и пары токоподводящих платиновых электродов для поддержания условий фиксации напряжения. Парацеллюлярный поток через биопсии измеряли с использованием 4 кДа FITC-декстрана, вводимого на слизистую (концентрация в камере 1 мг / мл). Отбор образцов производился со стороны подслизистой оболочки каждые 30 минут в течение всего 3 часов, и кумулятивная флуоресценция измерялась с помощью Multi-Mode Microplate Reader (BioTek, VT) и преобразовывалась в концентрацию с использованием стандартных кривых.Кумулятивный поток в конце 3 ч был рассчитан для FITC – декстрана. Корреляции Спирмена (непараметрические) использовались для проверки связи между разнообразием микробиома и потоком FITC – декстрана.

RNA seq

Образцы биопсии размораживали на льду, гомогенизировали и центрифугировали при 13000 об / мин, а супернатант переносили в новую пробирку. РНК получали с использованием набора RNeasy Mini Kit (QIAGEN, Hilden, Германия) и секвенировали на Illumina HiSeq 2500. Анализ данных выполняли с использованием Mayo Analysis Pipeline for RNA Sequencing (MAP-RSeq) с выравниванием по строению генома человека (GRCh48.78) 46 . Вкратце, конвейер MAP-RSeq выполняет оценку качества чтения последовательностей из файла FASTQ, выравнивает оставшиеся считывания с TopHat 47 , а количество генов агрегируется с библиотекой Python HTSeq 48 . Средняя общая глубина считывания составила 57 052 ​​595 (стандартное отклонение 8,5 × 10 6 ) и в среднем 87,0% (стандартное отклонение 2,0%) от общего числа считываний, сопоставленных с моделями генов. Условная квантильная нормализация была выполнена для учета длины гена и смещений содержания GC 49 .

1 Подготовка образцов метаболомики H-ЯМР

Образцы аспирата центрифугировали при 4 ° C и 12000 × g в течение 5 мин. 162 мкл супернатанта смешивали с 18 мкл буфера ЯМР (1,5 мкл KH 2 PO 4 , 1 г / л TSP и 0,13 г / л NaN 3 , Sigma-Aldrich) и переносили в Трубка для ЯМР 3 мм. Образцы фекалий предварительно взвешивали (~ 100 мг), рандомизировали и помещали в пробирку с завинчивающейся крышкой, содержащую 50 мг 1.Циркониевые шарики диаметром 0 мм, к которым было добавлено 400 мкл ACN: H 2 O (1: 3). Пробирку помещали в миксер Biospec на 30 с. Затем гомогенизированный образец центрифугировали в течение 20 мин при 16000 × g . Супернатант осторожно переносили в пробирки с центрифугированием и центрифугировали в течение 30 мин при 16000 × g . 80 мкл отфильтрованной фекальной воды вносили аликвотами в 96-луночный планшет и 10 мкл использовали для контроля качества. Отфильтрованную фекальную воду в 96-луночном планшете сушили в токе азота перед восстановлением 540 мкл D 2 O (Sigma-Aldrich) и 60 мкл буфера ЯМР.Восстановленную фекальную воду и буферную смесь переносили в 5-миллиметровые экспериментальные пробирки для ЯМР.

1 H-ЯМР эксперимент

Метаболические профили измеряли на спектрометре Bruker 600 МГц (Bruker Biospin, Rheinstetten, Германия), установленном на постоянную температуру 300 К для образцов мочи, аспирата и фекалий и 310 К для образцов плазмы. Стандартный одномерный эксперимент NOSY был выполнен для каждого образца мочи, аспирата и фекальной воды, а эксперимент CPMG - для образцов плазмы.Всего было выполнено 64 сканирования для каждого образца в 64 тыс. Точек данных для мочи, аспиратов и плазмы; Было собрано 128 сканирований на образец в 64 тыс. Точек данных для фекальной воды.

1 Предварительная обработка данных H-ЯМР

Данные спектров были импортированы в MATLAB (версия 8.3.0.532 R2014a, Mathworks Inc, Натик, Массачусетс, США). Для следующих исполнений использовалась серия сценариев собственной разработки. Фазирование, корректировка базовой линии и спектральная калибровка до TSP (0 ppm).Спектры выравнивались вручную. Чтобы учесть разницу в концентрации образцов, к образцам была применена нормализация вероятностного коэффициента. Собственные скрипты использовались для построения моделей PCA и OPLS-DA и интеграции интересующих пиков. Корреляции характеристик и тенденции были проанализированы в R.

Сводка отчетов

Дополнительная информация о дизайне исследования доступна в Сводке отчетов по исследованиям природы, связанной с этой статьей.

Дисбактериоз кишечника новорожденных | Журнал перинатологии

  • 1.

    Домингес-Белло MG, Годой-Виторино F, Knight R, Blaser MJ. Роль микробиома в развитии человека. Кишечник. 2019; 68: 1108–14.

    CAS PubMed PubMed Central Google Scholar

  • 2.

    Генсоллен Т., Айер С.С., Каспер Д.Л., Блумберг Р.С. Как колонизация микробиотой в раннем возрасте формирует иммунную систему. Наука. 2016; 352: 539–44.

    CAS PubMed PubMed Central Google Scholar

  • 3.

    Ayres JS. Совместное поведение микробной толерантности в мутуализме микробиоты хозяина. Клетка. 2016; 165: 1323–31.

    CAS PubMed PubMed Central Google Scholar

  • 4.

    Санчес К.К., Чен Г.Й., Шибер AMP, Редфорд С.Е., Шохирев М.Н., Леблан М. и др. Совместная метаболическая адаптация хозяина может способствовать бессимптомной инфекции и способствовать снижению вирулентности кишечного патогена. Клетка. 2018; 175: 146–58.e15.

    CAS PubMed PubMed Central Google Scholar

  • 5.

    Сорбара МТ, Памер Э.Г. Межбактериальные механизмы устойчивости к колонизации и стратегии, используемые патогенами для их преодоления. Mucosal Immunol. 2019; 12: 1–9.

    CAS PubMed PubMed Central Google Scholar

  • 6.

    Ко А., Бэкхед Ф. От ассоциации к причинной связи: роль микробиоты кишечника и ее функциональных продуктов в метаболизме хозяина. Mol Cell. 2020; 78: 584–96.

    CAS PubMed PubMed Central Google Scholar

  • 7.

    Gevers D, Kugathasan S, Denson LA, Vazquez-Baeza Y, Van Treuren W., Ren B, et al. Микробиом, ранее не получавший лечения, при впервые возникшей болезни Крона. Клетка. Хост-микроб. 2014; 15: 382–92.

    CAS PubMed PubMed Central Google Scholar

  • 8.

    Клингберг Э., Магнуссон М.К., Стрид Х., Демингер А., Шталь А., Сундин Дж. И др. Различный состав микробиоты кишечника у пациентов с анкилозирующим спондилитом связан с повышенным уровнем кальпротектина в кале.Arthritis Res Ther. 2019; 21: 248.

    CAS PubMed PubMed Central Google Scholar

  • 9.

    Фалони Дж., Джусенс М., Виейра-Силва С., Ван Дж., Дарзи Й., Фауст К. и др. Популяционный анализ изменчивости микробиома кишечника. Наука. 2016; 352: 560–4.

    CAS PubMed PubMed Central Google Scholar

  • 10.

    Яцуненко Т.Р., Манари М.Дж., Трехан И., Домингес-Белло М.Г., Контрерас М., Магрис М. и др.Микробиом кишечника человека в зависимости от возраста и географии. Природа 2012; 486: 222–7.

    CAS PubMed PubMed Central Google Scholar

  • 11.

    Биттингер К., Чжао С., Ли И, Форд Э, Фридман Э.С., Ни Дж. И др. Бактериальная колонизация перепрограммирует метаболом кишечника новорожденных. Nat Microbiol. 2020; 5: 838–47.

    CAS PubMed PubMed Central Google Scholar

  • 12.

    Vangay P, Ward T, Gerber JS, Knights D. Антибиотики, детский дисбактериоз и болезни. Клетка. Хост-микроб. 2015; 17: 553–64.

    CAS PubMed PubMed Central Google Scholar

  • 13.

    Deshmukh HS, Liu Y, Menkiti OR, Mei J, Dai N, O’Leary CE, et al. Микробиота регулирует гомеостаз нейтрофилов и устойчивость хозяина к сепсису Escherichia coli K1 у новорожденных мышей. Nat Med. 2014; 20: 524–30.

    CAS PubMed PubMed Central Google Scholar

  • 14.

    Грачи MG, Гарретт WS. Кишечник. микробиота, метаболиты и иммунитет хозяина. Nat Rev Immunol. 2016; 16: 341–52.

    CAS PubMed PubMed Central Google Scholar

  • 15.

    Olszak T, An D, Zeissig S, Vera MP, Richter J, Franke A, et al. Воздействие микробов в молодом возрасте оказывает стойкое влияние на функцию естественных Т-киллеров. Наука. 2012; 336: 489–93.

    CAS PubMed PubMed Central Google Scholar

  • 16.

    Cox LM, Yamanishi S, Sohn J, Alekseyenko AV, Leung JM, Cho I, et al. Изменение кишечной микробиоты во время критического периода развития имеет долгосрочные метаболические последствия. Клетка. 2014; 158: 705–21.

    CAS PubMed PubMed Central Google Scholar

  • 17.

    Кимура И., Миямото Дж., Оуэ-Китано Р., Ватанабе К., Ямада Т., Онуки М. и др. Микробиота кишечника матери во время беременности влияет на метаболический фенотип потомства у мышей.Наука. 2020; 367: eaaw8429.

    CAS PubMed PubMed Central Google Scholar

  • 18.

    Гордон Х.А., Пести Л. Животное-гнотобиотическое животное как инструмент в изучении микробных взаимоотношений хозяина. Бактериол. Ред. 1971; 35: 390–429.

    CAS PubMed PubMed Central Google Scholar

  • 19.

    Лучински П., Маквей Нойфельд К.А., Ориач К.С., Кларк Дж., Динан Т.Г., Крайан Дж. Ф.Выращивание в пузыре: использование стерильных животных для оценки влияния микробиоты кишечника на мозг и поведение. Int J Neuropsychopharmacol. 2016; 19: pyw020.

    PubMed PubMed Central Google Scholar

  • 20.

    Уилкс М. Бактерии и раннее развитие человека. Early Hum Dev. 2007; 83: 165–70.

    PubMed PubMed Central Google Scholar

  • 21.

    Гериг Дж. Л., Венкатеш С., Чанг Х. В., Хибберд М. С., Кунг В. Л., Ченг Дж. И др.Влияние продуктов, содержащих микробиоту, на животных-гнотобиотов и детей с недостаточным питанием. Наука. 2019; 365: eaau4732.

    PubMed PubMed Central Google Scholar

  • 22.

    Turnbaugh PJ, Ley RE, Mahowald MA, Magrini V, Mardis ER, Gordon JI. Микробиом кишечника, связанный с ожирением, с повышенной способностью собирать энергию. Природа. 2006; 444: 1027–31.

    PubMed PubMed Central Google Scholar

  • 23.

    Safari Z, Джерард П. Связь между микробиомом кишечника и неалкогольной жировой болезнью печени (НАЖБП). Клетка. Mol Life Sci. 2019; 76: 1541–58.

    CAS PubMed PubMed Central Google Scholar

  • 24.

    Цзян Ц., Ли Дж., Хуанг П., Лю З., Чжао Б. Микробиота кишечника и болезнь Альцгеймера. J. Alzheimers Dis. 2017; 58: 1–15.

    PubMed PubMed Central Google Scholar

  • 25.

    Lee YP, Chiu CC, Lin TJ, Hung SW, Huang WC, Chiu CF, et al. Моноколонизация мышей без микробов с помощью Bacteroides fragilis улучшает индуцированный азоксиметаном / декстрансульфатом натрия колоректальный рак, вызванный колитом. Immunopharmacol Immunotoxicol. 2019; 41: 207–13.

    CAS PubMed PubMed Central Google Scholar

  • 26.

    Tissier H. Recherches sur la flore кишечника дез nourrissons. C R Mem Soc Biol. 1899; 51: 943.

    Google Scholar

  • 27.

    Logan WR. Кишечная флора младенцев и детей раннего возраста. J Pathol. 1913; 18: 527–51.

    Google Scholar

  • 28.

    Гарридо Д., Бариле Д., Миллс Д.А. Молекулярная основа обогащения бифидобактериями желудочно-кишечного тракта младенцев. Adv Nutr. 2012; 3: 415С – 21С.

    CAS PubMed PubMed Central Google Scholar

  • 29.

    Ruiz-Moyano S, Totten SM, Garrido DA, Smilowitz JT, German JB, Lebrilla CB, et al.Различия в потреблении олигосахаридов грудного молока младенческими кишечными штаммами Bifidobacterium breve. Appl Environ Microbiol. 2013; 79: 6040–9.

    CAS PubMed PubMed Central Google Scholar

  • 30.

    Живкович AM, German JB, Lebrilla CB, Mills DA. Гликобиом грудного молока и его влияние на микробиоту желудочно-кишечного тракта младенцев. Proc Natl Acad Sci USA. 2011; 108 (Приложение 1): 4653–8.

    CAS Google Scholar

  • 31.

    Хенрик Б.М., Хаттон А.А., Палумбо М.С., Касабури Г., Митчелл Р.Д., Андервуд М.А. и др. Повышенный pH кала указывает на глубокое изменение микробиома кишечника грудного ребенка из-за сокращения бифидобактерий за последнее столетие. мСфера. 2018; 3: e00041–18.

    PubMed PubMed Central Google Scholar

  • 32.

    Litvak Y, Byndloss MX, Tsolis RM, Baumler AJ. Распространение дисбиотических протеобактерий: микробный признак дисфункции эпителия.Curr Opin Microbiol. 2017; 39: 1–6.

    CAS Google Scholar

  • 33.

    Milani C, Duranti S, Bottacini F, Casey E, Turroni F, Mahony J, et al. Первые микробные колонизаторы кишечника человека: состав, деятельность и последствия для здоровья микробиоты кишечника младенца. Microbiol Mol Biol Rev.2017; 81: e00036-17.

    PubMed PubMed Central Google Scholar

  • 34.

    La Rosa PS, Warner BB, Zhou Y, Weinstock GM, Sodergren E, Hall-Moore CM и др. Структурированное развитие бактериальных популяций в кишечнике недоношенных детей. Proc Natl Acad Sci USA. 2014; 111: 12522–7.

    Google Scholar

  • 35.

    Korpela K, Blakstad EW, Moltu SJ, Strommen K, Nakstad B, Ronnestad AE, et al. Развитие кишечной микробиоты и гестационный возраст у недоношенных новорожденных. Научный доклад 2018; 8: 2453.

    PubMed PubMed Central Google Scholar

  • 36.

    Ватанен Т., Плихта Д.Р., Сомани Дж., Мунк П.С., Артур Т.Д., Холл А.Б. и др. Геномная изменчивость и штамм-специфическая функциональная адаптация микробиома кишечника человека в раннем возрасте. Nat Microbiol. 2019; 4: 470–9.

    CAS Google Scholar

  • 37.

    Raman AS, Gehrig JL, Venkatesh S, Chang HW, Hibberd MC, Subramanian S, et al. Единица разреженного коваринга, которая описывает развитие здоровой и нарушенной микробиоты кишечника человека. Наука. 2019; 365: eaau4735.

    PubMed PubMed Central Google Scholar

  • 38.

    Younge NE, Newgard CB, Cotten CM, Goldberg RN, Muehlbauer MJ, Bain JR, et al. Нарушение созревания микробиоты и метаболома у крайне недоношенных детей с послеродовой задержкой роста. Научный доклад 2019; 9: 8167.

    PubMed PubMed Central Google Scholar

  • 39.

    Лю Дж, Ли Й, Фэн Й, Пан Л, Се З, Ян З и др.Структурированное прогрессирование кишечной микробиоты, связанное с некротическим энтероколитом и поздним сепсисом у недоношенных детей: проспективное исследование в отделении интенсивной терапии новорожденных в Китае. PeerJ. 2019; 7: e7310.

    PubMed PubMed Central Google Scholar

  • 40.

    Галаццо Дж., Ван Бест Н., Бервоетс Л., Дапаа И.О., Савелкул PH, Хорнеф М.В. и др. Развитие микробиоты и ассоциации с режимом рождения, диетой и атопическими расстройствами в продольном анализе образцов стула, собранных с младенчества до раннего детства.Гастроэнтерология. 2020; 158: 1584–96.

    CAS Google Scholar

  • 41.

    Madan JC, Hoen AG, Lundgren SN, Farzan SF, Cottingham KL, Morrison HG, et al. Связь кесарева сечения и добавления смеси с кишечным микробиомом 6-недельных младенцев. JAMA Pediatr. 2016; 170: 212–9.

    PubMed PubMed Central Google Scholar

  • 42.

    Стюарт С.Дж., Аджами, штат Нью-Джерси, О’Брайен Д.Л., Хатчинсон Д.С., Смит Д.П., Вонг М.С. и др.Временное развитие микробиома кишечника в раннем детстве по данным исследования TEDDY. Природа. 2018; 562: 583–8.

    CAS PubMed PubMed Central Google Scholar

  • 43.

    Combellick JL, Shin H, Shin D, Cai Y, Hagan H, Lacher C и др. Различия в фекальной микробиоте новорожденных, рожденных дома или в больнице. Научный доклад 2018; 8: 15660.

    PubMed PubMed Central Google Scholar

  • 44.

    Savage JH, Lee-Sarwar KA, Sordillo JE, Lange NE, Zhou Y, O’Connor GT и др. Диета во время беременности и младенчества и микробиом кишечника младенца. J Pediatr. 2018; 203: 47–54.e4.

    PubMed PubMed Central Google Scholar

  • 45.

    Лундгрен С.Н., Мадан Дж. К., Эмонд Дж. А., Моррисон Х. Г., Кристенсен BC, Карагас М. Р. и др. Диета матери во время беременности связана с микробиомом детского стула в зависимости от способа родов.Микробиом. 2018; 6: 109.

    PubMed PubMed Central Google Scholar

  • 46.

    Уильямс Дж. Э., Карротерс Дж. М., Лаки К. А., Битти Н. Ф., Брукер С. Л., Петерсон Х. К. и др. Между молочным, оральным и фекальным микробиомами в диадах мать-младенец существуют сильные многомерные отношения в течение первых шести месяцев после родов. J Nutr. 2019; 149: 902–14.

    PubMed PubMed Central Google Scholar

  • 47.

    Азад М.Б., Конья Т., Персо Р.Р., Гутман Д.С., Чари Р.С., Филд С.Дж. и др. Влияние антибиотиков во время родов, методов родов и грудного вскармливания на микробиоту кишечника в течение первого года жизни: проспективное когортное исследование. Int J Obstet Gynaecol. 2016; 123: 983–93.

    CAS Google Scholar

  • 48.

    Coker MO, Hoen AG, Dade E, Lundgren S, Li Z, Wong AD, et al. Конкретный класс антибиотиков во время родов связан с созреванием микробиоты кишечника младенца: проспективное когортное исследование.Int J Obstet Gynaecol. 2020; 127: 217–27.

    CAS Google Scholar

  • 49.

    Eck A, Rutten N, Singendonk MMJ, Rijkers GT, Savelkoul PHM, Meijssen CB, et al. Развитие микробиоты новорожденных и действие антибиотиков в раннем возрасте определяется двумя разными типами поселенцев. PloS ONE. 2020; 15: e0228133.

    CAS PubMed PubMed Central Google Scholar

  • 50.

    Гупта Р.В., Тран Л., Норори Дж., Феррис М.Дж., Эрен А.М., Тейлор С.М. и др. Блокаторы рецепторов гистамина-2 изменяют фекальную микробиоту у недоношенных детей. J Pediatr Gastroenterol Nutr. 2013; 56: 397–400.

    CAS Google Scholar

  • 51.

    Леви Э.И., Хоанг Д.М., Ванденплас Й. Влияние ингибиторов протонной помпы на микробиом у маленьких детей. Acta Paediatr. 2020; 109: 1531–8.

    CAS Google Scholar

  • 52.

    Vich Vila A, Collij V, Sanna S, Sinha T, Imhann F, Bourgonje AR, et al. Влияние часто используемых лекарств на состав и метаболическую функцию микробиоты кишечника. Nat Commun. 2020; 11: 362.

    CAS PubMed PubMed Central Google Scholar

  • 53.

    Jackson MA, Verdi S, Maxan ME, Shin CM, Zierer J, Bowyer RCE и др. Связь кишечной микробиоты с распространенными заболеваниями и лекарствами, отпускаемыми по рецепту, в популяционной когорте.Nat Commun. 2018; 9: 2655.

    PubMed PubMed Central Google Scholar

  • 54.

    Iszatt N, Janssen S, Lenters V, Dahl C, Stigum H, Knight R, et al. Экологические токсиканты в грудном молоке норвежских матерей, а также состав и метаболиты кишечных бактерий у их младенцев в возрасте 1 месяца. Микробиом 2019; 7: 34.

    PubMed PubMed Central Google Scholar

  • 55.

    Лауэ Х.Э., Моройши Ю., Джексон Б.П., Палис Т.Дж., Мадан Дж.К., Карагас МР.Смеси питательных и токсичных элементов и микробиом кишечника в раннем постнатальном периоде в когорте продольных рождений в США. Environ Int. 2020; 138: 105613.

    CAS Google Scholar

  • 56.

    Маклин К., Джун С., Козырский А. Влияние курения матери на микробиоту кишечника младенца и его связь с избыточным весом ребенка: обзорный обзор. Мир J Pediatr. 2019; 15: 341–9.

    Google Scholar

  • 57.

    Tun HM, Konya T, Takaro TK, Brook JR, Chari R, Field CJ и др. Контакт с домашними пушистыми домашними животными влияет на микробиоту кишечника младенца в 3-4 месяца после различных сценариев рождения. Микробиом. 2017; 5: 40.

    PubMed PubMed Central Google Scholar

  • 58.

    D’Agata AL, Wu J, Welandawe MKV, Dutra SVO, Kane B, Groer MW. Влияние стресса ОИТН в раннем возрасте на развивающийся микробиом кишечника. Dev Psychobiol. 2019; 61: 650–60.

    PubMed PubMed Central Google Scholar

  • 59.

    Ho TTB, Groer MW, Kane B., Yee AL, Torres BA, Gilbert JA, et al. Дихотомическое развитие микробиома кишечника у недоношенных детей. Микробиом. 2018; 6: 157.

    PubMed PubMed Central Google Scholar

  • 60.

    Parra-Llorca A, Gormaz M, Alcantara C, Cernada M, Nunez-Ramiro A, Vento M и др. Микробиом кишечника недоношенных в зависимости от типа кормления: значение донорского грудного молока.Front Microbiol. 2018; 9: 1376.

    PubMed PubMed Central Google Scholar

  • 61.

    Taft DH, Salinero LK, Vongbhavit K, Kalanetra KM, Masarweh C, Yu A, et al. Бактериальная колонизация и гены устойчивости к противомикробным препаратам в трубках для энтерального питания новорожденных. FEMS Microbiol Ecol. 2019; 95: физ039.

    CAS PubMed PubMed Central Google Scholar

  • 62.

    Ногачка А., Салазар Н., Суарес М., Милани С., Арболея С., Солис Г. и др.Влияние антимикробной профилактики во время родов на микробиоту кишечника и распространенность генов устойчивости к антибиотикам у доношенных новорожденных, родившихся через естественные родовые пути. Микробиом. 2017; 5: 93.

    PubMed PubMed Central Google Scholar

  • 63.

    Гаспаррини А.Дж., Крофтс Т.С., Гибсон М.К., Тарр П.И., Уорнер Б.Б., Дантас Г. Нарушение антибиотиками микробиома кишечника недоношенных детей и резистома. Кишечные микробы. 2016; 7: 443–9.

    CAS PubMed PubMed Central Google Scholar

  • 64.

    Гибсон М.К., Ван Б., Ахмади С., Бернхэм Калифорния, Тарр П.И., Уорнер Б.Б. и др. Динамика развития микробиоты кишечника недоношенных новорожденных и резистома к антибиотикам. Nat Microbiol. 2016; 1: 16024.

    CAS PubMed PubMed Central Google Scholar

  • 65.

    Rutayisire E, Huang K, Liu Y, Tao F. Способ родов влияет на разнообразие и характер колонизации кишечной микробиоты в течение первого года жизни младенцев: систематический обзор.BMC Gastroenterol. 2016; 16:86.

    PubMed PubMed Central Google Scholar

  • 66.

    Dahl C, Stigum H, Valeur J, Iszatt N, Lenters V, Peddada S, et al. У недоношенных новорожденных есть различные микробиомы, которые не объясняются способом родов, продолжительностью грудного вскармливания или воздействием антибиотиков. Int J Epidemiol. 2018; 47: 1658–69.

    PubMed PubMed Central Google Scholar

  • 67.

    Tun MH, Tun HM, Mahoney JJ, Konya TB, Guttman DS, Becker AB. и другие. Послеродовое воздействие бытовых дезинфицирующих средств, микробиоты кишечника младенцев и последующий риск избыточного веса у детей. Can Med Assoc J. 2018; 190: E1097 – e107.

    Google Scholar

  • 68.

    Шоу К.А., Берта М., Хофмеклер Т., Чопра П., Ватанен Т., Шриватса А. и др. Дисбактериоз, воспаление и реакция на лечение: продольное исследование педиатрических субъектов с недавно диагностированным воспалительным заболеванием кишечника.Genome Med. 2016; 8: 75.

    PubMed PubMed Central Google Scholar

  • 69.

    Xia GH, You C, Gao XX, Zeng XL, Zhu JJ, Xu KY, et al. Индекс дисбактериоза инсульта (SDI) в микробиоме кишечника связан с травмой головного мозга и прогнозом инсульта. Фронт Neurol. 2019; 10: 397.

    PubMed PubMed Central Google Scholar

  • 70.

    Го Й, Чжан И, Герхард М., Гао Дж. Дж., Мехиас-Луке Р., Чжан Л. и др.Влияние Helicobacter pylori на микробиоту желудочно-кишечного тракта: популяционное исследование в Linqu, зоне высокого риска рака желудка. Кишечник. 2019. https://doi.org/10.1136/gutjnl-2019-319696.

  • 71.

    Casen C, Vebo HC, Sekelja M, Hegge FT, Karlsson MK, Ciemniejewska E, et al. Отклонения в микробиоте кишечника человека: новый диагностический тест для определения дисбактериоза у пациентов с СРК или ВЗК. Пищевая Pharmacol Therap. 2015; 42: 71–83.

    CAS Google Scholar

  • 72.

    Мандл Т., Марсал Дж., Олссон П., Олссон Б., Андреассон К. Тяжелый кишечный дисбактериоз распространен при первичном синдроме Шегрена и связан с системной активностью заболевания. Arthritis Res Ther. 2017; 19: 237.

    PubMed PubMed Central Google Scholar

  • 73.

    Ватанен Т., Костич А.Д., д'Хеннезель Э., Сильяндер Х., Франзоса Э.А., Яссур М. и др. Вариабельность иммуногенности ЛПС микробиома способствует развитию аутоиммунитета у людей.Клетка. 2016; 165: 842–53.

    CAS PubMed PubMed Central Google Scholar

  • 74.

    Ватанен Т., Франзоза Э.А., Швагер Р., Трипати С., Артур Т.Д., Вехик К. и др. Микробиом кишечника человека при диабете типа 1 с ранним началом из исследования TEDDY. Природа. 2018; 562: 589–94.

    CAS PubMed PubMed Central Google Scholar

  • 75.

    Chua HH, Chou HC, Tung YL, Chiang BL, Liao CC, Liu HH и др.Дисбактериоз кишечника с обилием ruminococcus gnavus ассоциируется с аллергическими заболеваниями у младенцев. Гастроэнтерология. 2018; 154: 154–67.

    PubMed PubMed Central Google Scholar

  • 76.

    Lee MJ, Kang MJ, Lee SY, Lee E, Kim K, Won S, et al. Нарушения генов микробиома кишечника у младенцев с атопическим дерматитом в зависимости от типа вскармливания. J Allergy Clin Immunol. 2018; 141: 1310–9.

    CAS PubMed PubMed Central Google Scholar

  • 77.

    Ламонт РФ, Моллер Люф Б., Стенер Йоргенсен Дж. Воспалительные заболевания и нарушение обмена веществ у детей после воздействия антибиотиков во время беременности, антенатального, интранатального и неонатального периода. F1000Res. 2020; 9: 144.

    Google Scholar

  • 78.

    Доухауэр Карпа К., Пол И.М., Леки Дж. А., Шунг С., Каркачи-Салли Н., Врана К. Е. и др. Обзор ретроспективной карты для выявления перинатальных факторов, связанных с пищевой аллергией. Нутр Дж. 2012; 11: 87.

    PubMed PubMed Central Google Scholar

  • 79.

    Metz TD, McKinney J, Allshouse AA, Knierim SD, Carey JC, Heyborne KD. Воздействие стрептококковой антибиотикопрофилактики группы B и индекс массы тела в раннем детстве в когорте вагинальных родов. J Matern Fetal Neonatal Med. 2020; 33: 3318–3323.

    PubMed PubMed Central Google Scholar

  • 80.

    Wohl DL, Curry WJ, Mauger D, Miller J, Tyrie K. Антибиотики во время родов и детский атопический дерматит. J Am Board Fam Med. 2015; 28: 82–9.

    PubMed PubMed Central Google Scholar

  • 81.

    Памми М., Коуп Дж., Тарр П.И., Уорнер Б.Б., Морроу А.Л., Май В. и др. Дисбактериоз кишечника у недоношенных детей, предшествующий некротическому энтероколиту: систематический обзор и метаанализ. Микробиом. 2017; 5:31.

    PubMed PubMed Central Google Scholar

  • 82.

    Olm MR, Bhattacharya N, Crits-Christoph A, Firek BA, Baker R, Song YS, et al.Некротическому энтероколиту предшествует усиленная репликация кишечных бактерий, клебсиелл и бактерий, кодирующих фимбрии. Sci Adv. 2019; 5: eaax5727.

    CAS PubMed PubMed Central Google Scholar

  • 83.

    Esmaeilizand R, Shah PS, Seshia M, Yee W, Yoon EW, Dow K. Воздействие антибиотиков и развитие некротического энтероколита у очень недоношенных новорожденных. Педиатр детского здоровья. 2018; 23: e56 – e61.

    PubMed PubMed Central Google Scholar

  • 84.

    Esaiassen E, Fjalstad JW, Juvet LK, van den Anker JN, Klingenberg C. Воздействие антибиотиков у новорожденных и ранние неблагоприятные исходы: систематический обзор и метаанализ. J Antimicrob. Chemother. 2017; 72: 1858–70.

    CAS PubMed PubMed Central Google Scholar

  • 85.

    Guillet R, Stoll BJ, Cotten CM, Gantz M, McDonald S, Poole WK, et al. Связь терапии h3-блокаторами и более высокой частоты некротического энтероколита у младенцев с очень низкой массой тела при рождении.Педиатрия. 2006; 117: e137–42.

    PubMed Google Scholar

  • 86.

    Hewitt KM, Mannino FL, Gonzalez A, Chase JH, Caporaso JG, Knight R, et al. Бактериальное разнообразие в двух отделениях интенсивной терапии новорожденных (NICU). PloS ONE. 2013; 8: e54703.

    CAS PubMed PubMed Central Google Scholar

  • 87.

    Бокулич Н.А., Миллс Д.А., Андервуд М.А. Поверхностные микробы в отделении интенсивной терапии новорожденных: изменения в процессе регулярной очистки и со временем.J Clin Microbiol. 2013; 51: 2617–24.

    PubMed PubMed Central Google Scholar

  • 88.

    Брукс Б., Олм М.Р., Файрек Б.А., Бейкер Р., Геллер-МакГрат Д., Реймер С.Р. и др. Развитие кишечного микробиома недоношенных детей является основным фактором, формирующим микробиом отделений интенсивной терапии новорожденных. Микробиом. 2018; 6: 112.

    PubMed PubMed Central Google Scholar

  • 89.

    Стюарт С.Дж., Эмблтон Н.Д., Маррс Э.Л., Смит Д.П., Фофанова Т., Нельсон А. и др. Продольное развитие кишечного микробиома и метаболома у недоношенных новорожденных с поздним началом сепсиса и у здоровых людей. Микробиом. 2017; 5: 75.

    PubMed PubMed Central Google Scholar

  • 90.

    Сингер JR, Blosser EG, Zindl CL, Silberger DJ, Conlan S, Laufer VA и др. Предотвращение дисбактериоза кишечного микробиома новорожденных мышей защищает от позднего сепсиса.Nat Med. 2019; 25: 1772–82.

    CAS PubMed PubMed Central Google Scholar

  • 91.

    Маси А.С., Стюарт К.Дж. Роль кишечного микробиома недоношенных при сепсисе и некротизирующем энтероколите. Early Hum Dev. 2019; 138: 104854.

    PubMed PubMed Central Google Scholar

  • 92.

    Хемми М.Х., Вольке Д., Шнайдер С. Связь между проблемами с плачем, сном и / или кормлением в младенчестве и долгосрочными поведенческими результатами в детстве: метаанализ.Arch Dis Child. 2011; 96: 622–9.

    PubMed PubMed Central Google Scholar

  • 93.

    Loughman A, Quinn T, Nation ML, Reichelt A, Moore RJ, Van TTH, et al. Детская микробиота при коликах: предиктивные ассоциации с проблемным плачем и последующим поведением ребенка. J Dev Orig Health Dis. 2020: 1–11. https://doi.org/10.1017/S2040174420000227.

  • 94.

    Huttenhower C, Kostic AD, Xavier RJ. Воспалительное заболевание кишечника как модель трансляции микробиома.Иммунитет. 2014; 40: 843–54.

    CAS PubMed PubMed Central Google Scholar

  • 95.

    Mayer EA, Tillisch K, Gupta A. Ось кишечника / мозга и микробиота. J Clin исследования. 2015; 125: 926–38.

    PubMed PubMed Central Google Scholar

  • 96.

    Honda K, Littman DR. Микробиота в адаптивном иммунном гомеостазе и болезнях. Природа. 2016; 535: 75–84.

    CAS PubMed PubMed Central Google Scholar

  • 97.

    Schroeder BO, Bäckhed F. Сигналы от микробиоты кишечника к отдаленным органам в физиологии и болезнях. Nat Med. 2016; 22: 1079–89.

    CAS PubMed PubMed Central Google Scholar

  • 98.

    Леви М., Колодзейчик А.А., Тайс К.А., Элинав Э. Дисбактериоз и иммунная система. Nat Rev Immunol. 2017; 17: 219–32.

    CAS PubMed PubMed Central Google Scholar

  • 99.

    Марувада П., Леоне В., Каплан Л. М., Чанг Е.Б. Микробиом человека и ожирение: выход за рамки ассоциаций. Клетка. Хост-микроб. 2017; 22: 589–99.

    CAS PubMed PubMed Central Google Scholar

  • 100.

    Бах Дж. Ф. Гипотеза гигиены при аутоиммунных заболеваниях: роль патогенов и комменсалов. Nat Rev Immunol. 2018; 18: 105–20.

    CAS PubMed PubMed Central Google Scholar

  • 101.

    Браун JM, Хазен SL. Микробная модуляция сердечно-сосудистых заболеваний. Nat Rev.2018; 16: 171–81.

    CAS Google Scholar

  • 102.

    Tilg H, Zmora N, Adolph TE, Elinav E. Кишечная микробиота, питающая метаболическое воспаление. Nat Rev Immunol. 2020; 20: 40–54.

    CAS PubMed PubMed Central Google Scholar

  • 103.

    Iacob S, Iacob DG. Инфекционные угрозы, кишечный барьер и его троянский конь: дисбактериоз.Front Microbiol. 2019; 10: 1676.

    PubMed PubMed Central Google Scholar

  • 104.

    Fouhse JM, Yang K, More-Bayona J, Gao Y, Goruk S, Plastow G, et al. Воздействие амоксициллина на новорожденных изменяет долгосрочный иммунный ответ, несмотря на временное воздействие на кишечную микробиоту у поросят. Фронт Иммунол. 2019; 10: 2059.

    CAS PubMed PubMed Central Google Scholar

  • 105.

    Бомонт М., Паес С., Муссар Э., Кнудсен С., Каукиль Л., Эймард П. и др. Метаболиты кишечной микробиоты способствуют созреванию кишечного барьера при переходе от сосания к отъему. Кишечные микробы. 2020; 11: 1268–86.

    PubMed PubMed Central Google Scholar

  • 106.

    Suh SH, Choe K, Hong SP, Jeong SH, Mäkinen T., Kim KS, et al. Микробиота кишечника регулирует целостность молочных желез, индуцируя VEGF-C в макрофагах ворсинок кишечника.EMBO Rep.2019; 20: e46927.

    PubMed PubMed Central Google Scholar

  • 107.

    Kulkarni DH, McDonald KG, Knoop KA, Gustafsson JK, Kozlowski KM, Hunstad DA, et al. Пассажи антигена, связанные с бокаловидными клетками, ингибируются во время инфекции Salmonella typhimurium, чтобы предотвратить распространение патогена и ограничить реакцию на пищевые антигены. Mucosal Immunol. 2018; 11: 1103–13.

    CAS PubMed PubMed Central Google Scholar

  • 108.

    Abo H, Chassaing B, Harusato A, Quiros M, Brazil JC, Ngo VL, et al. Регулятор дифференцировки эритроидов-1, индуцированный микробиотой в раннем возрасте, управляет пролиферацией и регенерацией стволовых клеток кишечника. Nat Commun. 2020; 11: 513.

    CAS PubMed PubMed Central Google Scholar

  • 109.

    Fung TC, Vuong HE, Luna CDG, Проновост Г.Н., Александрова А.А., Райли Н.Г. и др. Воздействие кишечного серотонина и флуоксетина модулирует бактериальную колонизацию кишечника.Nat Microbiol. 2019; 4: 2064–73.

    PubMed PubMed Central Google Scholar

  • 110.

    Canfora EE, Meex RCR, Venema K, Blaak EE. Метаболиты кишечных микробов при ожирении, НАЖБП и СД2. Обзоры природы. Эндокринология. 2019; 15: 261–73.

    CAS PubMed PubMed Central Google Scholar

  • 111.

    Lau WL, Vaziri ND. Микробные короткоцепочечные жирные кислоты кишечника и риск диабета.Нат Рев Нефрол. 2019; 15: 389–90.

    PubMed PubMed Central Google Scholar

  • 112.

    Санна С., ван Зуйдам Н.Р., Махаджан А., Курильщиков А., Вич Вила А., Воса У и др. Причинно-следственные связи между микробиомом кишечника, короткоцепочечными жирными кислотами и метаболическими заболеваниями. Нат Жене. 2019; 51: 600–5.

    CAS PubMed PubMed Central Google Scholar

  • 113.

    De Vadder F, Kovatcheva-Datchary P, Goncalves D, Vinera J, Zitoun C, Duchampt A, et al.Метаболиты, вырабатываемые микробиотой, улучшают метаболизм через нервные цепи кишечника и мозга. Клетка. 2014; 156: 84–96.

    PubMed PubMed Central Google Scholar

  • 114.

    Далиле Б., Ван Ауденхове Л., Вервлиет Б., Вербеке К. Роль короткоцепочечных жирных кислот в коммуникации между микробиотой, кишечником и мозгом. Нат Рев Гастроэнтерол Гепатол. 2019; 16: 461–78.

    PubMed PubMed Central Google Scholar

  • 115.

    Parada Venegas D, De la Fuente MK, Landskron G, Gonzalez MJ, Quera R, Dijkstra G и др. Короткоцепочечные жирные кислоты (SCFA), опосредуемые эпителиальной и иммунной регуляцией кишечника, и ее значение при воспалительных заболеваниях кишечника. Фронт Иммунол. 2019; 10: 277.

    PubMed PubMed Central Google Scholar

  • 116.

    Frese SA, Hutton AA, Contreras LN, Shaw CA, Palumbo MC, Casaburi G, et al. Стойкость добавок Bifidobacterium longum subsp.Infantis EVC001 у младенцев на грудном вскармливании. мСфера. 2017; 2: e00501–17.

    PubMed PubMed Central Google Scholar

  • 117.

    Zheng N, Gao Y, Zhu W., Meng D, Walker WA. Короткоцепочечные жирные кислоты, образующиеся при взаимодействии кишечных комменсальных бактерий с сцеженным грудным молоком, обладают противовоспалительным действием в незрелых энтероцитах человека. PloS ONE. 2020; 15: e0229283.

    CAS PubMed PubMed Central Google Scholar

  • 118.

    Waligora-Dupriet AJ, Dugay A, Auzeil N, Nicolis I, Rabot S, Huerre MR, et al. Короткоцепочечные жирные кислоты и полиамины в патогенезе некротического энтероколита: аспекты кинетики у гнотобиотических перепелов. Анаэроб. 2009; 15: 138–44.

    CAS PubMed PubMed Central Google Scholar

  • 119.

    Рой С.К., Менг К., Садовиц Б.Д., Коллиш-Сингул М., Епури Н., Саталин Дж. И др. Энтеральное введение смеси, ферментированной бактериями, новорожденным поросятам: высокоточная модель некротического энтероколита (NEC).PloS ONE. 2018; 13: e0201172.

    PubMed PubMed Central Google Scholar

  • 120.

    Meng D, Sommella E, Salviati E, Campiglia P, Ganguli K, Djebali K, et al. Индол-3-молочная кислота, метаболит триптофана, секретируемый Bifidobacterium longum подвидом infantis, оказывает противовоспалительное действие в незрелом кишечнике. Pediatr Res. 2020. https://doi.org/10.1038/s41390-019-0740-x.

  • 121.

    Mukhopadhyay S, Wade KC, Puopolo KM.Препараты для профилактики и лечения сепсиса у новорожденных. Clin Perinatol. 2019; 46: 327–47.

    PubMed PubMed Central Google Scholar

  • 122.

    Caballero-Flores G, Sakamoto K, Zeng MY, Wang Y, Hakim J, Matus-Acuña V, et al. Иммунизация матери обеспечивает защиту потомства от прикрепляющегося и удаляющегося патогена за счет доставки IgG с грудным молоком. Клетка. Хост-микроб. 2019; 25: 313–23.e4.

    CAS PubMed PubMed Central Google Scholar

  • 123.

    Mukhopadhyay S, Sengupta S, Puopolo KM. Проблемы и возможности рационального использования антибиотиков среди недоношенных детей. Arch Dis Child. 2019; 104: F327 – f32.

    Google Scholar

  • 124.

    Шульман Дж., Диманд Р. Дж., Ли ХК, Дуэнас Г. В., Беннетт М. В., Гулд Дж. Б.. Использование антибиотиков в отделении интенсивной терапии новорожденных. Педиатрия. 2015; 135: 826–33.

    PubMed PubMed Central Google Scholar

  • 125.

    Шульман Дж., Профит Дж., Ли ХК, Дуэнас Дж., Беннетт М.В., Паруча Дж. И др. Варианты использования антибиотиков в неонатальном периоде. Педиатрия. 2018; 142: e20180115.

    PubMed PubMed Central Google Scholar

  • 126.

    Chi C, Buys N, Li C, Sun J, Yin C. Влияние пребиотиков на сепсис, некротический энтероколит, смертность, непереносимость кормления, время до полного энтерального питания, продолжительность пребывания в больнице и частоту стула в недоношенные дети: метаанализ.Eur J Clin Nutr. 2019; 73: 657–70.

    CAS PubMed PubMed Central Google Scholar

  • 127.

    Sun J, Marwah G, Westgarth M, Buys N, Ellwood D, Gray PH. Влияние пробиотиков на некротический энтероколит, сепсис, внутрижелудочковое кровотечение, смертность, продолжительность пребывания в больнице и прибавку в весе у очень недоношенных детей: метаанализ. Adv Nutr. 2017; 8: 749–63.

    PubMed PubMed Central Google Scholar

  • 128.

    Deshpande G, Jape G, Rao S, Patole S. Преимущества пробиотиков у недоношенных новорожденных в странах с низким и средним доходом: систематический обзор рандомизированных контролируемых испытаний. BMJ Open. 2017; 7: e017638.

    PubMed PubMed Central Google Scholar

  • 129.

    Dermyshi E, Wang Y, Yan C, Hong W, Qiu G, Gong X и др. «Золотой век» пробиотиков: систематический обзор и метаанализ рандомизированных и наблюдательных исследований недоношенных детей.Неонатология. 2017; 112: 9–23.

    CAS PubMed PubMed Central Google Scholar

  • 130.

    Olsen R, Greisen G, Schroder M, Brok J. Профилактические пробиотики для недоношенных детей: систематический обзор и метаанализ обсервационных исследований. Неонатология. 2016; 109: 105–12.

    PubMed PubMed Central Google Scholar

  • 131.

    Куанг Л., Цзян Ю. Эффект пробиотических добавок у беременных женщин: метаанализ рандомизированных контролируемых исследований.Br J Nutr. 2020; 123: 870–80.

    CAS Google Scholar

  • 132.

    Skonieczna-Zydecka K, Janda K, Kaczmarczyk M, Marlicz W., Loniewski I, Loniewska B. Влияние пробиотиков на симптомы, микробиоту кишечника и маркеры воспаления при детской колике: систематический обзор, метаанализ и мета-регрессия рандомизированных контролируемых исследований. J Clin Med. 2020; 9: 999.

    CAS Google Scholar

  • 133.

    van den Akker CHP, van Goudoever JB, Shamir R, Domellof M, Embleton ND, Hojsak I, et al. Пробиотики и недоношенные дети: позиционный документ Европейского общества педиатрической гастроэнтерологии, гепатологии и комитета по питанию по вопросам питания и рабочей группы Европейского общества детской гастроэнтерологии, гепатологии и питания по пробиотикам и пребиотикам. J Pediatr Gastroenterol Nutr. 2020; 70: 664–80.

    Google Scholar

  • 134.

    van den Akker CHP, van Goudoever JB, Szajewska H, ​​Embleton ND, Hojsak I., Reid D., et al. Пробиотики для недоношенных детей: систематический обзор штаммов и сетевой метаанализ. J Pediatr Gastroenterol Nutr. 2018; 67: 103–22.

    Google Scholar

  • 135.

    Su GL, Ko CW, Bercik P, Falck-Ytter Y, Sultan S, Weizman AV, et al. Руководство AGA по клинической практике о роли пробиотиков в лечении желудочно-кишечных расстройств.Гастроэнтерология. 2020. https://doi.org/10.1053/j.gastro.2020.05.059.

  • 136.

    Льюис З.Т., Шани Г., Масарве К.Ф., Попович М., Фрезе С.А., Села Д.А. и др. Подтверждение идентичности видов и подвидов бифидобактерий в коммерческих пробиотических продуктах. Pediatr Res. 2016; 79: 445–52.

    CAS Google Scholar

  • 137.

    Chiang MC, Chen CL, Feng Y, Chen CC, Lien R, Chiu CH. Lactobacillus rhamnosus сепсис, связанный с терапией пробиотиками у крайне недоношенных новорожденных: патогенез и обзор для клиницистов.J Microbiol Immunol Infect. 2020. https://doi.org/10.1016/j.jmii.2020.03.029

  • 138.

    Pell LG, Loutet MG, Roth DE, Sherman PM. Аргументы против рутинного приема пробиотиков для профилактики НЭК. Curr Opin Pediatrics. 2019; 31: 195–201.

    Google Scholar

  • Дисбактериоз кишечника в раннем возрасте связан с смертностью молоди страусов | Микробиом

    Смертность и дисбактериоз в различных отделах кишечника в онтогенезе

    Смертность молоди страусов наблюдалась в течение всего 12-недельного периода исследования, но была максимальной в возрасте от 4 до 8 недель с пиком в 6 недель (рис.1б). Люди с болезнью следовали кривой роста всех других людей, прежде чем быстро потерять вес перед смертью (рис. 1c, d). Причина снижения веса неизвестна, но наблюдалось, что больные люди перестают есть и пить, а в некоторых случаях страдали диареей, поэтому вероятными объяснениями являются обезвоживание и истощение. В общей сложности 40% всех цыплят умерли от подозреваемого заболевания (68/170, исключая 60 контрольных и 4 раненых). Вскрытие больных и контрольных лиц показало, что смертность была связана с обширным воспалением желудочно-кишечного тракта (рис.1e; Рисунок S1). Баллы воспаления кишечника больных людей (среднее ± стандартное отклонение для подвздошной кишки = 3,1 ± 1,0, слепой кишки = 2,0 ± 1,3, толстой кишки = 2,0 ± 1,2) были значительно выше, чем у контрольных лиц (подвздошная кишка = 0,4 ± 1,0, слепая кишка = 0,04 ± 0,29). , толстая кишка = 0,08 ± 0,45) (Рисунок S1).

    Рис. 1

    Динамика смертности страусов до 12-недельного возраста. a Один из птенцов страуса, включенных в исследование, в возрасте 1 недели. b Совокупная смертность и смертность за неделю. c , d Логарифмически преобразованные веса с течением времени контрольных особей, которые были случайным образом отобраны для эвтаназии на 2, 4, 6, 8, 10 и 12 неделях (синие линии в c ), и лиц, умерших от подозрение на заболевание (красные линии в d ). Серые линии показывают вес всех остальных особей, переживших весь период. e Фотографии во время диссекции, показывающие широко распространенное воспаление кишечника у больного человека (внизу) по сравнению с контрольным человеком (вверху)

    Структура микробиоты больных и контрольных лиц сильно различалась во всех трех областях кишечника (рис.2, рисунок S2, таблица 1). В частности, наблюдались значительные различия в расстояниях между микробными сообществами (полученные с помощью как измерений Брея – Кертиса (BC), так и взвешенного UniFrac (wUF)) между больными и контрольными людьми с учетом возраста, пола, группы и времени после смерти (Таблица 1 ). Однако измерения Брея – Кертиса и взвешенные UniFrac показали противоположные закономерности: расстояние Брея – Кертиса было наибольшим в подвздошной кишке, уменьшающейся к нижнему отделу кишки (слепая кишка), тогда как взвешенные измерения UniFrac были наибольшими в толстой кишке, уменьшающейся к подвздошной кишке (Таблица 1) .Пол, группа и время, прошедшее после смерти, не оказали значительного влияния на какие-либо измерения расстояния микробиома в любой из областей кишечника (таблица 1).

    Рис. 2

    Графики анализа основных координат (PCoA) различий Брея – Кертиса между микробиомами контрольных индивидуумов (синий) и больных людей (красный). Эллипсы обозначают 90% доверительные интервалы

    Таблица 1 PERMANOVA различий микробиома в трех областях кишечника

    Большие различия были также обнаружены при изучении вариаций микробиомов среди больных людей по сравнению с вариациями среди контрольных людей.Больные люди были более похожи друг на друга в микробиоме подвздошной кишки, чем контрольные, при использовании расстояний Брея-Кертиса, но без взвешенных расстояний UniFrac (многомерный тест однородности групповой дисперсии BC (бета-дисперсия): F 1, 99 = 13,9, p = 0,0003. WUF betadisper: F 1, 99 = 0,6, p = 0,46) (рисунки S3 – S4). Напротив, в слепой и толстой кишке было наоборот (BC cecum betadisper: F 1, 105 = 0.08, p = 0,79. Бета-дисперсия толстой кишки BC: F 1, 106 = 1,3, p = 0,25. wUF cecum betadisper: F 1, 105 = 11,2, p = 0,001. wUF Betadisper двоеточия: F 1, 106 = 11,4, p = 0,001) (Рисунок S3). Вместе эти результаты показывают, что бактериальный состав больных и контрольных индивидуумов больше всего отличался в подвздошной кишке, но что толстая кишка содержала наиболее филогенетически разные группы.

    Альфа-разнообразие и возрастной дисбиоз в различных областях кишечника

    Микробное альфа-разнообразие больных людей было значительно снижено во всех трех областях кишечника по сравнению с контрольной группой (болезнь GLM: подвздошная кишка F 1, 99 = 56,7, p = 2,5e − 11; слепая кишка F 1, 105 = 16,1, p = 0,0001; толстая кишка F 1, 106 = 61,5, p = 3,9e − 12), контролируя по возрасту (рис. 3). В подвздошной кишке различия сохранялись для всех возрастов (болезнь GLM * возраст: F 1, 97 = 0.0001, p = 0,99), и влияние возраста было незначительным даже у здоровых людей (возраст GLM: F 1, 98 = 1,4, p = 0,23). В слепой и толстой кишке у больных людей в раннем возрасте было более низкое альфа-разнообразие, чем в контрольной группе (таблица 1; рис. 3), но эти различия уменьшались с возрастом, поскольку разнообразие в целом увеличивалось у всех людей (болезнь GLM * возраст: слепая кишка F 1, 103 = 10,2, p = 0,002; двоеточие F 1, 104 = 9.1, p = 0,003). Поэтому уменьшение альфа-разнообразия, связанное с заболеванием, было очевидным в кишечнике в раннем возрасте, но ограничивалось подвздошной кишкой в ​​более старшем возрасте (см. Также [30]).

    Рис. 3

    Альфа-разнообразие (индекс Шеннона) во время развития в подвздошной, слепой и толстой кишке. Контрольные особи показаны синим цветом, а больные - красным. Линии отображают подогнанные кривые сглаживания локальной регрессии, а заштрихованные области - 95% доверительный интервал. Нижняя правая панель показывает все значения альфа-разнообразия вместе

    Таксоны, связанные с заболеванием в подвздошной кишке

    Чтобы лучше понять микробные различия между больными и контрольными людьми, мы оценили таксономический состав всех желудочно-кишечных регионов.Подвздошная кишка была наиболее ярким признаком дисбактериоза (рис. 4). Контрольные люди имели разнообразное сообщество разных классов бактерий в подвздошной кишке, тогда как у больных людей наблюдалось расцветание Gammaproteobacteria и значительное снижение Bacilli и других более редких классов. Детальное исследование семейств, принадлежащих к Gammaproteobacteria , показало почти полное доминирование Enterobacteriaceae в образцах пораженной подвздошной кишки, в то время как контрольные люди содержали разнообразный набор из семейств Gammaproteobacteria (Рисунок S5).

    Рис. 4

    Доля классов бактерий на индивидуум и область кишечника, отсортированная по возрасту (левые столбцы = самый молодой, правый столбцы = самый старый). Левая колонка = контрольные люди, правая колонка = больные. Верхний ряд = подвздошная кишка, средний ряд = слепая кишка, нижний ряд = толстая кишка

    Грамотрицательные бактерии Enterobacteriaceae - это большое семейство, которое, как известно, включает в себя несколько кишечных патогенов и патобионтов, и часто встречается в больших количествах у хозяев с дисбактериоз кишечника [10, 17, 18].Было обнаружено 19 операционных таксономических единиц (OTU; последовательности со 100% идентичностью нуклеотидов), связанных с Enterobacteriaceae в подвздошной кишке, и поиск по нуклеотидной базе данных NCBI соответствовал широкому диапазону родов, включая Escherichia , Klebsiella , Shigella , Salmonella , Yokenella , Citrobacter , Enterobacter , Cronobacter , Atlantibacter , Pluralibacter , Leclercia LeclerciaВ предыдущих исследованиях было показано, что различные члены семейства Enterobacteriaceae часто встречаются и цветут одновременно во время дисбактериоза [3, 31], что согласуется с нашими результатами.

    Другой ключевой характеристикой дисбактериоза подвздошной кишки было то, что у некоторых людей микробиомы почти полностью состояли из Clostridia , что не наблюдалось ни у одного из контрольных лиц (рис. 4). Семейства Clostridia показали дальнейшие поразительные таксономические закономерности у больных людей, включая значительное увеличение Peptostreptococcaceae и заметное сокращение Ruminococcaceae и других редких семейств (Рисунок S5).Семейство Peptostreptococcaceae было представлено шестью OTU в наших данных, а поисковый поиск дал совпадения с различными видами: Paeniclostridium , Paraclostridium и Clostridium . Наиболее распространенные из этих ОТЕ совпадают с Paeniclostridium sordellii , бактериями, имеющими вирулентные штаммы, вызывающие высокую заболеваемость и смертность от энтерита и энтеротоксемии как у людей, так и у животных [32, 33].

    Затем мы определили конкретные OTU, связанные с дисбиозом, выполнив отрицательные биномиальные тесты Вальда для определения численности бактерий, контролируя возраст хозяев.Тридцать восемь ОТЕ были значительно перепредставлены в подвздошной кишке больных людей (рис. 5), большинство из которых принадлежало к Clostridia , включая Ruminococcaceae , различные Clostridium spp. И Epulopiscium , но также Bacteroides Bacterodes. , Escherichia и Bilophila wadsworthia (Таблица S1).

    Рис. 5

    Дифференциально обильные ОТЕ ( q <0,01) между контрольными и больными индивидуумами, отдельными для трех областей кишечника.Оси и показывают таксономические семейства и OTU, окрашенные на уровне класса. Положительные log 2 -кратные изменения указывают на более высокую численность OTU у контрольных особей, а отрицательные log 2 -кратные изменения указывают на более высокую численность у больных индивидуумов. NA = OTU без классификации по семейству

    Таксоны, связанные с заболеванием слепой и толстой кишки

    Изучение относительной численности классов бактерий в слепой и толстой кишке показало, что контрольные люди в значительной степени похожи, демонстрируя относительно стабильный состав микробиома для разных хозяев и возрастов.Однако были серьезные нарушения микробного состава обоих отделов кишечника у больных людей (рис. 4). Подобно подвздошной кишке, Gammaproteobacteria были более распространены в слепой и толстой кишке больных людей, но наиболее заметные различия составили уменьшение Clostridia и увеличение Bacteroidia . Дальнейший таксономический анализ Bacteroidia показал, что семейство Porphyromonadaceae размножалось в слепой и толстой кишке больных людей (Рисунок S5).По нашим данным, это семейство включает два вида: Parabacteroides distasonis и Dysgonomonas sp., Которые обычно встречаются в нормальной микробиоте кишечника [34]. Однако P. distasonis ранее был идентифицирован как вызывающий колит вид у мышей [35], а представителей Dysgonomonas , как известно, связаны с кахексией и воспалением кишечника [36].

    Тесты дифференциальной численности выявили большое сходство в паттернах дисбактериоза слепой и толстой кишки, поскольку 50 из 56 (89%) ОТЕ, которые были более многочисленны в образцах пораженной толстой кишки, также были более многочисленными в образцах пораженной слепой кишки (рис.5; Таблицы S2 – S3). Кроме того, 15 из этих OTU (39%) также были значительно перепредставлены в подвздошной кишке (Таблица S1). Наиболее значимые ОТЕ в слепой кишке ( q = 1,2e-53) и толстой кишке ( q = 2,4e-56) отсутствовали у контрольных лиц, но были в большом количестве у больных (таблицы S2 – S3). Этот OTU, который также был очень значимым в подвздошной кишке ( q = 3,4e-21), имел 100% совпадение с Clostridium paraputrificum , известным патогеном человека, связанным с сепсисом и некротическим энтероколитом [37,38,39] . C. paraputrificum также был экспериментально изучен на гнотобиотических перепелах, где он вызывал поражения и кровотечения в слизистой оболочке кишечника, связанные с энтероколитом [40].

    Помимо C. paraputrificum , очень значимые OTU, которые были более многочисленны у больных людей (таблицы S2 – S3), дали бластные совпадения (идентичность 99,5–100%) с Clostridium видов C. colinum , C. cadaveris , C. butyricum и C.perfringens , все из которых ранее были связаны с острым энтероколитом как у страусов, так и у других животных [26, 41, 42, 43, 44]. Другие OTU, которые были широко представлены в образцах пораженных слепой и толстой кишки, принадлежали к Enterobacteriaceae , Ruminococcaceae , Mogibacteriaceae , Bacteroides , Dorea , Sedimentiphila99 5; Таблицы S2 – S3).Многие из этих бактерий составляют часть нормальной микробиоты кишечника [45,46,47], и большинство всех OTU, значительно превышенных у больных индивидуумов, также присутствовали у некоторых контрольных индивидуумов, хотя и в гораздо меньших количествах (Таблицы S2 – S3).

    Таксоны, связанные со здоровьем в различных областях кишечника

    В подвздошной кишке больных людей наблюдалось значительное сокращение количества определенных бактерий по сравнению с контрольной группой (рис. 4), в основном Bacilli , класса, в котором Turicibacteraceae и Lactobacillaceae были самые обычные семьи. Turicibacteraceae включал две значимые OTU из Turicibacter (Таблица S1), которые показали снижение численности в пораженной подвздошной кишке. Turicibacter , как было показано, в высокой степени наследуется у людей и мышей, когда он находится в прямом контакте с клетками-хозяевами тонкой кишки [48]. Этот род ассоциирован как со здоровьем, так и с болезнями, но часто обнаруживается, что он истощен у животных с диареей и энтеропатией [49,50,51].

    Одним из наиболее ярких различий как слепой, так и толстой кишки больных людей было существенное сокращение семейства Bacteroidia , S24-7 (Рисунок S5).Мало что известно о S24-7 , несмотря на то, что он является важным компонентом нормальной микробиоты кишечника позвоночных [52]. Тем не менее, исследования на мышах сообщили о потенциально благоприятном эффекте S24-7 , при этом количество часто снижается у больных хозяев [53, 54]. Большинство ОТЕ с пониженным содержанием в толстой кишке больных людей также недостаточно представлены в слепой кишке (15 из 19; 79%), что указывает на крупномасштабное истощение потенциально связанных со здоровьем бактерий по всей задней кишке.Эти OTU принадлежали к таким таксонам, как Lachnospiraceae (например, Coprococcus , Blautia ), Ruminococcaceae (например, Ruminococcus ), S24-7 a, 906ridhaceplus , Turicibacter , Methanobrevibacter , Akkermansia muciniphila и несколько неизвестных Clostridiales (рис. 5; таблицы S2 – S3).

    В то время как было обнаружено, что 15 OTU значительно перепредставлены во всех трех областях кишечника больных людей, только одна OTU была значительно недопредставлена ​​во всех областях кишечника больных людей.Этот OTU соответствует производящему бутират роду Roseburia , который неоднократно ассоциировался со здоровьем. Например, более низкая численность Roseburia spp. были обнаружены у людей с язвенным колитом, воспалительным заболеванием кишечника, синдромом раздраженного кишечника, ожирением, печеночной энцефалопатией и диабетом 2 типа [2, 55,56,57], а также у свиней с дизентерией свиней [58]. Эти результаты подтверждают идею о том, что Roseburia и многие другие таксоны, ранее обнаруженные как отрицательно связанные с заболеванием, не только специфичны для паттернов дисбиоза млекопитающих, но и их истощение является объединяющим признаком дисбактериоза у филогенетически далеких хозяев, таких как люди и страусы.

    Нарушение микробиоты кишечника за несколько недель до смерти

    Чтобы установить, возникает ли дисбактериоз непосредственно перед смертью или является результатом дисбаланса, возникшего в более раннем возрасте, мы исследовали микробиоту образцов фекалий, которые неоднократно собирались перед смертью. Мы обнаружили, что выживаемость цыплят до 4-недельного возраста не связана с альфа или филогенетическим разнообразием бактерий в более раннем возрасте (Таблица S4). Однако вероятность выживания более шести недель была предсказана более высоким альфа-разнообразием в возрасте 2 недель (отношение рисков Кокса (HR): 0.57 ± 0,25, p <0,05), но меньшее альфа-разнообразие в возрасте 4 недель (HR: 4,02 ± 0,59, p <0,05) и меньшее филогенетическое разнообразие в возрасте двух и четырех недель (HR 2 недели: 1,40 ± 0,15, p <0,05; HR 4 недели: 1,88 ± 0,24, p <0,01) (рисунок S6; таблица S4). Эти результаты предполагают, что люди с низким микробным альфа-разнообразием в возрасте 2 недель были восприимчивы к колонизации определенными филогенетическими группами бактерий, что увеличивало их риск смерти в последующие недели.

    Затем мы исследовали, может ли численность семейств бактерий, которые различаются между больными и контрольными людьми, предсказать закономерности будущей смертности в течение недель, предшествующих смерти. Имеются лишь слабые доказательства того, что более высокая численность Lactobacillaceae в возрасте 2 недель и Turicibacteraceae в возрасте 4 недель имеет тенденцию положительно влиять на выживаемость (Рисунок S7; Таблица S4). Численность Peptostreptococcaceae и S24-7 старше 6 недель также была связана с увеличением последующей выживаемости, хотя и незначительно (Таблица S4).Однако наблюдалась очень сильная связь между численностью Peptostreptococcaceae и S24-7 в течение первой недели жизни и смертностью во всех последующих возрастах, даже после контроля численности этих семейств бактерий в более позднем возрасте (диапазон HR Peptostreptococcaceae : От 1,65 ± 0,13 до 1,73 ± 0,16, все значения p <0,001; диапазон ЧСС S24-7: от 1,24 ± 0,11 до 1,60 ± 0,21, все значения p <0,05) (рис.6; таблица S4). Этот результат предполагает, что время размножения определенных групп бактерий, таких как Peptostreptococcaceae и S24-7 , может быть ключом к приспособленности хозяина с более высокой численностью в раннем возрасте, потенциально имеющей пагубные последствия, даже если те же самые группы бактерий могут быть полезными. в более позднем возрасте.Это также подтверждает идею о том, что первые пару дней после вылупления являются критическим периодом, определяющим возникновение микробного дисбаланса, который может привести к увеличению смертности даже через несколько месяцев.

    Рис. 6

    Численность (нормализованная и логарифмически преобразованная) двух семейств бактерий, связанных с заболеванием, в недели, предшествующие смерти, измеренная путем повторного отбора проб фекалий у людей. Точки и столбики ошибок представляют собой средние значения ± SE

    Источники кишечных бактерий в окружающей среде

    Наконец, мы оценили потенциальные экологические источники микробов, присутствующих в кишечнике контрольных и больных людей.Образцы были собраны из воды, пищи и почвенного субстрата в течение периода исследования и проанализированы с помощью SourceTracker [59]. Фактически отсутствовал вклад воды (0,1–0,4%) или почвы (0,2–0,7%) в микробиоту кишечника ни больных, ни контрольных лиц (рис. 7). Вместо этого большинство кишечных бактерий было из неизвестных источников (89,9%). Некоторые микробные последовательности, присутствующие в пище, перекрываются с OTU, обнаруженными в подвздошной и толстой кишке. Однако это были преимущественно контрольные люди, что можно объяснить тем, что здоровые люди ели больше, чем больные (рис.7). Эти результаты указывают на то, что зараженные продукты питания или вода вряд ли были источниками бактерий, связанных со смертностью.

    Рис. 7

    Экологические источники бактерий, присутствующие в различных отделах кишечника. C = контрольные люди и D = больные люди

    Наша схема отбора проб окружающей среды не исключает возможности наличия других источников патогенных бактерий в окружающей среде. Например, в вольерах для цыплят часто наблюдали несколько видов диких птиц, в том числе плащевых воробьев, ткачей, ткачей в масках, красных епископов и келеа.Отбор проб воды, продуктов питания и почвы каждые 2 недели также может быть недостаточно частым для выявления потенциального временного присутствия бактерий в окружающей среде или случаев передачи инфекции, которые могут происходить спорадически. Тем не менее, наш продольный анализ фекального микробиома показывает, что проблемы с дисбиозом возникают на ранних этапах жизни из-за таксонов, уже присутствующих в кишечнике, а не из-за внезапного приобретения новых таксонов. Мало что известно о микробиоме яиц, родителях или среде вылупления этого вида, но это очевидный путь для будущих исследований, которые могут помочь определить способы контроля распространенности проблемных бактерий в раннем возрасте.Для этого исследования цыплят выращивали изолированно от взрослых, поскольку это облегчает содержание и обращение с ними. Однако этот подход предотвращает взаимодействия между цыплятами и родителями, которые могут быть важны для раннего установления микробиоты кишечника. Например, было показано, что копрофагия (питание фекалиями) играет важную роль в развитии микробиоты у других животных [60], а цыплята страуса, как известно, обладают копрофагией [61]. Обеспечение доступа к взрослым особям (или, по крайней мере, к их фекалиям) может позволить цыплятам в раннем возрасте засеять свой микробиом сбалансированным и разнообразным бактериальным сообществом, возможно, предотвращая распространение проблемных бактерий в будущем.Однако эту идею еще предстоит проверить экспериментально.

    Роль микробиоты кишечника в питании и здоровье

    1. Ана М. Вальдес, доцент1 2,
    2. Йенс Уолтер, председатель CAIP по вопросам питания, микробов и здоровья желудочно-кишечного тракта4,
    3. Эран Сигал, профессор4,
    4. Тим Д. Спектор , профессор5
    1. 1 Школа медицины, Университет Ноттингема, Городская больница, Ноттингем NG5 1PB, Великобритания
    2. 2 NIHR Nottingham Biomedical Research Center, Ноттингем, Великобритания
    3. наук о сельском хозяйстве, питании и питании и Департамент биологических наук, Университет Альберты, Эдмонтон, Канада
    4. 4 Департамент компьютерных наук и прикладной математики, Институт науки Вейцмана, Реховот, Израиль
    5. 5 Департамент исследований близнецов и генетической эпидемиологии, Королевский колледж Лондона, Лондон, Великобритания
    1. Для корреспонденции: T D Spector tim.spector {at} kcl.ac.uk

    Ана М. Вальдес и его коллеги обсуждают стратегии регулирования кишечной микробиоты с помощью диеты и пробиотиков

    Микробиом относится к коллективным геномам микроорганизмов в конкретной среде и микробиоте это сообщество самих микроорганизмов (вставка 1). Приблизительно 100 триллионов микроорганизмов (большинство из них бактерии, но также вирусы, грибы и простейшие) существуют в желудочно-кишечном тракте человека12 - микробиом сейчас лучше всего рассматривать как виртуальный орган тела.Геном человека состоит примерно из 23 000 генов, тогда как микробиом кодирует более трех миллионов генов, производящих тысячи метаболитов, которые заменяют многие функции хозяина 13, следовательно, влияя на приспособленность, фенотип и здоровье хозяина.2

    Вставка 1

    Глоссарий
    • Микробиом - коллективные геномы микроорганизмов в определенной среде

    • Микробиота - сообщество самих микроорганизмов

    • Разнообразие микробиоты - мера разнообразия сколько разных видов и, в зависимости от показателей разнообразия, насколько равномерно они распределены в сообществе.Более низкое разнообразие считается маркером дисбактериоза (микробного дисбаланса) в кишечнике и обнаруживается при аутоиммунных заболеваниях, ожирении и кардиометаболических состояниях, а также у пожилых людей

    • Оперативная таксономическая единица - определение, используемое для классификации групп близкородственных организмов. Последовательности ДНК могут быть сгруппированы в соответствии с их сходством друг с другом, а рабочие таксономические единицы определяются на основе порога сходства (обычно 97% сходства), установленного исследователем

    • Колоноциты - эпителиальные клетки толстой кишки

    • Животные без микробов - животные, в которых или на них не живут микроорганизмы

    • Короткоцепочечные жирные кислоты - жирные кислоты с двумя-шестью атомами углерода, которые образуются в результате бактериальной ферментации пищевых волокон

    ВЕРНУТЬСЯ К ТЕКСТУ

    Изучение микробиоты кишечника

    Исследования с близнецами показали, что, хотя существует наследственный компонент микробиоты кишечника, факторы окружающей среды, связанные с диетой, лекарствами и антропометрическими показателями, являются более крупными детерминантами состава микробиоты.45

    Кишечные микробы играют ключевую роль во многих аспектах здоровья человека, включая иммунные6, метаболические5 и нейроповеденческие черты (рис. 1) .78 Различные уровни доказательств подтверждают роль кишечной микробиоты в здоровье человека, полученные на животных моделях910 и исследованиях на людях 4111213

    Рис. 1

    Схематическое изображение роли микробиоты кишечника в здоровье и болезнях с некоторыми примерами входов и выходов. ССЗ = сердечно-сосудистые заболевания; IPA = индолепропионовая кислота; ЛПС = липополисахарид; SCFA = жирные кислоты с короткой цепью; ТМАО = N-оксид триметиламина

    Модели на животных могут помочь идентифицировать кишечные микробы и механизмы, хотя степень, в которой результаты передаются людям, неизвестна.На людях обсервационные исследования могут показать перекрестные ассоциации между микробами и признаками здоровья, но ограничены невозможностью измерить причинно-следственные связи. Самый убедительный уровень доказательств получен в интервенционных клинических исследованиях, в частности, в рандомизированных контролируемых исследованиях.

    Состав кишечной микробиоты обычно количественно оценивается с использованием методов на основе ДНК, таких как секвенирование следующего поколения генов рибосомной РНК 16S или полногеномное секвенирование, которое также позволяет сделать вывод о функциях микробиоты.1415 Продукты метаболизма микробиоты теперь можно измерить в кале и сыворотке с помощью метаболомных методов.16

    Что делает кишечная микробиота?

    Микробиота кишечника обеспечивает необходимые возможности для ферментации неперевариваемых субстратов, таких как пищевые волокна и эндогенная кишечная слизь. Эта ферментация поддерживает рост специальных микробов, которые производят короткоцепочечные жирные кислоты (SCFA) и газы.17 Основными производимыми SCFA являются ацетат, пропионат и бутират.

    Бутират является основным источником энергии для колоноцитов человека, может вызывать апоптоз клеток рака толстой кишки и активировать глюконеогенез кишечника, оказывая благотворное влияние на глюкозный и энергетический гомеостаз.18 Бутират необходим эпителиальным клеткам для потребления большого количества кислорода через β окисление, вызывая состояние гипоксии, которое поддерживает кислородный баланс в кишечнике, предотвращая дисбактериоз кишечной микробиоты.19

    Пропионат переносится в печень, где он регулирует глюконеогенез и передачу сигналов насыщения через взаимодействие с рецепторами жирных кислот кишечника 18 Ацетат - самый обильные SCFA и важный метаболит для роста других бактерий - достигает периферических тканей, где он используется в метаболизме холестерина и липогенезе, и может играть роль в центральной регуляции аппетита.20 Рандомизированные контролируемые испытания показали, что более высокая продукция SCFAs коррелирует с более низким ожирением, вызванным диетой21, и со снижением инсулинорезистентности22. Бутират и пропионат, но не ацетат, по-видимому, контролируют гормоны кишечника и снижают аппетит и потребление пищи у мышей.21 ферменты участвуют в метаболизме желчных кислот, генерируя неконъюгированные и вторичные желчные кислоты, которые действуют как сигнальные молекулы и регуляторы метаболизма, влияя на важные пути хозяина.23

    Другие специфические продукты кишечной микробиоты непосредственно влияют на здоровье человека.Примеры включают триметиламин и индолепропионовую кислоту. Производство триметиламина из пищевого фосфатидилхолина и карнитина (из мяса и молочных продуктов) зависит от микробиоты кишечника, и, следовательно, его количество в крови варьируется у разных людей. Триметиламин окисляется в печени до N-оксида триметиламина, что положительно связано с повышенным риском атеросклероза и серьезных сердечно-сосудистых событий.24 Индолепропионовая кислота сильно коррелирует с потреблением пищевых волокон25 и обладает мощной активностью улавливания радикалов in vitro, 26 что кажется для снижения риска заболеваемости диабетом 2 типа.25

    Микробиота кишечника и ожирение

    Микробиота кишечника, по-видимому, играет роль в развитии и прогрессировании ожирения. Большинство исследований с участием людей с избыточным весом и ожирением показывают, что дисбактериоз отличается меньшим разнообразием. 31-39 Мыши без микробов, которые получают фекальные микробы от людей с ожирением, набирают больше веса, чем мыши, которые получают микробы от людей со здоровым весом.4 Крупное исследование близнецов в Великобритании показало, что род Christensenella редко встречается у людей с избыточным весом и когда давать мышам, не содержащим микробов, предотвращать увеличение веса.4 Этот микроб и другие, такие как Akkermansia , коррелируют с более низкими отложениями висцерального жира.12 Хотя большая часть подтверждающих данных получена на моделях мышей, долгосрочное увеличение веса (более 10 лет) у людей коррелирует с низким разнообразием микробиоты, и эта связь усугубляется низким потреблением пищевых волокон.28

    Дисбиоз кишечной микробиоты, вероятно, способствует ожирению, вызванному диетой, и метаболическим осложнениям за счет различных механизмов, включая иммунную дисрегуляцию, изменение регуляции энергии, изменение регуляции гормонов кишечника и провоспалительные механизмы (такие как липополисахаридные эндотоксины, проникающие через кишечник). барьер и вход в портал кровообращения 2930; рис 1 ) .

    Разнообразие микробиоты и здоровье

    Низкое бактериальное разнообразие воспроизводимо наблюдается у людей с воспалительным заболеванием кишечника, 31 псориатическим артритом, 32 диабетом 1 типа, 33 атопической экземой, 34 целиакией, 35 ожирением, 36 диабетом 2 типа, 37 и артериальным жесткость, 38, чем у здоровых людей. У курильщиков с болезнью Крона разнообразие кишечного микробиома еще ниже.39 Связь между сниженным разнообразием и заболеванием указывает на то, что богатая видами кишечная экосистема более устойчива к воздействиям окружающей среды, поскольку функционально связанные микробы в нетронутой экосистеме могут компенсировать функцию других отсутствующих разновидность.Следовательно, разнообразие, по-видимому, в целом является хорошим показателем «здорового кишечника». 4041 Но недавние интервенционные исследования показывают, что значительное увеличение количества пищевых волокон может временно уменьшить разнообразие, поскольку микробы, переваривающие клетчатку, становятся специфически обогащенными, что приводит к изменению состава и, за счет конкурентных взаимодействий, сокращение разнообразия.22

    Функциональная роль кишечного микробиома у людей была показана с помощью трансплантации фекальной микробиоты.42 Эта процедура эффективна в случаях тяжелой резистентной к лекарственным средствам инфекции, вызванной Clostridium difficile , и в настоящее время используется в повседневной практике. для этого по всему миру.43 Для других патологий трансплантация фекалий еще не является клинической практикой, но была изучена.44 Например, трансплантация фекалий от худощавого здорового донора (аллогенного) реципиентам с метаболическим синдромом привела к лучшей чувствительности к инсулину, сопровождаемой измененным составом микробиоты, чем при использовании аутологичные фекалии.45

    Влияние пищи и лекарств на микробиоту кишечника

    Конкретные продукты и режим питания могут влиять на численность различных типов бактерий в кишечнике, что, в свою очередь, может повлиять на здоровье (таблица 1).

    Таблица 1

    Примеры продуктов питания, питательных веществ и режимов питания, которые влияют на здоровье человека, в связи с их влиянием на микробиоту кишечника

    Высокоинтенсивные подсластители обычно используются в качестве альтернативы сахару, поскольку они во много раз слаще сахара при минимальном количестве калорий. Несмотря на то, что регулирующие органы «общепризнаны безопасными», некоторые исследования на животных показали, что эти заменители сахара могут оказывать негативное влияние на микробиоту кишечника.46 Было показано, что сукралоза, аспартам и сахарин нарушают баланс и разнообразие микробиоты кишечника.46 Крысы, получавшие сукралозу в течение 12 недель, имели значительно более высокие пропорции Bacteroides , Clostridia и общее количество аэробных бактерий в кишечнике, а также значительно более высокий pH фекалий, чем у крыс без сукралозы. экспрессия в кишечнике провоспалительных генов бактерий и нарушенных метаболитов фекалий.48

    Пищевые добавки, такие как эмульгаторы, которые повсеместно присутствуют в обработанных пищевых продуктах, также влияют на микробиоту кишечника животных.49 Мыши, которым давали относительно низкие концентрации двух обычно используемых эмульгаторов - карбоксиметилцеллюлозы и полисорбат-80, - показали снижение микробного разнообразия по сравнению с мышами, не получавшими эмульгаторы. Bacteroidales и Verrucomicrobia были уменьшены, а протеобактерии, способствующие воспалению, связанные со слизью, были обогащены .49

    Другие области, вызывающие беспокойство, включают побочные эффекты популярных ограничительных диет на здоровье кишечника. К ним относятся некоторые строгие веганские диеты, сыроедение или диеты «чистого питания», диеты без глютена и диеты с низким содержанием FODMAP (ферментируемых олигосахаридов, дисахаридов, моносахаридов и полиолов), используемые для лечения синдрома раздраженного кишечника.

    Некоторые считают веганов более здоровыми, чем всеядные. Исследование 15 веганов и 16 оминворов выявило поразительные различия в сывороточных метаболитах, генерируемых кишечными микробами, но очень скромные различия в кишечных бактериальных сообществах.50 Эксперимент с контролируемым кормлением 10 человек всеядных животных, рандомизированных для получения диеты с высоким содержанием жиров и низким содержанием клетчатки или с низким содержанием жира и высоким содержанием клетчатки в течение 10 дней было обнаружено очень скромное влияние на состав кишечного микробиома и отсутствие разницы в производстве короткоцепочечных жирных кислот.Вместе эти данные подтверждают большую роль диеты, влияющей на метаболом бактериального происхождения, чем только на краткосрочное бактериальное сообщество50.

    Исследования на животных и in vitro показывают, что безглютеновый хлеб снижает дисбактериоз микробиоты, наблюдаемый у людей с чувствительностью к глютену или глютеновой болезнью. 5152 Но большинство людей, избегающих глютена, не страдают глютеновой болезнью или непереносимостью, и недавнее крупное обсервационное исследование показало повышенный риск сердечных заболеваний у тех, кто избегает глютена, возможно, из-за снижения потребления цельного зерна.53 Одно исследование показало, что у 21 здорового человека профиль кишечной микробиоты существенно различается после четырех недель безглютеновой диеты. У большинства людей наблюдалась более низкая численность нескольких ключевых полезных видов микробов.54

    Диета с низким содержанием FODMAP была показана в шести рандомизированных контролируемых испытаниях для уменьшения симптомов синдрома раздраженного кишечника.5556 Это связано с уменьшением доли Bifidobacterium у пациентов. с синдромом раздраженного кишечника, и реакцию на эту диету можно предсказать по бактериальному профилю фекалий.57 Диеты с низким содержанием FODMAP приводят к глубоким изменениям микробиоты и метаболома, продолжительность и клиническая значимость которых пока неизвестны.5859

    Помимо диеты, лекарственные препараты являются ключевым модулятором состава микробиоты кишечника. Крупное голландско-бельгийское популяционное исследование показало, что лекарственные препараты (включая осмотические слабительные, прогестерон, ингибиторы TNF-α и рупатадин) обладают наибольшей объяснительной силой в отношении состава микробиоты (10% вариаций в сообществе) 13. ингибиторы протонной помпы на микробное сообщество, что может объяснить более высокую частоту желудочно-кишечных инфекций у людей, принимающих эти препараты.60 Очевидно, что антибиотики действуют на кишечные микробы, и животным обычно дают низкие дозы для увеличения их роста и веса. Большая часть антибиотиков во многих странах используется в сельском хозяйстве, особенно в интенсивном разведении птицы и говядины.61 Несколько наблюдательных исследований на людях, а также многие исследования на грызунах указали на ожирение антибиотиков у людей даже в крошечных дозах, обнаруживаемых в продуктах питания. 61 Но люди имеют очень разные ответы на антибиотики, и интервенционные исследования не показали последовательных метаболических последствий.62 Пестициды и другие химические вещества обычно распыляют на пищевые продукты, но, хотя уровни могут быть высокими, убедительных доказательств их вреда для здоровья кишечника и воздействия органических продуктов питания в настоящее время нет.63

    Недостаточно клинических данных, чтобы сделать четкие выводы или рекомендации. для тех или иных диетических предпочтений на основе микробиоты кишечника. Но будущие исследования пищевых добавок, лекарств, а также безопасности и эффективности диетических модификаций должны учитывать эти достижения и их влияние на микробиоту кишечника.Это становится очевидным для пациентов с раком, получавших иммунохимиотерапию, реципиентов костного мозга и пациентов с аутоиммунными нарушениями на биопрепаратах, у которых небольшие изменения в их микробиоте могут вызвать серьезные изменения в их реакции.64 Более того, эксперименты на животных показали защитные эффекты фитоэстрогенов. на рак груди зависят от наличия кишечных микробов (таких как Clostridium saccharogumia , Eggerthella lenta, Blautia producta, и Lactonifactor longoviformis ), которые могут превращать изофлавоны в биоактивные соединения.65

    Вставка 2 суммирует наши текущие знания о взаимодействии между микробиотой кишечника, питанием и здоровьем человека.

    Вставка 2

    Консенсус и неопределенности
    Что мы знаем
    • Добавки с пробиотиками имеют несколько положительных эффектов на здоровье человека

    • Микробы в нашем кишечнике влияют на энергетический метаболизм человека сильное влияние на состав микробиоты кишечника

    • Состав микробиоты влияет на реакцию на химиотерапию и иммунотерапию96

    • Состав микробиома определяет реакцию глюкозы на пищу и может использоваться для персонализации диеты94

    • Потребление пищевых волокон влияет на состав микробиоты кишечника и связано к лучшему здоровью8687104

    Чего мы не знаем
    • Лучше ли натуральные пробиотики в пище, чем пробиотические добавки? Стоит ли принимать их в профилактических целях?

    • Могут ли микробы влиять на выбор пищи и аппетит?

    • Влияют ли низкие дозы антибиотиков в пище на здоровье человека?

    • Как пестициды, содержащиеся в пище, влияют на микробиом кишечника? Органические продукты лучше для кишечной микробиоты?

    • Следует ли тестировать все новые лекарства и пищевые химикаты на микробиоте кишечника?

    ВОЗВРАТ К ТЕКСТУ

    Управление микробиотой кишечника с помощью диеты

    Изменения микробиоты кишечника могут произойти в течение нескольких дней после смены диеты; заметные различия были обнаружены после того, как афроамериканцы и сельские африканцы сменили диету всего на две недели.66 Увеличение численности известных бактерий, продуцирующих бутират, у афроамериканцев, потребляющих сельскую африканскую диету, привело к увеличению производства бутирата в 2,5 раза и снижению синтеза вторичной желчной кислоты66. пять дней.67 Но здоровая микробиота устойчива к временным изменениям за счет диетических вмешательств, что означает, что гомеостатические реакции восстанавливают исходный состав сообщества, как недавно было показано в случае хлеба 68

    Пребиотические продукты и пищевые волокна

    Большинство национальных властей определяют диетические волокна как съедобные углеводные полимеры с тремя или более мономерными единицами, которые устойчивы к эндогенным пищеварительным ферментам и, таким образом, не подвергаются гидролизу и не всасываются в тонком кишечнике.69 Подмножество источников пищевых волокон является ферментируемым, что означает, что они служат субстратами для роста микробов в дистальном отделе кишечника.70 Некоторые неперевариваемые углеводы называются «пребиотиками», которые определяются как пищевые компоненты или ингредиенты, которые не усваиваются человеческим организмом, но специально или выборочно питают полезные микроорганизмы толстой кишки (вставка 3) .71 Концепция пребиотиков подвергалась критике за то, что она плохо определена и излишне узка, 72 и некоторые ученые предпочитают термин «углеводы, доступные микробиоте» 11. которые по существу эквивалентны ферментируемым диетическим волокнам в том смысле, что они становятся доступными в качестве субстратов для роста кишечных микробов, которые обладают необходимой ферментативной способностью для их использования.70

    Box 3

    Что такое пребиотики и пробиотики?

    Количество белка, насыщенных и ненасыщенных жиров, углеводов и пищевых волокон в рационе влияет на численность различных типов бактерий в кишечнике. Микробиоту также можно изменить, добавляя в пищу живые микроорганизмы или голодая.

    • Пробиотики - это живые бактерии и дрожжи, которые при введении в жизнеспособной форме и в достаточных количествах полезны для здоровья человека.Обычно их добавляют в йогурты или принимают в качестве пищевых добавок.

    • Пребиотики определяются как субстрат, который избирательно используется микроорганизмами-хозяевами, принося пользу для здоровья. Хотя все соединения, считающиеся пребиотиками, являются углеводами, доступными для микробиоты, или ферментируемыми пищевыми волокнами, обратное неверно. Концепция пребиотиков является предметом текущих дебатов70

    • Синбиотики содержат смесь пребиотиков и пробиотиков

    ВОЗВРАТ К ТЕКСТУ

    Было показано, что потребление резистентных крахмалов обогащает определенные группы бактерий ( Bifidobacterium adolescentis, Ruminococcus bromii Eubacterium rectale ) у некоторых людей.7475 Обогащенные таксоны различаются в зависимости от типа устойчивых крахмалов и других пищевых волокон 75, что указывает на то, что сдвиги зависят от химической структуры углеводов и ферментативной способности микробов получать к ним доступ. Микробы также должны «прилипать» к субстрату и выдерживать условия, создаваемые ферментацией (например, низкий pH) .76

    Влияние доступных для микробиоты углеводов на состав микробиома желудочно-кишечного тракта может быть значительным, при этом определенные виды обогащаются и составляют больше более 30% фекальной микробиоты.7577 Таким образом, углеводы, доступные для микробиоты, обеспечивают потенциальную стратегию улучшения полезных меньшинств микробиома. Эти изменения продолжаются только до тех пор, пока потребляются углеводы, и они очень индивидуальны, что обеспечивает основу для индивидуальных подходов. Многие краткосрочные испытания кормления очищенными пищевыми волокнами или даже диетами на основе цельных растений либо не влияют на разнообразие микробиоты, либо уменьшают его, 22 но все же могут иметь клинические преимущества, потенциально за счет метаболитов, таких как жирные кислоты с небольшой цепью.2267

    Низкое потребление клетчатки снижает производство низкоцепочечных жирных кислот и сдвигает метаболизм микробиоты желудочно-кишечного тракта в сторону использования менее благоприятных питательных веществ 78, что приводит к выработке потенциально вредных метаболитов.7980 Убедительные доказательства показывают, что западная диета с низким содержанием клетчатки разрушает слизистый барьер толстой кишки. , вызывая вторжение микробиоты, что приводит к восприимчивости к патогенам81 и воспалению, 82 обеспечивая потенциальный механизм связи западной диеты с хроническими заболеваниями.Два недавних исследования показали, что пагубное влияние диеты с высоким содержанием жиров на проницаемость слизистого слоя и метаболические функции можно предотвратить путем диетического введения инулина.8384 В целом, эти результаты, вместе с ролью бутирата в предотвращении кислородно-индуцированного дисбиоза микробиоты кишечника, 19 являются убедительным аргументом в пользу увеличения потребления пищевых волокон для поддержания неповрежденной барьерной функции слизистой оболочки кишечника.85

    Значительные данные наблюдений показывают, что потребление клетчатки полезно для здоровья человека.Два недавних метаанализа обнаружили четкую связь между диетической клетчаткой и пользой для здоровья при широком спектре патологий 8687, а недавнее интервенционное исследование показало, что пищевые волокна значительно снижают инсулинорезистентность у пациентов с диабетом 2 типа, с четкой связью с изменениями в микробиоте. и полезные метаболиты (такие как бутират) .45

    Пробиотические продукты питания

    Пробиотики - это живые микроорганизмы, которые при введении в адекватных количествах приносят пользу здоровью хозяина).88 Пробиотики (в основном виды Bifidobacterium и Lactobacillus ) могут быть включены в различные продукты, включая продукты питания, пищевые добавки или лекарства.

    Существуют опасения, что большинство микробных добавок не могут прижиться в кишечнике и не могут оказать влияние на местное сообщество.8990 Но пробиотики могут влиять на здоровье независимо от микробиоты кишечника через прямое воздействие на хозяина; например, посредством иммуномодуляции или производства биологически активных соединений.Терапевтический эффект пробиотических добавок изучался при широком спектре заболеваний.

    Мы провели поиск в Кокрановской библиотеке систематических обзоров на предмет «пробиотик *», что дало 39 исследований, и выполнили поиск в Medline по запросу «систематический обзор» или «метаанализ» и «пробиотик *», в результате чего было получено 31 исследование. Мы включили информацию о систематических обзорах рандомизированных контролируемых исследований, опубликованных за последние пять лет, в которых основным лечением были пробиотики (а не пищевые добавки в целом). Только исследования, которые были сосредоточены на сравнении пробиотиков с контрольной группой, которые содержали по крайней мере несколько рандомизированных контролируемых испытаний среднего или высокого качества по оценке авторов систематического обзора, в результате которых было подготовлено в общей сложности 22 систематических обзора (таблица 2 ). .Анализ 313 испытаний и 46 826 участников продемонстрировал убедительные доказательства положительного воздействия пробиотических добавок в профилактике диареи, некротизирующего энтероколита, острых инфекций верхних дыхательных путей, обострений легких у детей с муковисцидозом и экземы у детей. Пробиотики также улучшают кардиометаболические параметры и снижают концентрацию в сыворотке С-реактивного белка у пациентов с диабетом 2 типа. Важно отметить, что исследования не были однородными и не обязательно соответствовали типу или дозе пробиотических добавок, а также продолжительности вмешательства, что ограничивает точные рекомендации.Новые области лечения пробиотиками включают использование новых микробов и их комбинаций, сочетание пробиотиков и пребиотиков (синбиотиков) 91 и индивидуальные подходы, основанные на профилях микробов-кандидатов при воспалении, раке, метаболизме липидов или ожирении.92 Стабильное приживление пробиотика Bifidobacterium longum , например, было показано, что он зависит от индивидуальных особенностей микробиоты кишечника, что дает обоснование для персонализации применения пробиотиков.93

    Таблица 2

    Резюме систематических обзоров, анализирующих роль пробиотиков в клинических исходах

    Персонализированное питание и будущие направления

    Учитывая различия в микробиоте кишечника у разных людей, может потребоваться адаптация оптимальной диеты человека к его микробиоте кишечника.Зееви и др. 94 получили многомерный профиль микробиоты у 900 человек и отслеживали потребление пищи, постоянный уровень глюкозы в крови и физическую активность в течение одной недели. Исследователи разработали алгоритм машинного обучения для прогнозирования персонализированных ответов глюкозы после еды на основе клинических данных и данных микробиома кишечника и показали, что он позволяет получать значительно более высокие прогнозы, чем такие подходы, как подсчет углеводов или оценка гликемического индекса. В последующем двойном слепом рандомизированном перекрестном исследовании с 26 участниками персонализированные диетические вмешательства, основанные на алгоритме, успешно нормализовали уровень глюкозы в крови.94

    Исследование реакции на хлеб68 с использованием рандомизированного перекрестного испытания однонедельных диетических вмешательств показало значительную межличностную вариабельность гликемической реакции на разные виды хлеба. Тип хлеба, который вызывал более низкий гликемический ответ у каждого человека, можно было предсказать, основываясь исключительно на данных микробиома, собранных до вмешательства.68 Требуются гораздо больше исследований, чтобы установить, являются ли эти виды персонализированных подходов осуществимыми, устойчивыми и имеют положительный эффект. по клиническим исходам.

    Выводы

    Мы вступаем в эпоху, когда мы можем все больше изменять здоровье с помощью продуктов питания и измерять воздействие с помощью наших микробов или метаболитов. Клетчатка является ключевым питательным веществом для здорового микробиома, и на нее не обращали внимания, пока велись дебаты о сахаре и жирах. Нельзя больше игнорировать неблагоприятное воздействие на микробиом лекарств и обработанных пищевых ингредиентов. Учитывая текущие пробелы в знаниях, нам нужны клинические доказательства, которые могут быть применены в клинической практике, в идеале с помощью рандомизированных контролируемых исследований, в которых используются согласованные матрицы пребиотиков или пробиотиков или трансплантация фекальной микробиоты для оценки изменений в составе микробиоты кишечника и в результатах для здоровья.

    Ключевые сообщения

    • Микробиота кишечника влияет на многие области здоровья человека, от врожденного иммунитета до аппетита и энергетического метаболизма

    • Нацеливание на микробиом кишечника с помощью пробиотиков или пищевых волокон приносит пользу здоровью человека и потенциально может снизить ожирение

    • Лекарства, пищевые ингредиенты, антибиотики и пестициды могут оказывать неблагоприятное воздействие на микробиоту кишечника

    • Микробиоту следует рассматривать как ключевой аспект в питании; медицинское сообщество должно адаптировать свое образование и сообщения общественного здравоохранения

    • Потребление клетчатки связано с положительными эффектами в нескольких контекстах

    Сноски

    • Участники и источники: AMV изучает молекулярные основы старения и сложных заболеваний и имеет недавно исследовали роль состава кишечного микробиома на кардиометаболические нарушения.JW изучал и широко освещал микробную экологию кишечной микробиоты, ее роль в здоровье хозяина и то, как она может регулироваться диетой. ES возглавляет многопрофильную лабораторию вычислительных биологов и ученых-экспериментаторов, специализирующуюся на питании, генетике, микробиоме и их влиянии на здоровье и болезни. Его цель - разработать индивидуальное питание и медицину. TDS возглавляет регистр TwinsUK и британский проект кишечника в качестве главы многопрофильной группы, изучающей генетические, диетические и образ жизни, определяющие состав микробиома кишечника человека и его связь с распространенными заболеваниями.Все авторы внесли, прочитали и одобрили окончательную версию.

    • Конкурирующие интересы: Мы прочитали и поняли политику BMJ в отношении конкурирующих интересов и заявляем следующее: AMV и TS являются консультантами Zoe Global. Компания JW получила финансирование исследований из промышленных источников, занимающихся производством и маркетингом пребиотиков и пищевых волокон, и является совладельцем Synbiotics Solutions, разработчика синбиотических продуктов. ES является консультантом DayTwo Inc. AMV финансируется Ноттингемским центром биомедицинских исследований NIHR.JW поддерживается через программу Campus Alberta Innovates и гранты Канадского института медицинских исследований (CIHR), Совета естественных и инженерных исследований Канады (NSERC), JPI HDHL и Канадского фонда инноваций. ES поддерживается Центром генома человека Crown; Фонд Эльзы Кроенер Фрезениус; Дональд Л. Шварц, Шерман-Окс, Калифорния; Джек Н. Халперн, Нью-Йорк, штат Нью-Йорк; Лиза Стейнберг, Канада; и гранты, финансируемые Европейским исследовательским советом и Израильским научным фондом.TwinsUK финансировался Wellcome Trust; Седьмая рамочная программа Европейского сообщества (FP7 / 2007-2013). Исследование также получило поддержку от Национального института исследований в области здравоохранения (NIHR), Центра клинических исследований BioResource и Центра биомедицинских исследований, базирующегося в Фонде NHS Гая и Сент-Томаса, и Королевского колледжа Лондона. TDS - старший следователь NIHR.

      Добавить комментарий

      Ваш адрес email не будет опубликован. Обязательные поля помечены *

    Болезнь Статус микробиоты Воздействие болезни
    Воспалительное заболевание кишечника Проблемные инфекции или сниженная степень защиты от микробов, антибиотики
    Спонтанный артрит Без микробов Без болезней
    Аутоиммунный артрит Без микробов Без болезней
    Аутоиммунный энцефаломиелит Без микробов Без микробов Без изменений
    Сахарный диабет 1 типа Без микробов Без микробов
    Спонтанная анкилозирующая энтеропатия Без микробов или пробиотиков Без микробов