Как долго лечится дисбактериоз кишечника у взрослых: Дисбактериоз кишечника – симптомы, диагностика, лечение — медцентр Аксис (Зеленоград)

Содержание

Дисбактериоз: кишечные баталии

Фото носит иллюстративный характер. Из архива «МВ».

Едва ли найдется человек, у которого никогда не было изжоги, отрыжки, тошноты, боли в животе, метеоризма или нарушений стула. Однако за медпомощью люди обращаются только в том случае, если симптомы регулярно дают о себе знать или проявляются остро. Большинство до поры до времени лечатся самостоятельно, пользуясь распространенными «желудочными» средствами на свое усмотрение. 

Цель — баланс

Пищеварительный тракт — гетерогенная бактериальная экосистема. Вследствие низкого значения pH желудок здорового человека можно считать стерильной средой. 

В кишечнике условия для роста микроорганизмов лучше. В тонком бактерий немного — 104–106/мл (высокое значение pH и быстрый транзит не способствуют увеличению их количества), а в толстом — в 100 000 раз больше.

Кишечник является строго анаэробной системой, богатой питательными веществами, с кислотностью среды от нейтральной до слабощелочной. Его бактериальная экосистема включает от 400 до 500 типов микроорганизмов, которые взаимодействуют. Многие являются компенсалами, помогают расщеплять неперевариваемые соединения, содержащиеся в пище.

У практически здоровых людей около 96% микрофлоры кишечника составляют представители облигатной (т. е. постоянно встречающейся) микрофлоры: бифидо- и лактобактерии, бактероиды, непатогенная кишечная палочка и др. 

Вторая группа, куда входят факультативная (непостоянная) и условно-патогенная микрофлора, занимает лишь 2–4% от общего количества микроорганизмов. При определенных условиях (снижение местного, а тем более общего иммунитета) вызывает внутрикишечные и общие нарушения. Факультативная группа представлена микрококками, протеем, стафилококками, клостридиями, цитробактерами и др. 

Третью группу составляет транзиторная (случайная) патогенная микрофлора: клостридии, синегнойная палочка, грибы рода Candida. На ее долю приходится 0,001–0,01%. 

В процессе постоянного вза­имодействия макро- и микроорганизмов формируется уникальная экосистема, находящаяся в состоянии динамического баланса. Существенную роль играют облигатные и факультативные анаэробы: бифидо-, лакто- и энтеробактерии, а также энтерококки. Бифидобактерии создают кислую среду и тем самым препятствуют размножению вредной микрофлоры. Кроме того, обладают выраженным антагонизмом в отношении патогенов, улучшают процессы пищеварения, поддерживают витаминный баланс и иммунный статус, участвуют в синтезе незаменимых аминокислот.

Нарушение бактериоэкологического равновесия в ЖКТ приводит к формированию дисбактериоза (дисбиоза) кишечника.

Нехорошие перемены 

Дисбактериоз кишечника — это клинико-лабораторный синдром, возникающий при разных патологических состояниях. Характерны изменения количественного и (или) качественного состава нормофлоры, метаболические и иммунологические нарушения; у некоторых пациентов добавляются симптомы поражения кишечника.

Кишечная микрофлора взрослого человека довольно устойчива к переменам в питании. Между тем стоит помнить, что еда, богатая углеводами, стимулирует бифидофлору и ведет к увеличению бактериальной массы толстого кишечника. Белковые блюда не влияют на спектр и количество кишечных бактерий, а жиры угнетают бифидобактерии и энтерококки, но стимулируют размножение бактероидов. «Пищевой» дисбиоз чаще носит временный характер и исчезает при переходе на здоровый сбалансированный рацион.

При заболеваниях местного и общего характера изменяется микробный пейзаж толстой кишки. Дисбактериоз регистрируется у большинства пациентов с поражением ЖКТ инфекционной и неинфекционной природы, после острых вирусных и бактериальных инфекций внекишечной локализации, при хронической воспалительной и аллергической патологии, у страдающих злокачественными заболеваниями и лейкозами, на фоне применения цитостатиков и особенно антибиотиков. Антибиотикозависимые дисбиозы стабильны и требуют активной терапии.

Сдвиги в микрофлоре кишечника вторичны — отражают воздействие факторов, изменяющих статус кишечника или внутренний баланс самого микробиоценоза. Нарушение микробного равновесия может осложнять многие патологические состояния, быть атерогенным явлением, связанным с антибактериальной, гормональной и другой терапией, несбалансированным питанием и т. д. 

Один из частых вариантов (удельный вес порой достигает 31%) дисбактериоза кишечника — кандидозный, при котором имеет место избыточный рост грибов рода Candida. Он нередко ассоциируется с пищевой аллергией и аллергическими заболеваниями вообще, а также с курением.

Лабораторные поиски

Клиническая картина дисбактериоза кишечника вариабельна, а выраженность симптоматики не всегда напрямую зависит от степени дисбиотических нарушений. Ранними и наиболее специфическими симптомами можно считать повышенное газообразование, нарушение переваривания пищи (кишечная диспепсия), изменение характера стула; при развитии дисбактериоза на фоне колита — болевой синдром, патологические примеси в кале (слизь). В более тяжелых случаях добавляются интоксикация, диарея и обезвоживание, снижение массы тела.

В диагностике и трактовке кишечного дисбактериоза большое значение имеет копрологическое исследование, дающее возможность охарактеризовать пищеварительную, ферментовыделительную, всасывательную и двигательную функции кишечника. В последнее время получили распространение методы, основанные на выявлении метаболитов микроорганизмов, — газожидкостная и ионная хроматография. В лабораториях проводят бактериологические исследования фекалий и посев на питательные среды соскобов со слизистых оболочек.

Золотым стандартом диагностики синдрома избыточного роста бактерий считается интестиноскопия с аспирацией содержимого тонкой кишки и посевом аспирата на питательную среду. Но эта методика сложна, требует общей анестезии и хорошей бактериологической базы с возможностью культивирования аэробов и анаэробов, а результат приходится ждать порядка 10 дней.

Синдром избыточного роста бактерий выявляется также по данным дыхательного теста с меченым Н2 — с лактулозой или галактозой. Бактерии разлагают лактулозу, в результате чего освобождается меченый Н2, концентрация которого затем может быть измерена в выдыхаемом воздухе. В норме лактулоза расщепляется лишь микрофлорой в толстом кишечнике. При дисбиозе и тонкая кишка заселяется микроорганизмами, расщепляющими лактулозу. При этом следует исключить ускоренное продвижение субстрата по тонкой кишке.

Посев дуоденального аспирата тоже подтверждает синдром избыточного роста бактерий: при патологии содержание микроорганизмов >106/мл (общее количество бактерий в просвете тощей кишки не превышает 104–106/мл).

Микрофлора различных отделов пищеварительного тракта значительно отличается количественно и качественно.+

Микробиологическое исследование фекалий лишь косвенно может свидетельствовать о микробном неблагополучии, т. к. состав фекальной микрофлоры отражает ситуацию только в толстой кишке, а точнее — в дистальном отделе.

Настрой на победу 

Профилактика и особенно лечение дисбактериоза кишечника должны быть комплексными и предполагать:

  • устранение избыточного бактериального обсеменения тонкой кишки;
  • восстановление нормальной микробной флоры толстой кишки; 
  • улучшение кишечного пищеварения и всасывания;
  • восстановление нормальной моторики кишечника;
  • стимулирование реактивности организма.

Важнейшими нормальными обитателями толстого кишечника человека являются бифидобактерии (вид анаэробных палочковидных грамположительных бактерий) — 3–7% от общей фекальной микрофлоры взрослых. Нужны и лактобактерии.

Восстановлению качества и количества бифидобактерий способствует увеличение в рационе пектинов (растворимых пищевых волокон), а для лактобактерий лучшие продукты — кисломолочные. Антибиотическую активность последних повышают путем добавления никотиновой кислоты (на 1 л — 6–8 мг), тиамина (4–6 мг), токоферола (1–3 мг).

Для профилактики и лечения дисбактериоза широко используются пробиотики и пребиотики.

Пробиотики — это живые микроорганизмы (молочнокислые бактерии, чаще бифидо- или лактобактерии), нормальные обитатели кишечника здорового человека, улучшающие микробный баланс. Обладают антагонистическими свойствами по отношению к патогенам (третья группа): конкурируют за рецепторы на эпителиоцитах, питательные вещества; способны выделять ингредиенты (цитокины, масляную кислоту), ингибирующие рост патогенных бактерий. Монокультуру или комплекс живых микроорганизмов дополняют веществом, стимулирующим их колонизирующую способность и размножение. 

Пробиотики содержатся в молочных продуктах со специальной закваской, кукурузных хлопьях, крупах, черном хлебе.

При наличии бродильных процессов в кишечнике надо ограничивать углеводы, пищевые волокна (клетчатку), при гнилостных — белки и жиры. 

Каждому, у кого высок риск развития дисбиоза, следует избегать цельного молока, бобовых, а также продуктов, богатых эфирными маслами (чеснок, зеленый лук, репа, редька). 

Для стабилизации микрофлоры кишечника в рацион включают морковный сок, сою, дрожжевой, тыквенный, картофельный и рисовый экстракты, молочную сыворотку и молозиво (обладают бифидогенным действием). 

Используют растительные компоненты и при стафилококковом дисбактериозе. Полезны лесная земляника, рябина, малина, черника, шиповник, черная смородина. При протейном дисбактериозе нужны абрикосы и черная смородина; при наличии гнилостных бактерий — клюква и абрикосы. Если имеет место избыточный рост грибов рода Candida, стоит налегать на бруснику, стручковый перец, морковь. 

При торпидно протекающем дисбактериозе рекомендуют дополнять лечение, подключая эффект от приема эвкалипта, календулы, аира, зверобоя. Когда подтвержден грибковый дисбактериоз с бродильной диспепсией, положительное влияние окажет цикорий растворимый. 

Кроме пробиотиков, важное значение в профилактике и лечении дисбактериоза кишечника имеют пребиотики (к ним в основном относят растворимые пищевые волокна класса углеводов: фруктоолигосахариды, галактоолигосахариды). В желудке и тонкой кишке они избегают гидролиза пищеварительными ферментами и достигают толстой кишки в неизменном виде. Там подвергаются ферментации бифидо- и лактобактериями, что приводит к увеличению количества флоры и объема каловых масс. При этом важно подчеркнуть, что фруктоолигосахариды представляют собой энергетический субстрат для представителей нормальной микрофлоры кишечника (бифидо- и лактобактерий). В процессе ферментации образуются короткоцепочечные жирные кислоты (преимущественно уксусная, пропионовая, масляная), которые снижают рН в кишечнике, стимулируют перистальтику.

Укреплению защитного барьера толстой кишки при потреблении пребиотиков способствует и стимуляция выработки в ней слизи. Повышенное слизеобразование энтероцитами может быть следствием снижения рН при возросшем синтезе короткоцепочечных жирных кислот микро­флорой кишечника в ответ на введение пребиотиков. Свойствами пребиотиков в наибольшей степени обладают инулин, лактулоза, лактил, олигосахариды, лактоолигосахариды, хилак форте и др.

Инулин присутствует в клетках цикория, артишока, корней одуванчика, клубней топинамбура, фасоли, петрушки. Наиболее хорошо изучен как бифидогенный фактор — избирательно ускоряет рост и метаболизм бифидобактерий. Прием 5 г/день олигофруктозы или ≤8 г/день инулина обеспечивает значительное изменение состава кишечной микрофлоры, увеличивая численность бифидобактерий и снижая количество патогенов.

Пробиотики и пребиотики могут применяться для профилактики и лечения дисбактериоза кишечника, в т. ч. при назначении эрадикационных схем лечения Helicobacter pylori при гастроэзофагеальной рефлюксной, язвенной болезни желудка и двенадцатиперстной кишки, эрозивных гастро- и дуоденопатиях.

Применение антибиотиков нежелательно, т. к. они могут усугублять дисбиоз кишечника. Целесо­образно использовать препараты, минимально влияющие на симбиотическую флору и в тоже время подавляющие рост патогенных микроорганизмов. К таким относятся нитрофураны (нифуроксазид, интетрикс) — т. н. кишечные антисептики.

Пациентам с кишечной диспепсией показаны ферментные препараты. Чаще используют панкреатин (мезим форте, трифермент, креон). При стеаторее и гипомоторной дискинезии кишечника к панкреатину добавляют желчные кислоты (панзинорм), при бродильных расстройствах — гемицеллюлозу (фестал, энзистал, дигестал). Для улучшения процессов всасывания можно назначать мембраностабилизирующие препараты (карсил, эссенциале).

При дисбактериозе, особенно в период реабилитации, показаны иммуномодуляторы (натрия нуклеинат, витамины), растительные адаптогены (элеутерококк, женьшень, эхинацея). Когда отмечена тенденция к лейкопении и требуется усилить эпителизацию слизистой оболочки, можно использовать метилурацил и пентоксил (не более двух недель).

Иван Броновец, профессор кафедры кардиологии и внутренних болезней БГМУ, доктор мед. наук
Медицинский вестник, 12 сентября 2016

Дисбактериоз после антибиотиков - симптомы, причины и лечение

Открытие антибиотиков помогло сохранить жизни и здоровье множеству людей в ситуациях, в которых ранее врачи могли рассчитывать лишь на чудо1,8. Однако антибиотики способны уничтожать не только болезнетворные бактерии, но и представителей нормальной микрофлоры кишечника. Поэтому они могут являться одной из причин нарушения здорового баланса микроорганизмов в просвете кишечника и могут способствовать развитию дисбактериоза2. Почему антибиотики могут вызвать дисбактериоз и можно ли с этим бороться? Мы нашли для вас ответы на эти и другие важные вопросы о непростых взаимоотношениях антибиотиков и кишечной микрофлоры.

Кто в здоровом кишечнике живет?

Полное здоровье кишечника невозможно без микроорганизмов, которые начинают заселять желудочно-кишечный тракт с первых дней жизни ребёнка, и постепенно формируют умеренно стабильную по бактериальному составу среду, помогающую организму переваривать пищу и получать нужные питательные вещества3,4.

В составе нормальной микробной флоры кишечника преобладают бифидо- и лактобактерии, а также бактероиды, энтерококки и кишечная палочка. Их и ещё несколько разновидностей бактерий называют облигатной, то есть постоянной, флорой кишечника. Облигатная флора составляет 95-98% от нормальной микрофлоры кишечника. Другие виды микроорганизмов относятся к добавочной и транзиторной микрофлоре (1-4%). В неё входят грибы, стафилококки и условно-патогенные микробы, представляющую потенциальную угрозу для здоровья человека4. Каждая группа микроорганизмов имеет различную степень восприимчивости к действию антибиотиков3.

Роль нормальной микрофлоры в пищеварении и не только

Установлено, что нарушение микрофлоры кишечника связано не только с развитием заболеваний пищеварительной системы, но и с появлением проблем со стороны других систем организма, не имеющих прямого отношения к процессам пищеварения7.

Это объясняется тем, что бактерии, обитающие в здоровом кишечнике, выполняют работу, которая оказывает влияние на многие важные процессы в организме человека:

  • Выработка ферментов3,6.
  • Участие в работе иммунной системы. Бифидобактерии стимулируют образование некоторых видов антител, а лактобактерии повышают активность отдельных клеток, участвующих иммунном ответе (лимфоцитов, фагоцитов)3,6.
  • Защитная функция. Микрофлора кишечника выделяет собственные антимикробные вещества, которые препятствуют заселению пищеварительного тракта болезнетворными бактериями, неизбежно попадающими в него при приёме пищи3.
  • Выработка витаминов, необходимых для нормального обмена веществ (витамины группы К) 3,6,11.

Причины нарушения микрофлоры после приёма антибиотиков

Для современных антибиотиков характерен широкий спектр действия, что, с одной стороны, хорошо, так как помогает бороться с бактериальными инфекциями, даже когда их возбудитель не известен. Но с другой стороны невозможно направить действие антимикробных препаратов только на вредные микроорганизмы. К ним оказываются восприимчивы и некоторые представители нормальной микрофлоры кишечника. Они тоже разрушаются и гибнут в ходе лечения8. Тогда микроорганизмы, которые оказываются устойчивы к препарату, получают возможность размножаться более активно, занимая место погибших полезных бактерий. Так антибиотики изменяют качественный и количественный состав микрофлоры кишечника и могут привести к активации условно-патогенных микробов. Иногда после завершения курса антибиотиков микрофлора кишечника способна восстановиться самостоятельно, но для этого требуется время, и восстановление может быть неполным8.

На фоне нарушения нормального состава микрофлоры кишечника, вызванного приёмом антибиотиков, могут возникать симптомы, характерные для дисбактериоза (жидкий стул, вздутие живота и др.), но состояние бывает и бессимптомным. Восстановление нормального баланса микроорганизмов в кишечнике может помочь избавиться от этих симптомов8.

Антибиотики: вред или польза?

Без антибиотиков медицина бы утратила мощное оружие, которое позволяет быстро направить течение многих тяжёлых заболеваний в сторону выздоровления или обеспечить людям восстановление без инфекционных осложнений после операций разной степени сложности1,8. Но состояние микрофлоры кишечника после курсового лечения антимикробными препаратами может ухудшиться2.

Любое применение антибиотика должно быть оправданным, поэтому избегайте самолечения. И помните, что нарушенная микрофлора требует восстановления3,7.

Как устранить дисбактериоз после антибиотиков?

Современный подход к восстановлению состава нормальной микрофлоры кишечника заключается в применении специальных препаратов разного механизма действия:

  • Метабиотики, продукты обмена бактерий нормальной микрофлоры, способствующие восстановлению нормальной микрофлоры кишечника биологическим путем и позволяющие сохранить физиологические и биологические функции слизистой оболочки кишечника;
  • пробиотики, которые содержат живые бактерии и призваны восполнить недостаток собственных;
  • пребиотики, питательная среда, способствующая размножению бактерий.

Некоторые из этих препаратов рассматриваются не только как средство для восстановления кишечной микрофлоры после лечения антибиотиками, но и как элемент комплексного лечения кишечных расстройств, улучшающий защиту организма от болезнетворных бактерий2,8,12.

Хилак форте является метабиотиком №1 на российском рынке9. Хилак форте сохраняет свою эффективность при совместном приёме с антибиотиками, так как в отличие от пробиотиков не содержит живых бактерий, поэтому его действие не подавляется одновременным приёмом антибиотиков. Другим достоинством Хилак форте при лечении дисбактериоза после и вовремя курса приёма антибиотиков – это удобные формы выпуска (саше и капли). Одно из достоинств Хилак форте при лечении дисбактериоза после или во время курса приёма антибиотиков – это удобные формы выпуска (саше и капли). Как только болезнь после курса антибиотикотерапии отступает, большинство людей вынуждены закрывать больничный и выходить на работу, или просто торопятся разобраться с делами, которые скопились за время их болезни. Находясь вне дома, люди сталкиваются с затруднениями при восстановлении микрофлоры кишечника, потому что далеко не все пробиотики можно легко носить с собой и принимать в любом месте в удобное время. Хилак форте выпущен в форме саше, которые можно спокойно носить в своей сумке или в кармане одежды. Хилак форте способствует восстановлению нормального баланса микроорганизмов в кишечнике, где бы вы ни находились: на работе, или в путешествии.

 

1. Lee Ventola C. The Antibiotic Resistance Crisis. P T. 2015 Apr; 40(4): 277–283.

2. Francino M. P. Antibiotics and the Human Gut Microbiome: Dysbioses and Accumulation of Resistances. Front Microbiol. 2015; 6: 1543.

3. Аджигайтканова С.К. Подходы к медикаментозному лечению дисбактериоза кишечника // РМЖ. 2007. №2. С. 73.

4. Щербаков П.Л., Нижевич А.А., Логиновская В.В., Щербакова М.Ю., Кудрявцева Л.В., Митрохин С.Д., Нуртдинова Н.М., Очилова Р.А. Микроэкология кишечника у детей и ее нарушения. «Фарматека» 2007, № 14, с. 28-34.

5. Fröhlich E.E., Farzi A., Mayerhofer R., Reichmann F., Jačan A., Wagner B., Zinser E., Bordag N., Magnes C., Fröhlich E., Kashofer K., Gorkiewicz G., Holzer P. Cognitive impairment by antibiotic-induced gut dysbiosis: Analysis of gut microbiota-brain communication. Brain Behav Immun. 2016 Aug;56:140-55.

6. Morowitz, M. J., Carlisle, E., & Alverdy, J. C. (2011). Contributions of Intestinal Bacteria to Nutrition and Metabolism in the Critically Ill. The Surgical Clinics of North America, 91(4), 771–785. https://journals.sagepub.com/doi/10.1177/1756283X10373814.

7. Carding, S., Verbeke, K., Vipond, D. T., Corfe, B. M., & Owen, L. J. (2015). Dysbiosis of the gut microbiota in disease. Microbial Ecology in Health and Disease, 26, 10.3402/mehd.v26.26191. https://www.tandfonline.com/toc/zmeh30/current.

8. Langdon, A., Crook, N., & Dantas, G. (2016). The effects of antibiotics on the microbiome throughout development and alternative approaches for therapeutic modulation. Genome Medicine, 8, 39. https://journals.sagepub.com/doi/10.1177/1756283X10373814.

9. Хилак форте –лидер по продажам в деньгах  в 2016 г. среди метабиотиков  по данным АМ ЭМ ЭС Хэлс.

10. Verna, E. C., & Lucak, S. (2010). Use of probiotics in gastrointestinal disorders: what to recommend? Therapeutic Advances in Gastroenterology, 3(5), 307–319. https://journals.sagepub.com/doi/10.1177/1756283X10373814.

11. Conly J.M., et al. The contribution of vitamin K2 (menaquinones) produced by the intestinal microflora to human nutritional requirements for vitamin K. Am J Gastroenterol. 1994;89(6):915–23".

12. Инструкция по применению лекарственного препарата для медицинского применения.

13. HLKF-RU-00259-Cons.

Подходы к медикаментозному лечению дисбактериоза кишечника | Аджигайтканова С.К.

Под общим понятием «дисбактериоз» подразумевается клинико–лабораторный синдром, возникающий при ряде заболеваний и клинических ситуаций, характеризующийся изменением качественного и/или количественного состава нормальной микрофлоры, метаболическими и иммунными нарушениями, сопровождающимися у части больных клиническими проявлениями [1]. Таким образом, дисбактериоз – это не диагноз, а со­стоя­ние.

При дисбактериозе кишечника появляется значительное количество микробов в тонкой кишке и изменение микробного состава толстой кишки. В толстой кишке меняется общее количество и свойства микроорганизмов, усиливается их инвазивность и агрессивность [11].
Причин дисбактериоза кишечника может быть несколько: это гипо– и ахлоргидрия желудка (особенно при нарушении эвакуации из него), синдром приводящей петли после резекции желудка по Бильрот–2, тощекишечные и дуоденальные дивертикулы, синдром слепой петли при тонко–толстокишечных анастомозах конец в бок, непроходимость кишечника, хронический панкреатит, иммунодефициты, бездумное и бесконтрольное применение антибиотиков, приводящее к гибели значительной части представителей нормальной микрофлоры, чувствительных к препарату, и размножению устойчивой к нему микрофлоры, в т.ч. патогенной и условно–патогенной, нарушения питания, употребление алкоголя и др. Известно, что этиотропная терапия острых и хронических желудочно–кишечных заболеваний, особенно квадритерапия хронического гастрита, язвенной болезни желудка и двенадцатиперстной кишки, ассоциированных с Helicobacter pylori, в 100% случаев ведет к усугублению дисбиотических явлений [13].
Дисбактериозами страдают пациенты практически всех стационаров и амбулаторных служб, жители экологически неблагоприятных регионов, нарушения нормальной микрофлоры которых формируются в результате воздействия на организм физических, химических, радиационных и других факторов [4,10].
С современных позиций нормальную флору рассматривают как совокупность микробиоценозов различных частей тела. Для полного здоровья человека характерно состояние равновесия микроэкологии организма. Кишечник здоровых людей представляет собой пример сбалансированного взаимодействия между защитными силами макроорганизма и микробными ассоциациями. В состав флоры содержимого толстого кишечника входят анаэробные и аэробные бактерии. Нормальная микрофлора на 95% состоит из анаэробных видов бактерий, главными из которых являются бифидобактерии и лактобактерии. Функции полезной микрофлоры в организме человека неоценимы. Перечислим наиболее важные из них.
Ферментопродуцирующая функция: нарушение и гибель полезной микрофлоры в организме ведет к тому, что нарушается метаболизм разнообразных субстратов растительного, животного и микробного происхождения – глюкозы, фруктозы, лактозы, а также более сложных соединений, содержащих углеводы. Лактобак­те­рии нейтрализуют действие фенольных ферментов, поддерживающих разрастания раковых клеток в кишечнике, препятствуя тем самым развитию рака молочной железы и толстого кишечника. Важную роль микрофлора кишечника играет в метаболизме белков. Бакте­ри­альные протеазы гидролизуют белки и пептиды, а последние под действием бактероидов гидролизуются до аминокислот и пептидных остатков. Одним из свойств нормофлоры является метаболизм азот– и углеродосодержащих соединений за счет микробных ферментов. Метаболизм мочевины в кишечнике происходит за счет микробных уреаз. Микрофлора кишечника участвует в деградации липидов и в их синтезе. Нормальная микрофлора принимает участие в рециркуляции желчных кислот и активно влияет на холестериновый и билирубиновый метаболизм.
Защитная функция: нормальная микрофлора ки­шеч­ника в процессе эволюции приобрела исключительно важную роль в формировании колонизационной резистентности организма. Одним из главных механизмов защиты от колонизации условно–патогенными и патогенными бактериями является присутствие в организме достаточного количества собственной полезной микрофлоры, к которой, в первую очередь, относятся лакто– и бифидобактерии. Очень важным фактором защиты является то, что представители нормофлоры продуцируют бактериоцины, лизоцим и другие антибиотикоподобные вещества, обуславливающие антагонистическую активность этих бактерий. Представители нормофлоры в кишечнике конкурируют с патогенной флорой за аргинин, треонин, аспарагиновую кислоту, серин, за область обитания – экологические ниши.
Синтетическая функция: бактерии кишечной флоры синтезируют витамины, необходимые для метаболических реакций. Бифидобактерии синтезируют витамины группы В, в частности, никотиновую, фолиевую кислоты, тиамин, биотин, цианокобаламин, а также аминокислоты и белки, обеспечивающие их всасывание. Лакто­бак­те­рии образуют молочную кислоту, продуцируют лизоцим, леколин, низин, ацидофилин и др. Кишечная палочка способствует синтезу иммуноглобулинов, что препятствует развитию инфекции, вырабатывает канцеролитические вещества. Продуцируя молочную кислоту, бифидо– и лактобактерии создают в кишечнике кислую среду, подавляя гнилостную флору и способствуя всасыванию кальция, витамина Д и железа. Большое значение имеет продуцирование анаэробами биологически активных соединений – летучих жирных кислот, которые принимают участие в рециркуляции и абсорбции ионов натрия, калия, хлора, воды, а также кальция, магния и цинка. Кишечная нормофлора способна разлагать белки до конечных продуктов распада (индол, фенол, скатол), утилизировать непереваренные пищевые субстраты, образуя органические кислоты, аминокислоты и другие соединения, которые нормализуют обмен веществ в организме. Микрофлора кишечника, в конечном счете, поддерживает водный, электролитный и кислотно–щелочной балансы в организме.
Иммунногенная функция: нормальная микрофлора способствует пролиферации плазматических клеток. Бифидобактерии стимулируют синтез антител к овальбумину, лактобактерии повышают активность фагоцитов и лимфоцитов. Повышение численности бифидо– и лактобактерий при их недостатке приводит к положительному эффекту в уменьшении воспалительных процессов слизистой кишечника и увеличении В–лимфоцитов в периферической крови. Иммуностимулирующий эффект под воздействием нормофлоры проявляется усилением фагоцитарной активности макрофагов, моноцитов, увеличением специфического А, синтезом цитокинов, стимуляцией клеточных иммунных механизмов защиты. К сожалению, не до конца оправдывают себя фагопрофилактика и фаготерапия дисбактериоза. Тому есть ряд причин: слишком узкая специфичность, быстрое появление фагорезистентных штаммов патогенных бактерий, а также возможность сенсибилизации организма этим видом чужеродного белка. Кроме того, фаги плохо сорбируются в коллоидной среде, так что трудно представить возможность их бактерицидности в толстом кишечнике, где бактерии окутаны слизью и перемешаны с фекальными массами. Проблемой является доставка фагов к «месту назначения». В частности, практикуемое введение препаратов при помощи клизмы не обеспечивает поступления фагов в проксимальные отделы толстого кишечника, где может быть локализован основной дисбиотический процесс, то же касается и введения фагов в виде ректальных свечей. Даже высокая эффективность бактериофагов не гарантирует его эффективности при введении в организм.
Симптомы дисбактериоза напрямую связаны с заболеванием или состоянием, которое вызвало дисбактериоз, и являются неспецифичными и разнообразными: снижение или отсутствие аппетита, тошнота, рвота, металлический привкус во рту, боли в животе (тупые или схваткообразные), возникающие спонтанно и при пальпации, отрыжка, метеоризм, чувство неполного опорожнения кишечника, императивные позывы на дефекацию, запоры, понос, заеды, зуд кожи и слизистых, высыпания на коже (при развитии аллергических реакций), утомляемость.
Необходимо помнить о том, что дисбактериоз всегда усугубляет течение хронических болезней пищеварительного тракта, а потому это состояние всегда требует своевременной диагностики и лечения. Лечение патологических состояний, связанных с дисбактериозом, должно быть комплексным и направленным на устранение избыточного бактериального обсеменения кишечника условно–патогенной микрофлорой, восстановление нормальной микрофлоры и нарушенной моторики толстого кишечника, улучшение кишечного пищеварения и всасывания, стимулирование реактивности организма.
В связи с этим в лечении дисбактериоза кишечника используются следующие группы препаратов: антибактериальные средства и антисептики, пробиотики, пребиотики, синбиотики, пищеварительные ферменты, регуляторы моторики кишечника, стимуляторы реактивности организма.
Применение антибиотиков должно быть оправданным, т.к. они сами могут оказывать губительное влияние на симбионтную микробную флору толстого кишечника. Антибактериальные средства желательно применять при наличии абсолютных показаний, таких как бактериемия и угроза энтерогенного сепсиса, причиной которых является дисбактериоз. Достаточно часто антибиотики применяют при избыточном обсеменении тонкой кишки условно–патогенной флорой, при заболеваниях, сопровождающихся нарушением всасывания и моторики кишечника [15]. Применяются препараты фторхинолоновой группы (офлоксацин или норфлоксацин по 400 мг 2 раза в сутки в течение 5–7 дней), пенициллины (амоксициллин по 500 мг 3 раза в сутки в течение 5–7 дней), тетрациклины (доксициклин по 100 мг 2 раза в сутки в течение 3–5 дней).
Наиболее предпочтительными препаратами при дисбактериозе кишечника являются антимикробные препараты, такие как ко–тримоксазол (по 480 мг 2 раза в сутки в течение 7 дней), налидиксовая кислота (по 1 г 4 раза в сутки в течение 7 дней), нифуроксазид (по 200 мг 4 раза в сутки в течение 5–7 дней), фуразолидон (по 100 мг 4 раза в сутки в течение 7 дней), антисептики – интетрикс (по 2 капс. 2 раза в сутки в течение 7 дней).
Препараты, применяемые для восстановления нормальной микрофлоры кишечника, принято подразделять на 3 группы: пробиотики, пребиотики и синбиотики [4,6,7,9,14,18].
Пробиотики – это живые микроорганизмы и вещества микробного происхождения, оказывающие при естественном способе введения позитивные эффекты на физиологические, биохимические и иммунные реакции организма хозяина через стабилизацию и оптимизацию функции его нормальной микрофлоры [2,3,14,16,17].
В России зарегистрировано несколько бифидосодержащих препаратов, которые применяются для лечения дисбактериоза в течение 2–3 недель.
Составляющим этих препаратов являются живые бифидобактерии, которые обладают антагонистической активностью против широкого спектра патогенных и условно–патогенных бактерий, основное назначение – обеспечение быстрой нормализации микрофлоры кишечного тракта. Быстрое заселение кишечника бифидобактериями способствует нормализации количественного и качественного состава микрофлоры и стимулирует репаративный процесс слизистой оболочки кишечника [1–6,9]. Ряд преимуществ имеет препарат бифиформ. Первое из них заключается в том, что капсула препарата кислотоустойчива, т.е. не растворяется соляной кислотой и пепсином. Это обеспечивает высвобождение в кишечнике высоких концентраций содержащихся в препарате бактерий практически без их инактивации на уровне желудка. Вторым важным преимуществом и особенностью бифиформа является наличие в его капсуле специфических факторов, которые, освобождаясь в кишечнике, ускоряют и усиливают его колонизацию бифидобактериями и энтерококками, причем бифидобактерии колонизируют толстую, а энтерококки – и толстую, и тонкую кишку.
Не менее важное место занимают лактосодержащие препараты. Длительность лечения зависит от причины развития дисбактериоза и индивидуальных особенностей (от 2 недель до 1,5 месяцев). Дей­ствующим началом этих препаратов являются живые лактобациллы, обладающие широким спектром антагонистической активности за счет продукции органических кислот, микробного лизоцима, перекиси водорода и различных антибиотических веществ. Лактобациллы синтезируют различные ферменты и витамины, принимающие участие в пищеварительной деятельности желудоч­но–ки­шеч­ного тракта, обладают иммуномодулирующим действием, важным для восстановления естественных иммунных факторов защиты организма [2–6,9,17,18].
Коли–содержащие препараты применяются в течение 1–3 месяцев. Они обладают антагонистической активностью в отношении широкого спектра патогенных и условно–патогенных микроорганизмов, включая шигеллы, сальмонеллы, протей; оказывают корригирующее воздействие на нарушенный микробиоценоз; стимулируют местные репаративные процессы в кишечнике; способствуют улучшению пищеварения и обмена веществ; стимулируют естественные факторы защиты. Могут применяться для лечения больных хроническими колитами разной этиологии, реконвалесцентов острых кишечных инфекций при наличии дисфункций кишечника, протекающих на фоне дисбактериоза.
Сухие препараты достаточно долго хранятся при комнатной температуре. Но есть существенный недостаток – после процесса лиофилизации бактерии ослаб­лены и плохо приживаются в кишечнике, так как требуется 8–10 часов для их перехода от анабиоза к активному физиологическому состоянию, но к этому времени большая их часть уже элиминируется из кишечника.
Жидкие препараты представляют собой микробную массу бактерий в живой активной форме и имеют ряд преимуществ перед сухими: бактерии находятся в активном состоянии и способны к колонизации ЖКТ уже через 2 часа после попадания в организм; жидкие препараты кроме бактерий содержат продукты их жизнедеятельности – незаменимые аминокислоты, органические кислоты, интерферонстимулирующие вещества.
Пребиотики – это препараты немикробного происхождения, способные оказывать позитивный эффект на организм хозяина через селективную стимуляцию роста или усиления метаболической активности нормальной микрофлоры кишечника [1–4,8–9]. В эту группу входят препараты, относящиеся к различным фармакотерапевтическим группам, но обладающие общим свойством – стимулировать рост и развитие нормальной микрофлоры кишечника.
Из пребиотиков чаще всего используется Хилак форте. Хилак форте представляет собой стерильный концентрат продуктов обмена веществ нормальной микрофлоры кишечника: молочную кислоту, аминокислоты и жирные кислоты. Препарат способствует восстановлению нарушенной нормальной микрофлоры кишечника биологическим путем, вызывая сдвиг рН в ЖКТ в границах физиологической нормы, что создает неблагоприятные условия для развития патогенной и условно–патогенной микрофлоры, обеспечивает санацию кишечника. Продукты метаболизма улучшают трофику и функцию эпителиоцитов и колоноцитов. Хилак форте назначают по 40–60 капель 3 раза в сутки на срок до 4 нед. в сочетании с препаратами антимикробного действия или после их применения.
По данным, приведенным в литературе, на сегодняшний день известно, что применение капель Хилак форте у больных хроническими заболеваниями органов пищеварения, осложненных дисбактериозом, способствовало уменьшению частоты дефекаций примерно вдвое уже через 3–5 суток после начала приема препарата. Больные отмечали также значительное уменьшение клинических проявлений. Использование препарата способствовало положительной динамике копрологических показателей: содержание перевариваемой клетчатки, внутриклеточного крахмала и йодофильной микрофлоры, определявшихся в значительном количестве у подавляющего числа больных до начала лечения Хилак форте, существенно уменьшалось в среднем через 2 недели от начала лечения, а к концу курса терапии в фекалиях практически не определялись крахмальные зерна и непереваренные мышечные волокна.
Использование Хилак форте улучшало микробное содержание толстой кишки. В процессе лечения у большинства больных 1 и 2 стадии дисбактериоза кишечника достигалась полная нормализация микробиоценоза. У больных с тяжелыми нарушениями кишечной микрофлоры (дисбактериоз 3 и 4 стадии), хотя и не был полностью достигнут эубиоз, наблюдалось уменьшение относительного количества эшерихий, стафилококков и бактерий рода клебсиелл и протея в фекалиях, что свидетельствовало о положительном влиянии препарата на состав кишечной микрофлоры. Кроме того, Хилак форте прекрасно переносился больными. Не было зарегистрировано побочных эффектов, которые бы потребовали его отмены.
Нами Хилак форте использовался у больных хронической алкогольной интоксикацией, у которых отмечались клинические проявления дисбактериоза. При длительном применении нормализовался стул, уменьшались диспесические явления.
В качестве пребиотиков также используют такие средства, как лактулоза, кальция пантотенат, лизоцим и др.
Синбиотики – это препараты, полученные в результате рациональной комбинации пробиотиков и пребиотиков. Часто это биологически активные добавки, входящие в состав функционального питания, обогащенные одним или несколькими штаммами представителей родов Lactobacillus и Bifidobacterium. В России известны несколько препаратов, содержащих бифидогенные факторы и биомассу B. bifidum, B. adolescentis, L. plantarum, мальтодекстрин, L. acidоphilus, L. bulgaricus, фруктоолигосахариды из топинамбура в комбинации и количестве, наиболее характерных для определенного возраста ребенка, подростка и взрослых лиц.
Регуляторы пищеварения и моторики кишечника назначаются в зависимости от наличия заболевания, явившегося причиной дисбактериоза.
Для повышения реактивности организма ослабленным больным также применяют иммуностимулирующие средства.
Таким образом, дисбактериоз является сложным симптомокомплексом, возникающим на фоне различных факторов и заболеваний. Лечение дисбактериоза достаточно сложное, требующее большого вклада сил и средств. В связи с этим необходимо проведение вторичной профилактики дисбактериоза: осторожно применять антибактериальные препараты, пытаться свое­временно диагностировать и лечить хронические заболевания желудочно–кишечного тракта.

Литература
1. Отраслевой Стандарт «Протокол ведения больных. Дисбактериоз кишечника» (ОСТ 91500.11.0004–2003, Приказ Министерства здравоохранения РФ № 231 от 09.06.2003)
2. Бондаренко В.М., Воробьев А.А. Дисбиозы и препараты с пробиотической функцией. //Журн. микробиол. 2004. № 1.С. 84–92.
3. Бондаренко В.М., Грачева Н.М. Препараты пробиотики, пребиотики и синбиотики в терапии и профилактике кишечных дисбактериозов. // Фарматека. 2003.№ 7. С.56–63.
4. Бондаренко В.М., Грачева Н.М., Мацулевич Т.В. Дисбактериозы кишечника у взрослых. КМК Scientific Press. Москва, 2003. С.224.
5. Бондаренко В.М., Грачева Н.М., Мацулевич Т.В., Воробьев А.А.. Микроэкологические изменения кишечника и их коррекция с помощью лечебно–профилактических препаратов. Журн. гастроэнтерол. гепатол. колопроктол. 2003. № 4 (приложение № 20).С. 66–76.
6. Бондаренко В.М., Чупринина Р.П., Воробьева М.А. Механизм действия пробиотических препаратов. БиоПрепараты. 2003. № 3. С. 2–5.
7. Вахитов Т.Я., Момот Е.Н., Шалаева О.Н.и др. Состав и биологическая активность экзометаболитов Escherichia coli M–17. //Журн. микробиол. 2003; 6: 20–5.
8. Грачева Н.М., Бондаренко В.М. Пробиотические препараты в терапии и профилактике дисбактериоза кишечника. Инфекц. бол. 2004; 2: 53–8.
9. Звягинцева Т.Д., Сергиенко Е.И. Дисбактериоз кишечника: клиническое значение и перспективы лечения. //Эксперим. клин. гастроэнтерол. 2003. № 3. С.70–74.
10. Лобзин Ю.В., Макарова В.Г., Корвякова Е.Р., Захаренко С.М. Дисбактериоз кишечника (клиника, диагностика, лечение). СПб., 2003.
11. Парфенов А.И. Энтерология. Москва., 2002.
12. Парфенов А.И., Осипов Г.А., Ручкина И.Н., Справ.поликл.врача. 2003. №3, Т.3.
13. Чернин В.В., Червинец В.М., Бондаренко В.М., Базлов С.Н. Язвенная болезнь, хронический гастрит и эзофагит в аспекте дисбактериоза эзофагогастродуоденальной зоны. Тверь: Триада, 2004.
14. Collins M.D., Gibson G.R. Probiotics, prebiotics, and synbiotics: approaches for modulating the microbial ecology of the gut. Am.J.Clin.Nutr.1999. Vol.69. № 5. Р.1052–1057.
15. Corazza GR, Sorge M., Strocchi A., et al . Non–absorbable antibiotics and small bowel bacterial overgrowth.// Ital. J. Gastroenterol. 1992;24:4–9.
16. Floch M.H., Hong–Curtiss J. Probiotics and functional foods in gastrointestinal disorders. Curr. Gastroenterol. Rep. 2001,3(4):343–350.
17. Fuller R. Probiotics: prospects of use in opportunistic infections. – N.Y., 1995.
18. Tannock G.W. Probiotics. A Critical Review. Horizon Sci.Press,Norfolk, England.1999.

.

Антибиотик-ассоциированный дисбактериоз кишечника | Бельмер С.В.

Многочисленный микробиоценоз кишечника человека представлен более 500 видов микроорганизмов, причем в различных отделах желудочно–кишечного тракта количество их колеблется от 103 до 1012 КОЕ/мл. Наиболее многочисленными представителями микробного сообщества кишечника человека являются Bifidobacterium sp., E. coli, Lactobacillus sp., Bacterioides sp., анаэробные стрептококки, Clostridium sp. и многие другие. Микроорганизмы желудочно–кишечного тракта обеспечивает процессы переваривания и всасывания, трофику кишечника, антиинфекционную защиту, синтез витаминов и мн. др. Самыми многочисленными и наиболее хорошо изученными являются микроорганизмы толстой кишки, насчитывающие около 1012 КОЕ/мл.

Различные факторы внешней и внутренней среды могут существенно влиять на состав кишечной микрофлоры, что может не только нарушать нормальное течение физиологических процессов, но даже приводить к тяжелым патологическим состояниям. Качественное и/или количественное изменение состава кишечной микрофлоры называют дисбактериозом кишечника. Дисбактериоз всегда вторичен. Наиболее частой причиной развития дисбактериоза кишечника – применение антибиотиков, прямо подавляющих жизнедеятельность кишечных микроорганизмов и существенно меняющих «микробный пейзаж» желудочно–кишечного тракта.

Другими причинами возникновения дисбактериоза являются воспалительные заболевания слизистой оболочки кишечника как инфекционной, так и неинфекционной природы. Значительную роль среди неинфекционных факторов играют длительные функциональные расстройства желудочно–кишечного тракта, в том числе желчевыделительной системы, а также ферментопатии и аллергическое поражение слизистой оболочки кишечника. Сушественное изменение микрофлоры кишечника происходит под воздействием экологически неблагоприятных факторов внешней среды и стрессовых состояний организма: физических и психических перегрузках. Отмечено влияние возрастного фактора на микробиоценоз кишечника. У детей дисбактериоз развивается достаточно быстро, что связано с ферментативной и иммунной незрелостью кишечника. У пожилых людей отмечается возрастное ослабление ферментативной и иммунологической активности слизистой оболочки кишечника, а так же изменение образа жизни, снижение двигательной активности и характера питания. Важно отметить, что дисбактериоз кишечника, не являясь заболеванием (следовательно, он не может быть диагнозом), представляет собой важный патологический процесс, способный привести к тяжелому поражению желудочно–кишечного тракта, который следует учитывать при определении тактики лечения больного. Действительно, нарушение состава кишечной микрофлоры может способствовать повреждению энтероцитов и нарушению физиологических процессов в кишечнике, привести к повышению кишечной проницаемости для макромолекул, менять моторику, снижать защитные свойства слизистого барьера, создавая условия для развития патогенных микроорганизмов.

Комплекс патологических сдвигов в составе кишечной микрофлоры с соответствующими клиническими проявлениями, связанный с дисбактериозом, развившимся вследствие применения антибиотиков, в зарубежной литературе часто обозначают как антибиотик–ассоциированная диарея (antibiotic associated diarrhea). Исходя из наших представлений об этом процессе термин «антибиотик–ассоциированный дисбактериоз кишечника» можно считать более патогенетически обоснованным. Частота данного состояния, по данным различных авторов, колеблется от 5 до 39%. Естественно, что у этих пациентов практически всегда эндоскопически и гистологически можно выявить признаки колита, что делает обоснованным также термин «антибиотик–ассоциированный колит». Факторами риска его развития являются возраст пациента (младше 6 лет и старше 65 лет), сопутствующие заболевания органов пищеварения, а также снижение функции иммунной системы.

Большинство современных антибиотиков могут стать причиной кишечного дисбактериоза, хотя действие каждого из них имеет определенные особенности. В частности, ампициллин в значительной степени подавляет рост как аэробной, так и анаэробной микрофлоры, тогда как амоксициллин лишь минимально подавляя активность большинства нормальных кишечных микроорганизмов, способствует некоторому увеличению популяции представителей рода Enterobacteriacaea. Аналогично на микробиоценоз кишечника влияет комбинированный препарат амоксициллина и клавулановой кислоты. При этом большинство современных пенициллинов не способствуют размножению грибов и С. difficile. Пероральные цефподоксим, цефпрозил и цефтибутен определенно способствуют росту численности представителей рода Enterobacteriacaea в кишечнике, тогда как цефаклор и цефрадин практически не оказывают влияния на кишечную микрофлору, а применение цефиксима ведет к значительному снижению анаэробных микроорганизмов. Важно, что большинство цефалоспоринов способствует росту численности энтерококков и С. difficile. Фторхинолоны в значительной степени угнетают рост микробов рода Enterobacteriacaea и в меньшей степени – энтерококков и анаэробных микроорганизмов, не способствуя при этом росту грибов и С. difficile [1].

Наиболее тяжелым и даже угрожающим жизни состоянием, связанным с антибиотик–ассоциированным дисбактериозом кишечника, является т.н. С. difficile–ассоциированный колит, вызванный избыточным размножением в кишечнике С. difficile. Последний в норме выявляют при бактериологическом исследовании у 1–3% здоровых лиц, но более чем у 20% пациентов, получающих антибактериальную терапию. У некоторых больных, на фоне угнетения нормальной флоры приемом антибиотиков происходит лавинообразный рост популяции С. difficile с изменением его токсигенных свойств, в т.ч. повышением синтеза энтеротоксина А и цитотоксина В. Результатом этого становится тяжелое поражение слизистой оболочки толстой кишки. Чаще всего С.difficile–ассоциированный колит развивается при применении клиндамицина или линкомицина, полусинтетических пенициллинов, реже – цефалоспоринов с широким спектром антибактериального действия. Наиболее тяжелой формой С. difficile–ассоциированного колита является псевдомембранозный колит, летальность при развитии которого достигает 30% [2,3,4].

Типичными симптомами псевдомембранозного колита являются сильные боли в животе, подъем температуры до 40°С, частый (10–20 раз в сутки) жидкий стул с примесью слизи и крови. Также часто наблюдаются признаки тяжелого эндотоксикоза, а в крови выявляют лейкоцитоз и увеличение СОЭ. В толстой кишке обнаруживаются гиперемия слизистой оболочки и фибринозные пленки, образовавшиеся на участках некроза слизистой оболочки, в виде бледных серовато–желтых бляшек размером 0,5–2,0 см в диаметре на слегка приподнятом основании. Гистологически выявляются участки некроза слизистой оболочки толстой кишки, отек подслизистого слоя, круглоклеточная инфильтрация собственной пластинки и фокальные экстравазаты эритроцитов. Наиболее доступным диагностическим тестом при псевдомембранозном колите является определение в фекалиях токсина А С. difficile методом латекс–агглютинации.

Первый год жизни ребенка, и особенно первые его месяцы, являются наиболее уязвимыми с точки зрения развития любого дисбактериоза кишечника, в т.ч. антибиотик–ассоциированного. Это связано с тем, что в это время происходит первичное формирование кишечной микрофлоры, что в сочетании с незрелостью иммунной системы делает ее весьма неустойчивой по отношению ко многим экзогенным факторам.

Факторы, обеспечивающие благоприятные условия для формирования нормальной микрофлоры кишечника, способствуют профилактике антибиотик–ассоциированного дисбактериоза не только в этот возрастной период, но, в большей или меньшей степени, на протяжении дальнейшей жизни ребенка. Большое значение для становления кишечной микрофлоры имеет естественное вскармливание как за счет иммунологических факторов, присутствующих в женском молоке, так и в связи с наличием в молоке пребиотиков. Первое обстоятельство имеет значение в связи с относительной незрелостью иммунной системы новорожденного ребенка, в то время как заселение кишечника определенными видами микроорганизмов должно контролироваться как специфическими, так и неспецифическими механизмами. В частности, новорожденный ребенок может синтезировать в достаточном количестве только иммуноглобулины класса М, в то время как иммуноглобулины класса А в течение первого месяца жизни практически не образуются и поступают в желудочно–кишечный тракт младенца с молоком матери. С молоком матери поступают также и неспецифические факторы, которые все вместе обеспечивают не только эффективную антиинфекционную защиту ребенка в самый уязвимый период его жизни, но также – нормальный процесс заселения кишечника микроорганизмами.

В женском молоке присутствуют также обеспечивающие рост и размножение нормальной кишечной микрофлоры нутриенты, получившие название «пребиотики». Пребиотики – это частично или полностью неперевариваемые компоненты пищи, которые избирательно стимулируют рост и/или метаболизм одной или нескольких групп микроорганизмов, обитающих в толстой кишке, обеспечивая нормальный состав кишечного микробиоценоза. Пребиотиками женского молока являются лактоза и олигосахариды. Последние до недавнего времени отсутствовали в смесях для искусственного вскармливания, однако в настоящее время активно в них вводятся, в частности, различные комбинации галакто– и фруктоолигосахаридов. Механизм действия всех пребиотиков един: не расщепляясь в тонкой кишке ферментными системами макроорганизма, они утилизируются микрофлорой, преимущественно, бифидо– и лактобактериями, обеспечивая их рост и активность. Кроме того, в результате бактериального метаболизма лактозы и олигосахаридов в толстой кишке обеспечивается оптимальное содержание короткоцепочечных жирных кислот, необходимых для стабильного функционирования колоноцитов. Таким образом, для обеспечения нормального становления кишечной микрофлоры крайне желательно естественное вскармливание, а при его невозможности рекомендуется использование смесей, содержащих пребиотики.

Таким образом, становится очевидным, что многочисленные внешние факторы способны нарушить становление кишечной микрофлоры у новорожденного ребенка. Антибиотикотерапия, даже обоснованная, у детей первого года жизни может привести к тяжелому дисбактериозу кишечника, однако у детей более старшего возраста и даже у взрослых она может серьезно нарушить уже сформированный кишечный биоценоз.

В этой связи одной из проблем, возникших в последние годы, является развитие дисбактериоза кишечника на фоне эрадикации H. pylori. В состав антихеликобактерных схем в различных комбинациях могут входить различные антибактериальные препараты, такие как амоксициллин, макролиды (кларитромицин, рокситромицин, азитромицин), метронидазол, фуразолидон, субцитрат висмута, а также современные препараты, снижающие желудочную секрецию (блокаторы протонного насоса или блокаторы Н2–гистаминовых рецепторов), также способные, хотя и косвенно, снизить резистентность естественной кишечной микрофлоры. Многочисленные исследования свидетельствуют о необходимости включения в комплексную терапию хеликобактер–ассоциированных заболеваний верхних отделов пищеварительного тракта биопрепаратов, в частности, бифидум–содержащих, что позволяет уменьшить частоту развития и глубину выраженности дисбиотических изменений и, как следствие, уменьшить выраженность и длительность сохранения болевого абдоминального и диспепсического синдромов у детей [7].

Профилактика и коррекция антибиотик–ассоциированного дисбактериоза кишечника является достаточно трудной задачей, особенно у детей первого года жизни, особенно, если антибактериальную терапию следует продолжать по жизненным показаниям. Основой профилактики дисбактериоза кишечника является рациональная антибиотикотерапия и исключение необоснованных случаев назначения антибактериальных средств. У детей первого года жизни важным фактором профилактики является сохранение грудного вскармливания или, при невозможности, использование смесей с пребиотиками. Обычно лечение включает следующие направления: снижение избыточного микробного обсеменения тонкой кишки и восстановление нормальной микрофлоры.

Для снижения микробного обсеменения тонкой кишки во взрослой практике принято использование антибиотиков и других антисептиков (нитрофуранов, налидиксовой кислоты). Но у детей раннего возраста при отсутствии клинических и лабораторных признаков энтероколита предпочтительно использование не антибиотиков, а препаратов, относящихся к группе пробиотиков. Это прежде всего споровые монокомпонентные пробиотики. Для детей старше 2 лет наиболее предпочтителен монокомпонентный пробиотик, содержащий дрожжевые грибы, – энтерол.

На втором этапе терапии основное внимание уделяется восстановлению нормальной микрофлоры. С этой целью используются как широко известные монокомпонентные (бифидумбактерин и др.), так и поликомпонентные (примадофилюс и др.) и комбинированные пробиотики. В некоторые поливалентные препараты наряду со штаммами бифидо– и лактобактерий включены штаммы энтерококков, обладающих высокой антагонистической активностью по отношению к условно–патогенным и патогенным возбудителям (Линекс). Это значительно повышает активность препаратов по сравнению с монокомпонентными пробиотиками.

В лечении ассоциированного с антибиотиками дисбактериоза кишечника в настоящее время ключевое положение занимают пробиотики – препараты, содержащие микроорганизмы, которые оказывают положительное влияние на кишечный микробиоценоз. Основоположником концепции пробиотиков стал И.И. Мечников, удостоенный за серию работ в этом направлении Нобелевской премии в области медицины в 1908 г. В частности, он показал, что отдельные микроорганизмы способны угнетать рост холерного вибриона, а другие – наоборот, стимулировать. С тех пор было изучено большое количество микроорганизмов, которые могли бы найти применение в повседневной медицинской практике в составе пробиотических препаратов и продуктов питания, однако лишь немногие из них сегодня официально признаются таковыми. Основным критерием при этом является пробиотический эффект, доказанный в двойных слепых плацебо–контролируемых исследованиях. Этот «экзамен» прошли B. bifidum, Lactobacillus acidophilus, Lactobacillus GG, Lactobacillus fermentum, Strepto (Entero) coccus faecium SF68, S. termophilus, Saccharomyces boulardii. Перечисленные микроорганизмы входят в состав многочисленных препаратов, как монобактериальных, так и комбинированных. С другой стороны, микроорганизм с минимальными потерями должен преодолеть верхние отделы пищеварительного тракта, в связи с чем возникает необходимость размещения его в рН–чувствительной капсуле. Наконец, длительное сохранение микроорганизмов в процессе хранения обеспечивается их лиофилизацией.

Препаратом, который соответствует перечисленным выше требованиям, является Линекс, представляющий собой комплекс 3–х живых лиофилизированных бактерий Bifidobacterium infantis v.liberorum, Lactobacillus acidophilus и Streptococcus faecium в количестве не менее 1,2х107. Важной особенностью микроорганизмов, входящих в состав Линекса, является их устойчивость к антибиотикам и химиотерапевтическим средствам, резистентность к пенициллинам, в т.ч. полусинтетическим, макролидам, цефалоспоринам, фторхинолонам и тетрациклинам. Это обстоятельство позволяет применять Линекс при необходимости в комбинации с антибиотиками с целью профилактики дисбактериоза. Перечисленные особенности позволяют выделить Линекс в ряду препаратов для коррекции дисбактериоза кишечника различного происхождения.

Нами был проведен анализ результатов коррекции антибиотик–ассоциированного дисбактериоза кишечника препаратом Линекс у 8 детей в возрасте от 6 до 12 мес (1–я группа) и 19 детей в возрасте от 1 года до 5 лет (2–я группа), у которых развитие дисбактериоза кишечника можно было связать с применением пероральных антибиотиков из группы пенициллинов и цефалоспоринов в возрастных дозировках. Назначение этих препаратов было связано с лечением острых заболеваний органов дыхания. Во всех случаях на фоне приема антибиотика в конце курса отмечалось учащение стула (до 8 раз в сутки), который имел кашицеобразный или жидкий характер и содержал примеси слизи и зелени. Общее состояние ребенка во всех случаях определялось характером основного патологического процесса, а неустойчивый стул сохранялся и после его купирования. В связи с нарушением стула дети обследовались в сроки от нескольких дней до 2 недель от момента появления кишечных нарушений. При бактериологическом исследовании фекалий у всех был выявлен дисбактериоз кишечника, общей характеристикой которого было значительно снижение бифидо– и лактофлоры. С целью его коррекции дети получали по 1 капсуле препарата Линекс 2 раза в день. Клиническое улучшение (нормализация стула) наблюдалось у 6 детей из 1–й группы и 14 детей из 2–й группы в течение 7 дней, у 7 детей из 1–й группы и 16 детей из 2–й группы в течение 14 дней, у 17 детей из 2–й группы в течение 21 дня. За указанный срок у 1 ребенка из 1–й группы и у 2 детей из 2–й группы стул не нормализовался полностью, оставаясь кашицеобразным, хотя примеси слизи и зелени исчезли. Через 21 день микробиологическое улучшение было отмечено у всех детей, хотя нормализация показателей количества бифидо– и лактобактерий отмечалась только в половине случаев (у 5 детей из 1–й группы и 10 детей из 2–й группы). Эффект от проводимого лечения не зависел от длительности и характера проводимой антибактериальной терапии, ставшей причиной дисбактериоза кишечника. Полученные данные позволяют сделать вывод об эффективности коррекции антибиотик–ассоциированного дисбактериоза у детей Линексом, содержащим живые лифилизированные лактобактерии, бифидобактерии и энтерококк. Совместное применение Линекса и адсорбента–мукоцитопротектора диосмектита повышало эффективность терапии: симптомы купировались у 8 детей из 10 в возрасте 4–7 лет. Назначение препарата Линекс во время курса антибиотков исключало развитие клинически явного дисбактериоза кишеника примерно в половине случаев (у 6 из 11 детей).

Таким образом, даже обоснованное применение антибиотиков может привести к развитию серьезного дисбактериоза кишечника, следствием которого может быть колит. Совместное применение пробиотиков с антибиотиками позволяет снизить риск ассоциированного с антибиотиками дисбактериоза или уменьшить его тяжесть. В случае развития антибиотик–ассоциированного дисбактериоза кишечника у детей показано назначение биопрепаратов, эффект которых может быть усилен энтеросорбентами. Развитие C. difficile–ассоциированного колита требует особой терапевтической тактики, включающей применение специфических антибактериальных препаратов, но также не исключающей пробиотики.

 

Литература:

1. Edlund C., Nord C.E.. Effect on the human normal microflora of oral antibiotics for treatment of urinary tract infection.// J.Antimicrob.Chemoter.– 2000.– Vol.46 Suppl.S1.– P.41–41.

2. Ерюхин И.А., Шляпников С.А., Лебедев В.Ф., Иванов Г.А.. Псевдомембранозный колит и «кишечный сепсис» – следствие дисбактериоза, вызванного антибиотиками.// Вестник хирургии им.И.И.Грекова.– 1997.– том 156.– N2.– С.108–111.

3. Sullivan A., Edlund C., Nord C.E. Effect of antimicrobial agents on the ecological balance of human microflora.// Lancet Infect.Dis.– 2001.– Vol.1.– N2.– P.101–114.

4. McFarland L.V. Risk factor for antibiotic–associated diarrhea.// Ann.Med.Intern. (Paris).– 1998.– Vol.149.– N.5.– P.261–266.

5. Fanaro S, Chierici R, Guerrini P, Vigi V. Intestinal microflora in early infancy: composition and development.// Acta Paediatr.– 2003.– Vol.91. Suppl.– P.48–55.

6. Benno Y, Sawada K, Mitsuoka T. The intestinal microflora of infants: composition of fecal flora in breast–fed and bottle–fed infants.// Microbiol.Immunol.– 1984.– Vol.28.– N9.– P.975–986.

7. Цветкова Л.Н., Щербаков П.Л., Салмова В.С., Вартапетова Е.Е. Результаты биокоррекционной поддержки у детей, получавших антигеликобактерную терапию.// Детская гастроэнтерология 2002.– С.482–484.

.

Есть ли дисбактериоз на самом деле

Хочу Вам рассказать о дисбактериозе - заболевании, которого нет, а также о том, что думает гомеопатия по поводу зловредных бактерий, паразитов и прочих врагов рода человеческого. Мало кто догадывается, что такой распространенной нынче среди взрослых и детей болезни, как "дисбактериоз", нет вовсе. Мало кто знает, что этот самый дисбактериоз - "язва здешних мест", нигде в мире о таком и не слыхивали. И, наконец, мало кто понимает, что делать дорогостоящий "анализ на дисбактериоз" - довольно бессмысленное занятие. Но обо всем по порядку.

О черной кошке как причине беды

Под "дисбактериозом" кроется микробиологическое понятие и означает оно нарушение состава флоры толстой кишки. Становится мало тех бактерий, которых должно быть много, и наоборот, а также появляются такие микроорганизмы, которые не должны присутствовать. Судят об этом по единичным анализам небольшого кусочка кала. До этого момента все логично - анализ кала на содержание бактерий, как один из методов диагностики заболеваний. Но дальше начинаются сплошные чудеса. Судить ведь можно только, сравнивая с общепринятыми нормами. А происхождение этих норм, с которыми сравниваются результаты вашего анализа, как утверждают серьезные российские гастроэнтерологи, совершенно не научно. То есть никто не исследовал в течение многих лет на большом количестве людей разного пола и возраста, сколько, каких бактерий и при каких условиях должно быть в пределах нормы. Из этого следует, что популярный и дорогостоящий анализ мало о чем говорит.

Но это еще было бы полбеды. Беда в том, что нарушение в составе флоры кишечника объявляют причиной заболевания без всяких на то оснований. Тогда как оно - только следствие других нарушений, причем самых разных (об этом ниже). Точно так же повышение количества лейкоцитов в крови (лейкоцитоз) при самых разных заболеваниях можно было бы объявить их причиной и начать лечить. Никто не лечит лейкоцитоз, а вот дисбактериоз лечат долго, упорно и с охотой.

Неправильно установленные причинно-следственные отношения ведут к суевериям. Просыпавшаяся соль и перебежавшая дорогу черная кошка как источники несчастья - из этой серии. Дисбактериоз кишечника как причина болезни - тоже суеверие. Поверье в то, что именно нечисть, гнездящаяся в кишечнике (а почему бы не во рту? не на коже?) приносит беду. (О происхождении этого суеверия можно прочитать в статье известного московского гастроэнтеролога В.В. Василенко "Дисбактериоз - синдром раздраженного кишечника: эссе - анализ проблемы").

Остается лишь добавить, что в Международной классификации болезней такое заболевание как "дисбактериоз" отсутствует. Потому и смотрят удивленно западные врачи на российских родителей, жалующихся на то, что у ребенка дисбактериоз. Здесь возникает повод поговорить о вещах еще более серьезных.

Человек в роли банки - склянки

С началом бактериологической эры человек стал потихоньку превращаться в некую нечистую посудину, заселенную непривлекательными микроорганизмами. И чем больше открывают последних, тем больше растет их значимость и могущество, тем сильнее умаляется человек. Вот он уже почти и оказался в роли банки-склянки, которую, если заведется в ней что непотребное - промывают и дезинфицируют. С банкой-то поступают правильно - она, бедная, не способна себя защитить. А человек? Образ Божий, венец творения? Неужели система защиты и внутренней саморегуляции его организма так уж немощна? По счастью, можно многое сказать в ее оправдание. Во-первых, наличие в мазке или анализе той или иной бактерии (пусть даже очень зловредной) не означает автоматически: а) что она вызвала данную конкретную болезнь у данного пациента, и б) что она вообще для этого пациента вредна. По аналогии: тот, кого обнаружили на месте преступления, совсем не обязательно и есть преступник.

Например, у грудных детей в течение первых нескольких месяцев происходит становление кишечной флоры, состав и численность бактерий постоянно меняются. И это нормально. В учебном пособии по неонатологии под ред. профессора Шабалова читаем о новорожденных: "Первичная бактериальная флора кишечника и кожи, слизистых оболочек представлена не только такими бактериями, как бифидобактерии, молочно-кислые стрептококки, сапрофитный стафилококк, но и условно-патогенными стафиллококками, кишечной палочкой с измененными ферментативными свойствами, различными штаммами протея, грибами... В работах многих отечественных педиатров показано, что во 2-й половине 1-й и на 2-й неделях жизни с кожи, слизистых носа, зева, из кала у 60-70% новорожденных можно выделить патогенные стафиллококки, у 30-60% - энтеробактерии со сниженными ферментативными свойствами, дрожжеподобные грибы рода Кандида, у 10-15% протей, гемолитические энтеробактерии. Из зева новорожденных при выписке из роддома в 20-40% посевов обнаруживают золотистый стафиллококк, клебсиелы, эшерихии". О чем все это говорит? О том, что здоровый малыш прекрасно справляется со всей этой могущественной армией.

Во-вторых, бактерии, как живые микроорганизмы, нуждаются для жизни в определенных условиях, а применительно к нашей ситуации эти условия зависят от организма человека, а не от них самих. Человека можно сравнить с большим и сложным государством. Так, если в государстве растет преступность и становится все меньше порядочных людей, то логично предположить, что в государстве что-то не так. Давайте представим, что для того, чтобы исправить ситуацию, в это государство привезли миллион порядочных людей. Если оно само останется прежним, то сколько из них и как долго продержатся? Здесь прямая аналогия с введением при "дисбактериозе" препаратов типа бифидумбактерина и других. Выводы напрашиваются сами собой.

Извечные вопросы: кто виноват и что делать?

Велик соблазн искать причины человеческих болезней вовне. Но всякая попытка истребить врагов народа неизменно оборачивается истреблением самого народа.

Причина только в самом человеке. Нарушения во внутренней среде организма (из-за которого в нем начинают обитать паразиты и даже собственные полноправные граждане - вроде кишечной палочки - начинают вести себя непристойно) могут иметь массу причин. Например, нарушение секреции пищеварительных соков - желудочного, желчи, секретов поджелудочной железы и тонкого кишечника. Или прием различных лекарственных препаратов, среди которых не только антибиотики. Или расстройства секреции гормонов: щитовидной железы, половых и других.

А еще... Любой опытный врач подтвердит, сколь часто эмоциональные переживания могут выливаться в физические недуги, сколь часто психические расстройства маскируются соматическими (то есть телесными) заболеваниями. И особенно заболеваниями желудочно-кишечного тракта. Прежде чем перейти ко второму извечному вопросу, вспомним один мудрый анекдот. "Встречаются двое. Один другому говорит: «Представляешь, у меня нашли хламидии!» «Ну, и у меня нашли». «Так чем ты их лечишь?» «Да они у меня не болеют...»

С точки зрения любого разумного врача, лечить можно только того, кто болеет. То есть человека. Не инфекцию и даже не болезнь (разве она существует отдельно от больного?). Величайшим заблуждением и откровенно порочной практикой будет лечить данные анализа (в том числе и на дисбактериоз), данные УЗИ, показания сфигмоманометра и результаты мазка. Не надо лечить дисбактериоз - займитесь лечением человека и порядок в кишечнике восстановится сам собой. Но отчего же сплошь и рядом поступают наоборот?

Известный американский кардиолог Бернард Лоун в своей замечательной книге "Утерянное искусство врачевания" пишет: "Мне кажется, что медицина утратила свой основной подход к пациенту, если не сказать, душу. Связь "врач-пациент", основанная на взаимной привязанности и доверии, выпестованная в течении трех тысячелетий, заменена совершенно другим типом отношений. Исцеление подменили лечением, уход - бесстрастным выполнением обязанностей, а умение слушать - технологическими процедурами. Врач больше не занимается личностью больного, а лишь "ремонтирует" отдельные, неправильно работающие части биологической системы. При этом душевное состояние пациента чаще всего не учитывается".

Гомеопатия против инфекций и паразитов

До сих пор я не говорила ни слова о гомеопатии, ибо все вышесказанное касается любого добросовестного и здравомыслящего врача. Гомеопату же легче всего избежать искушения лечить по анализу - просто потому, что это невозможно. По самой сути своей гомеопатия рассматривает больного человека как личность, требующую целостного подхода. Она не лечит отдельно печень, кишечник или нос и не может обходиться без учета эмоциональных переживаний пациента, его жизненной ситуации. Посмотрим, как это выглядит на практике.

К Машеньке, очаровательной большеглазой девочке, меня впервые позвали полтора года назад по поводу острого заболевания с высокой температурой. После того, как острые явления прошли, родители попросили помочь и давними проблемами девочки. Машеньке тогда только что исполнился год. С двух месяцев у нее сухая сыпь на сгибах суставов, с того же времени постоянно полужидкий зеленый стул, без обильных газов и колик. С трех месяцев ей постоянно давали "Примадофилус" без какого-либо эффекта. У Машенькиных папы и прабабушки по папиной линии хроническая экзема. Осматриваю девочку: худенькая, длинное тело, худые ручки и ножки. Сухая шелушащаяся сыпь на щеках и голенях. Сухая морщинистая кожа на шее, в подмышечных впадинах, на животе. Ручки тоже морщинистые, "как у прачки". На стопах кожа сухая, на больших пальцах трещины, пократые кровянистыми корочками. Ходит, растопырив ноги, как моряк по палубе. Согласно всем этим данным я предполагаю, что Маше нужен препарат Петролеум. Я спрашиваю об одном из ключевых симптомов этого лекарства: не хрустят ли у девочки суставы? Да, хрустят, почти с самого рождения.

При приеме Петролеума через 2 недели нормализовался стул, улучшилась переносимость продуктов и значительно уменьшилась сыпь. И перестали хрустеть суставы! Хронические кожные заболевания - сложная для лечения проблема и обострения сыпи на коже у Маши были еще не раз. Но былые проблемы со стулом не возвращались (кроме ситуаций острых заболеваний) и хруста в суставах тоже не было. Конечно, у Маши был "дисбактериоз". Но как однобоко было бы лечить только его, а не Машу "целиком"!

Второй случай имел место уже со взрослой пациенткой. Лене 28 лет, она журналист. Ее беспокоят вздутие живота, частые поносы. Анализ кала выявил "дисбактериоз". Спрашиваю, что еще ее беспокоит. Оказывается, тревожность. Она боится ответственных встреч, выступлений на публике - это вызывает понос, "медвежью болезнь". Боится высоты, толпы, замкнутых пространств. При волнении испытывает сильное сердцебиение и видимую дрожь. Лена худенькая, смуглая, быстрая. Ее раздражает медлительность других, ей трудно ждать. Обожает сладкое, но плохо его переносит: оно вызывает обильные газы и полужидкий стул. На основании этих симптомов после внимательного осмотра назначаю Аргентум нитрикум, который в течение нескольких месяцев значительно изменил к лучшему не только функцию кишечника, но и психическое состояние пациентки. Делать повторный анализ на дисбактериоз она не пошла: дорого, да и зачем?

Гомеопатические лекарства никогда не убивают ни бактерий, ни паразитов. И однако под действием подходящего по закону подобия лекарства инфекционные заболевания проходят, глисты покидают своего хозяина, а распоясавшаяся кишечная палочка начинает знать свое место. Просто срабатывают защитные силы выздоравливающего человека. Именно они имеют достаточный резерв для того, чтобы справиться и с хламидиями, и с вирусами, и с "дисбактериозом".

Вероника Маслова, врач-гомеопат

Карта сайта

Адреса клиник г. Казань

Адрес: ул. Гаврилова, 1, ост. «Гаврилова» (пр. Ямашева)

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00

Автобус: 10, 10а, 18, 33, 35, 35а, 36, 44, 45, 46, 49, 55, 60, 62, 76

Троллейбус: 2, 13

Трамвай: 5, 6

Адрес: ул. Т.Миннуллина, 8а, (Луковского) ост. «Театр кукол»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00

Автобус: 1, 2, 31, 37, 47, 74

Троллейбус: 6, 8, 12

Метро: Суконная слобода

 

 

Адрес: ул. Сыртлановой, 16, ст. метро Проспект Победы, ост. ул. Сыртлановой (проспект Победы)

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00 

Автобус: 5, 34, 37, 62 77

Трамвай: 5

Метро: Проспект Победы

Адрес: ул. Назарбаева, 10, ст. метро «Суконная Слобода», ост. «Метро Суконная Слобода»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: выходной

Автобус: 1, 4, 25, 43, 71

Метро: Суконная слобода

 

 

Адрес: ул. Декабристов, 180, ст. метро «Северный вокзал», ост. «Гагарина»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: выходной

Автобус: 6, 18, 29, 33, 37, 40, 43, 53, 62, 76, 78, 89

Троллейбус: 13

Трамвай: 1, 6

Метро: Северный вокзал

Адрес: пр. А.Камалеева, 28/9, (жилой комплекс «XXI век»), ост. «Новый ипподром»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00 

Троллейбус: 3

 

 

Адрес: Дербышки, ул. Мира, 20, ост. «Магазин Комсомольский», «Гвоздика»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00 

Автобус: 1, 19, 25, 34, 44, 60, 84

Адрес: ул. Серова, 22/24, ост. «ул. Серова»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00 

Автобус: 10, 10а

 

 

Адрес: ул. Беломорская, 6, ст. метро «Авиастроительная», ост. «ул. Ленинградская»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00 

Автобус: 6, 18, 33, 37, 40, 42, 43, 53, 60, 78, 89, 93

Троллейбус: 13

Трамвай: 1

Метро: Авиастроительная

Адрес: ул. Закиева, 41а, ост. «Кабельное телевидение»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00 

Автобус: 5, 18, 30, 31, 34, 45, 46, 62, 63, 77, 89

Троллейбус: 3, 5, 9, 12

 

 

Адрес: ул. Кул Гали, 27, ост. «ул. Кул Гали» (ул. Габишева)

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: выходной

Автобус: 46, 90

Адрес: ул. Рихарда Зорге, 95, м. «Дубравная», ост. «ул. Юлиуса Фучика»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00

Автобусы: 5, 18, 30, 31, 33, 34, 45, 68, 74, 77

Троллейбусы: 5, 9, 12

Трамвай: 4

Метро: Дубравная

Адрес: ул. Фрунзе, 3а, ост. «Идель»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8:00-14:00 

Автобусы: 10а, 36, 49, 53, 63, 72, 106

Троллейбус:1

 

КИШЕЧНЫЙ ДИСБАКТЕРИОЗ | #05-06/01 | «Лечащий врач» – профессиональное медицинское издание для врачей. Научные статьи.

Что понимают под дисбактериозом?

Какие методы диагностики являются современными и достоверными?
Какие лекарственные препараты применяются при дисбактериозе?

Вкишечнике человека находится свыше 500 различных видов микробов, общее количество которых достигает 1014, что на порядок выше общей численности клеточного состава человеческого организма. Количество микроорганизмов увеличивается в дистальном направлении, и в толстой кишке в 1 г кала содержится 1011 бактерий, что составляет 30% сухого остатка кишечного содержимого.

Нормальная микробная флора кишечника

В тощей кишке здоровых людей находится до 105 бактерий в 1 мл кишечного содержимого. Основную массу этих бактерий составляют стрептококки, стафилококки, молочнокислые палочки, другие грамположительные аэробные бактерии и грибы. В дистальном отделе подвздошной кишки количество микробов увеличивается до 107–108 , в первую очередь за счет энтерококков, кишечной палочки, бактероидов и анаэробных бактерий. Недавно нами было установлено, что концентрация пристеночной микрофлоры тощей кишки на 6 порядков выше, чем в ее полости, и составляет 1011 кл/мл. Около 50% биомассы пристеночной микрофлоры составляют актиномицеты, примерно 25% — аэробные кокки (стафилококки, стрептококки, энтерококки и коринеформные бактерии), от 20 до 30% приходится на бифидобактерии и лактобациллы.

Количество анаэробов (пептострептококки, бактероиды, клостридии, пропионобактерии) составляет около 10% в тонкой и до 20% в толстой кишке. На долю энтеробактерий приходится 1% от суммарной микрофлоры слизистой оболочки.

До 90-95% микробов в толстой кишке составляют анаэробы (бифидобактерии и бактероиды), и только 5-10% всех бактерий приходится на строгую аэробную и факультативную флору (молочнокислые и кишечные палочки, энтерококки, стафилококки, грибы, протей).

Кишечные палочки, энтерококки, бифидобактерии и ацидофильные палочки обладают выраженными антагонистическими свойствами. В условиях нормально функционирующего кишечника они способны подавлять рост несвойственных нормальной микрофлоре микроорганизмов.

Площадь внутренней поверхности кишечника составляет около 200 м2. Она надежно защищена от проникновения пищевых антигенов, микробов и вирусов. Важную роль в организации этой защиты играет иммунная система организма. Около 85% лимфатической ткани человека сосредоточено в стенке кишечника, где продуцируется секреторный IgA. Кишечная микрофлора стимулирует иммунную защиту. Кишечные антигены и токсины кишечных микробов значительно увеличивают секрецию IgA в просвет кишки.

Расщепление непереваренных пищевых веществ в толстой кишке осуществляется ферментами бактерий, при этом образуются разнообразные амины, фенолы, органические кислоты и другие соединения. Токсические продукты микробного метаболизма (кадаверин, гистамин и другие амины) выводятся с мочой и в норме не оказывают влияния на организм. При утилизации микробами неперевариваемых углеводов (клетчатки) образуются короткоцепочечные жирные кислоты. Они обеспечивают клетки кишки энергоносителями и, следовательно, улучшают трофику слизистой оболочки. При дефиците клетчатки может нарушаться проницаемость кишечного барьера вследствие дефицита короткоцепочечных жирных кислот. В результате кишечные микробы могут проникать в кровь.

Под влиянием микробных ферментов в дистальных отделах подвздошной кишки происходит деконъюгация желчных кислот и преобразование первичных желчных кислот во вторичные. В физиологических условиях от 80 до 95% желчных кислот реабсорбируется, остальные выделяются с фекалиями в виде бактериальных метаболитов. Последние способствуют нормальному формированию каловых масс: тормозят всасывание воды и тем самым препятствуют излишней дегидратации кала.

Дисбактериоз

В понятие дисбактериоза кишечника входит избыточное микробное обсеменение тонкой кишки и изменение микробного состава толстой кишки. Нарушение микробиоценоза происходит в той или иной степени у большинства больных с патологией кишечника и других органов пищеварения. Следовательно, дисбактериоз является бактериологическим понятием. Он может рассматриваться как одно из проявлений или осложнение заболевания, но не самостоятельная нозологическая форма.

Крайней степенью дисбактериоза кишечника является появление бактерий желудочно-кишечного тракта в крови (бактериемия) или даже развитие сепсиса.

Состав микрофлоры кишечника нарушается при болезнях кишечника и других органов пищеварения, лечении антибиотиками и иммунодепрессантами, воздействиях вредных факторов внешней среды.

Клинические проявления дисбактериоза зависят от локализации дисбиотических изменений.

Дисбактериоз тонкой кишки

При дисбактериозе тонкой кишки численность одних микробов в слизистой оболочке тонкой кишки увеличена, а других уменьшена. Отмечается увеличение Eubacterium (в 30 раз), α-стрептококков (в 25 раз), энтерококков (в 10 раз), кандид (в 15 раз), появление бактерий рода Acinetobacter и вирусов герпеса. Уменьшается от 2 до 30 раз количество большинства анаэробов, актиномицетов, клебсиелл и других микроорганизмов, являющихся естественными обитателями кишечника.

Причиной дисбактериоза могут быть: а) избыточное поступление микроорганизмов в тонкую кишку при ахилии и нарушении функции илеоцекального клапана; б) благоприятные условия для развития патологических микроорганизмов в случаях нарушения кишечного пищеварения и всасывания, развития иммунодефицита и нарушений проходимости кишечника.

Повышенная пролиферация микробов в тонкой кишке приводит к преждевременной деконъюгации желчных кислот и потере их с калом. Избыток желчных кислот усиливает моторику толстой кишки и вызывает диарею и стеаторею, а дефицит желчных кислот приводит к нарушению всасывания жирорастворимых витаминов и развитию желчнокаменной болезни.

Бактериальные токсины и метаболиты, например фенолы и биогенные амины, могут связывать витамин В12.

Некоторые микроорганизмы обладают цитотоксическим действием и повреждают эпителий тонкой кишки. Это ведет к уменьшению высоты ворсинок и углублению крипт. При электронной микроскопии выявляется дегенерация микроворсинок, митохондрий и эндоплазматической сети.

Дисбактериоз толстой кишки

Состав микрофлоры толстой кишки может меняться под влиянием различных факторов и неблагоприятных воздействий, ослабляющих защитные механизмы организма (экстремальные климатогеографические условия, загрязнение биосферы промышленными отходами и различными химическими веществами, инфекционные заболевания, болезни органов пищеварения, неполноценное питание, ионизирующая радиация).

В развитии дисбактериоза толстой кишки большую роль играют ятрогенные факторы: применение антибиотиков и сульфаниламидов, иммунодепрессантов, стероидных гормонов, рентгенотерапия, хирургические вмешательства. Антибактериальные препараты значительно подавляют не только патогенную микробную флору, но и рост нормальной микрофлоры в толстой кишке. В результате размножаются микробы, попавшие извне, или эндогенные виды, устойчивые к лекарственным препаратам (стафилококки, протей, дрожжевые грибы, энтерококки, синегнойная палочка).

Клинические особенности дисбактериоза

Клинические проявления чрезмерного роста микроорганизмов в тонкой кишке могут полностью отсутствовать, выступать в качестве одного из патогенетических факторов хронической рецидивирующей диареи, а при некоторых болезнях, например, дивертикулезе тонкой кишки, частичной кишечной непроходимости или после хирургических операций на желудке и кишечнике, приводить к тяжелой диарее, стеаторее и В12-дефицитной анемии.

Особенностей клинического течения заболевания у больных с различными вариантами дисбактериоза толстой кишки, по данным бактериологических анализов кала, в большинстве случаев установить не удается. Можно отметить, что больные хроническими заболеваниями кишечника чаще инфицируются острыми кишечными инфекциями по сравнению со здоровыми. Вероятно, это связано со снижением у них антагонистических свойств нормальной микрофлоры кишечника и, прежде всего, частым отсутствием бифидобактерий.

Особенно большую опасность представляет псевдомембранозный колит, развивающийся у некоторых больных, длительно лечившихся антибиотиками широкого спектра действия. Этот тяжелый вариант дисбактериоза вызывается токсинами, выделяемыми синегнойной палочкой Clostridium difficile, которая размножается в кишечнике при угнетении нормальной микробной флоры.

Основным симптомом псевдомембранозного колита является обильная водянистая диарея, началу которой предшествовало назначение антибиотиков. Затем появляются схваткообразные боли в животе, повышается температура тела, в крови нарастает лейкоцитоз. Эндоскопическая картина псевдомембранозного колита характеризуется наличием бляшковидных, лентовидных и сплошных «мембран», мягких, но плотно спаянных со слизистой оболочкой. Изменения наиболее выражены в дистальных отделах ободочной и прямой кишок. Слизистая оболочка отечная, но не изъязвлена. При гистологическом исследовании обнаруживают субэпителиальный отек с круглоклеточной инфильтрацией собственной пластинки, капиллярные стазы с выходом эритроцитов за пределы сосудов. На стадии образования псевдомембран под поверхностным эпителием слизистой оболочки возникают экссудативные инфильтраты. Эпителиальный слой приподнимается и местами отсутствует; оголенные места слизистой оболочки прикрыты лишь слущенным эпителием. На поздних стадиях болезни эти участки могут занимать большие сегменты кишки.

Очень редко наблюдается молниеносное течение псевдомембранозного колита, напоминающее холеру. Обезвоживание развивается в течение нескольких часов и заканчивается летальным исходом.

Таким образом, оценка клинической значимости дисбиотических изменений должна основываться прежде всего на клинических проявлениях, а не только на результатах исследования микрофлоры кала.

Методы диагностики

Диагностика дисбактериоза представляет собой сложную и трудоемкую задачу. Для диагностики дисбактериоза тонкой кишки применяют посев сока тонкой кишки, полученного с помощью стерильного зонда. Дисбактериоз толстой кишки выявляют с помощью бактериологических исследований кала.

Микробная флора образует большое количество газов, в том числе водорода. Это явление используют для диагностики дисбактериоза. Концентрация водорода в выдыхаемом воздухе натощак находится в прямой зависимости от выраженности бактериального обсеменения тонкой кишки. У больных с заболеваниями кишечника, протекающими с хронической рецидивирующей диареей и бактериальным обсеменением тонкой кишки, концентрация водорода в выдыхаемом воздухе значительно превышает 15 ppm.

Для диагностики дисбактериоза применяют также нагрузку лактулозой. В норме лактулоза не расщепляется в тонкой кишке и метаболизируется микробной флорой толстой кишки. В результате количество водорода в выдыхаемом воздухе повышается (рис. 1).

Рисунок 1. Концентрация водорода в выдыхаемом воздухе

Наиболее частыми бактериологическими признаками дисбактериоза толстой кишки являются отсутствие основных бактериальных симбионтов — бифидобактерий и уменьшение количества молочнокислых палочек. Увеличивается количество кишечных палочек, энтерококков, клостридий, стафилококков, дрожжеподобных грибов и протея. У отдельных бактериальных симбионтов появляются патологические формы. К ним относятся гемолизирующая флора, кишечные палочки со слабо выраженными ферментативными свойствами, энтеропатогенные кишечные палочки и т. д.

Углубленное изучение микробиоценоза показало, что традиционные методы не позволяют получить истинную информацию о состоянии микрофлоры кишечника. Из 500 известных видов микробов в целях диагностики обычно изучаются лишь 10-20 микроорганизмов. Важно, в каком отделе — в тощей, подвздошной или толстой кишках — исследуется микробный состав. Поэтому перспективы разработки клинических проблем дисбактериоза в настоящее время связывают с применением химических методов дифференциации микроорганизмов, позволяющих получить универсальную информацию о состоянии микробиоценоза. Наиболее широко для этих целей используются газовая хроматография (ГХ) и газовая хроматография в сочетании с масс-спектрометрией (ГХ-МС). Этот метод позволяет получить уникальную информацию о составе мономерных химических компонентов микробной клетки и метаболитов. Маркеры такого рода могут быть определены и использованы для детектирования микроорганизмов. Главным преимуществом и принципиальным отличием этого метода от бактериологических является возможность количественного определения более 170 таксонов клинически значимых микроорганизмов в различных средах организма. При этом результаты исследования могут быть получены в течение нескольких часов.

Проведенные нами исследования микробиоценоза в крови и биоптатов слизистой оболочки тонкой и толстой кишок у больных с синдромом раздраженного кишечника позволили обнаружить отклонения от нормы до 30-кратного увеличения или уменьшения многих компонентов. Существует возможность оценки изменений микрофлоры кишечника на основании данных анализа крови методом ГХ-МС-микробных маркеров.

Схема лечения дисбактериоза кишечника

Лечение

Лечение дисбактериоза должно быть комплексным (схема) и включать в себя следующие мероприятия:

  • устранение избыточного бактериального обсеменения тонкой кишки;
  • восстановление нормальной микробной флоры толстой кишки;
  • улучшение кишечного пищеварения и всасывания;
  • восстановление нарушенной моторики кишечника;
  • стимулирование реактивности организма.

Антибактериальные препараты

Антибактериальные препараты необходимы в первую очередь для подавления избыточного роста микробной флоры в тонкой кишке. Наиболее широко применяются антибиотики из группы тетрациклинов, пенициллинов, цефалоспорины, хинолоны (таривид, нитроксолин) и метронидазол.

Однако антибиотики широкого спектра действия в значительной степени нарушают эубиоз в толстой кишке. Поэтому они должны применяться только при заболеваниях, сопровождающихся нарушениями всасывания и моторики кишечника, при которых, как правило, отмечается выраженный рост микробной флоры в просвете тонкой кишки.

Антибиотики назначают внутрь в обычных дозах в течение 7–10 дней.

При заболеваниях, сопровождающихся дисбактериозом толстой кишки, лечение лучше проводить препаратами, которые оказывают минимальное влияние на симбионтную микробную флору и подавляют рост протея, стафилококков, дрожжевых грибов и других агрессивных штаммов микробов. К ним относятся антисептики: интетрикс, эрсефурил, нитроксолин, фуразолидон и др.

При тяжелых формах стафилококкового дисбактериоза применяют антибиотики: таривид, палин, метронидазол (трихопол), а также бисептол-480, невиграмон.

Антибактериальные препараты назначают в течение 10–14 дней. В случае появления в кале или кишечном соке грибов показано применение нистатина или леворина.

У всех больных с диареей, ассоциированной с антибиотиками, протекающей с интоксикацией и лейкоцитозом, возникновение острой диареи следует связывать с Cl. difficile.

В этом случае срочно делают посев кала на Cl. difficile и назначают ванкомицин по 125 мг внутрь 4 раза в сутки; при необходимости доза может быть увеличена до 500 мг 4 раза в день. Лечение продолжают в течение 7-10 суток. Эффективен также метронидазол в дозе 500 мг внутрь 2 раза в сутки, бацитрацин по 25 000 МЕ внутрь 4 раза в сутки. Бацитрацин почти не всасывается, в связи с чем в толстой кишке можно создать более высокую концентрацию препарата. При обезвоживании применяют адекватную инфузионную терапию для коррекции водно-электролитного баланса. Для связывания токсина Cl. difficile используют холестирамин (квестран).

Бактериальные препараты

Живые культуры нормальной микробной флоры выживают в кишечнике человека от 1 до 10% от общей дозы и способны в какой-то мере выполнять физиологическую функцию нормальной микробной флоры. Бактериальные препараты можно назначать без предварительной антибактериальной терапии или после нее. Применяют бифидумбактерин, бификол, лактобактерин, бактисубтил, линекс, энтерол и др. Курс лечения длится 1-2 месяца.

Возможен еще один способ устранения дисбактериоза — воздействие на патогенную микробную флору продуктами метаболизма нормальных микроорганизмов. К таким препаратам относится хилак форте. Он создан 50 лет назад и до настоящего времени применяется для лечения больных с патологией кишечника. Хилак форте представляет собой стерильный концентрат продуктов обмена веществ нормальной микрофлоры кишечника: молочной кислоты, лактозы, аминокислот и жирных кислот. Эти вещества способствуют восстановлению в кишечнике биологической среды, необходимой для существования нормальной микрофлоры, и подавляют рост патогенных бактерий. Возможно, продукты метаболизма улучшают трофику и функцию эпителиоцитов и колоноцитов. 1 мл препарата соответствует биосинтетическим активным веществам 100 млрд. нормальных микроорганизмов. Хилак форте назначают по 40–60 капель 3 раза в день на срок до 4 недель в сочетании с препаратами антибактериального действия или после их применения.

Совсем недавно появились сообщения о возможности лечения острой диареи, ассоциированной с антибактериальной терапией и Cl. difficile, большими дозами пре- и пробиотиков.

Регуляторы пищеварения и моторики кишечника

У больных с нарушением полостного пищеварения применяют креон, панцитрат и другие панкреатические ферменты. С целью улучшения функции всасывания назначают эссенциале, легалон или карсил, т. к. они стабилизируют мембраны кишечного эпителия. Пропульсивную функцию кишечника улучшают имодиум (лоперамид) и тримебутин (дебридат).

Стимуляторы реактивности организма

Для повышения реактивности организма ослабленным больным целесообразно применять тактивин, тималин, тимоген, иммунал, иммунофан и другие иммуностимулирующие средства. Курс лечения должен составлять в среднем 4 недели. Одновременно назначаются витамины.

Профилактика дисбактериоза

Первичная профилактика дисбактериоза представляет очень сложную задачу. Ее решение связано с общими профилактическими проблемами: улучшением экологии, рациональным питанием, улучшением благосостояния и прочими многочисленными факторами внешней и внутренней среды.

Вторичная профилактика предполагает рациональное применение антибиотиков и других медикаментов, нарушающих эубиоз, своевременное и оптимальное лечение болезней органов пищеварения, сопровождающихся нарушением микробиоценоза.

Микробный дисбиоз тонкого кишечника лежит в основе симптомов, связанных с функциональными желудочно-кишечными расстройствами

Этическое одобрение исследований на людях

Все исследования на людях были одобрены IRB клиники Мэйо [тестовые образцы (16–006388 и 15–003235), контрольные образцы здоровых людей (14–002382) и 15–003603)], и мы соблюдаем все соответствующие этические нормы. Исследование диетического вмешательства было зарегистрировано на сайте ClinicalTrials.gov (NCT03266536). Все субъекты исследования питания дали информированное согласие, тогда как аспираты тонкой кишки были получены из лаборатории клинической микробиологии в соответствии с отказом от согласия IRB для протокола 15–003235.Биологические материалы, полученные от пациентов, не могут быть переданы на основании протокола, одобренного институциональным IRB.

Сбор аспиратов тонкой кишки

Последовательные пробы аспирата тонкой кишки от пациентов с симптомами после диагностической ЭГДС были получены непосредственно из микробиологической лаборатории с мая по декабрь 2016 года. Образцы двенадцатиперстного аспирата были собраны во время ЭГД после прямого попадания в двенадцатиперстную кишку с минимальным раздувом в желудке с помощью стандартного однопросветного аспирационного катетера, пропущенного через всасывающий порт эндоскопа.Были включены образцы, связанные с пациентами, которые ранее давали согласие на просмотр электронных медицинских карт. Всего за этот промежуток времени было получено 143 аспирата от пациентов с симптомами. После исключения образцов из-за отсутствия согласия или низкой глубины считывания при секвенировании (<1000) было включено в общей сложности 126 пациентов с симптомами. Дуоденальные аспираты, полученные от 38 здоровых добровольцев, участвовавших в других исследованиях и собранные аналогичным образом, также были получены и обработаны аналогичным образом.Клинические метаданные были получены ретроспективным обзором электронной медицинской карты, включая демографическую информацию, ИМТ, клинические показания для тестирования SIBO, количественные результаты аэробных и анаэробных аспиратных культур, курс антибиотиков для лечения SIBO, клинический ответ на антибиотики, необходимость повторного приема антибиотиков, недавние лекарства включая использование антибиотиков и ИПП, операции на желудочно-кишечном тракте, сопутствующие заболевания и т. д.

Критерии диагностики SIBO на основе количественных культур

Аспираты тонкой кишки (10 мкл) наносили штрихами на RBAP (кровяной агар), REMB (грамотрицательная селективная среда) , RBAPA (предварительно восстановленный кровяной агар) и инкубировали в аэробных условиях при 35 ° C, 5% CO 2 , RIMA (дрожжевая селективная среда) и инкубировали при комнатной температуре и на RCDC (анаэробный кровяной агар), RLKC (замороженная кровь Канамицин Ванкомицин - Prevotella selection), RPEA (фенол-спиртовой агар - грамположительный селективный) и инкубировали анаэробно либо в клинической лаборатории, либо в исследованиях. лаборатория.Общее количество бактерий (анаэробное плюс аэробное количество) было меньше или больше 10 5 КОЕ / мл, а диагноз СИБР был основан на культуре дуоденального аспирата, демонстрирующей рост бактерий ≥ 10 5 КОЕ / мл (аэробный, анаэробный или оба) более 48 часов 15,16,17 .

Сравнение культур и секвенирование 16S рРНК

Бактериальная ДНК была извлечена из аспиратов и биопсий двенадцатиперстной кишки с использованием фенол-хлороформа и из стула с использованием набора для экстракции фекальной ДНК MoBio с последующей амплификацией 16 S рРНК с использованием праймеров, совместимых с библиотекой Nextera, фланкирующих V4 гипервариабельная область ([прямое выступание] + 515 F: [TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG] GTGCCAGCMGCCGCGGTAA; и [обратное выступание] + 806 R: [GTCTCGTGGGCTCGGAGATGTGTATA протокол секвенирования 900 с использованием протокола 900 с двойным секвенированием с использованием 900 GGACT].Все образцы секвенировали вместе в режиме парных концов 2 × 300 на приборе Illumina MiSeq с использованием реагентов v3, разработанных Центром геномики Университета Миннесоты.

Сырые последовательности с парными концами были отфильтрованы по качеству, обрезаны адаптером и сшиты с использованием конвейера контроля качества SHI7 35 , с порогом обрезки> 32 и средним показателем качества> 35. Предварительно обработанные считывания были проанализированы путем закрытого отбора ссылок с ускоренным механизмом оптимального выравнивания с зазором BURST 36,37 в режиме CAPITALIST против баз данных NCBI RefSeq Targeted Loci Project, посвященных бактериальным и архейным 16 S (https: // www.ncbi.nlm.nih.gov/refseq/targetedloci/) с 97-процентной идентичностью. После фильтрации образцов с низкой глубиной считывания мы приступили к анализу 126 пациентов с симптомами и 38 здоровых людей из контрольной группы. Анализ разнообразия был проведен с использованием QIIME v1.9.1 38 , а другие анализы данных, статистические тесты и визуализации были выполнены в R. сайта с наименьшим количеством чтений, CLR (центрированное логарифмическое соотношение) - преобразовано после мультипликативной замены и проанализировано с помощью пользовательских сценариев R и пакета «vegan » .

Дифференциальный анализ численности между здоровыми и имеющими симптомы субъектами был выполнен на нормализованных данных обилия 39 для каждого таксономического ранга с использованием теста перестановки (1000 перестановок) с t-статистикой в ​​качестве статистики критерия. Перед тестированием к нормированным данным о численности применялось преобразование квадратного корня. Таксоны с распространенностью <10% или максимальной долей <0,2% были исключены из тестирования. Контроль FDR (процедура Бенджамини – Хохберга) выполнялся для каждого таксономического ранга для корректировки множественного тестирования.SI был сгенерирован с использованием классификации случайных лесов на основе нормализованных данных уровня OTU (пакет randomForest в R). Шкала индекса была определена как вероятность отсутствия симптомов классификации пациентов на основе сгенерированной модели. Этот метод предотвращает перетренированность путем удержания выборки для классификации и прогнозирования на основе оставшегося набора данных n -1. Функция Boruta 40 Выбор (пакет Boruta в R) использовалась для определения OTU, которые вносят значительный вклад в классификацию.Связи с семью демографическими или клиническими переменными были протестированы с использованием моделей линейной регрессии и скорректированы для множественного тестирования с использованием контроля FDR.

Мы сгенерировали DI с помощью метода CLOUD 24 . Вкратце, матрица расстояний Эйчисона здоровых образцов использовалась в качестве эталонного облака, и расстояние от каждого здорового образца до здорового облака рассчитывалось для каждого образца в наборе данных. Затем этот расчет расстояния был повторен для каждой выборки пациентов с симптомами относительно здорового облака; расстояния, превышающие два стандартных отклонения (SD) от среднего значения расстояния до здорового человека, считаются «дисбиотическими»; те, кто находится в пределах 2 SD от среднего значения расстояния до здорового человека, считаются «подобными здоровью».Затем эта оценка дисбактериоза CLOUD была подтверждена с использованием ортогонального подхода, основанного на показателях SI: мы подгоняли показатели SI здоровых к распределению по логит-шкале (значения SI здорового контроля примерно нормальны по логит-шкале; p = 0,41, нормальность Шапиро-Уилка контрольная работа). Мы снова применили правило 2 SD, классифицируя образцы с более чем 2 SD от среднего значения распределения здоровых как «дисбиотические», а образцы в пределах 2 SD как «аналогичные здоровым». Чтобы сгенерировать DI здесь, мы затем повторно классифицировали образцы по случайному лесу с использованием новых групповых классификаций и использовали OOB-вероятность «дисбиотической» классификации в качестве показателя индекса.Эти два независимых метода находятся в тесном согласии, что оценивается по высокой степени корреляции между оценками ОБЛАЧНОГО дисбиоза в выборках и их индексом, основанным на вероятности ( r = 0,7, p = 2 × 10 −16 , Корреляции Пирсона). Оценка расстояния в облаке использовалась во всех последующих анализах. Для сравнения мы также сгруппировали данные с использованием спектральной кластеризации, реализованной в пакете R «kernlab» v0.9.27, с использованием двух центров кластеров и настроек по умолчанию 41 .

Вмененные функции из состава микробиоты

Для прогнозирования микробных функций предварительно обработанные считывания ДНК были сопоставлены с версией 13_8 базы данных GreenGenes 16 S рРНК с использованием BURST с идентичностью 97%. Полученные таблицы OTU использовались для создания прогнозируемых аннотаций KEGG с помощью PICRUSt v1.1.3 42 . Размер эффекта линейного дискриминантного анализа (LDA) (LEfSe; Galaxy Version 1.0) 43 затем использовался для выявления предполагаемых функций, которые значительно различались (оценка LDA> 2.0) между группами.

Исследование диетических вмешательств на здоровых добровольцах

Это было пилотное проспективное одноцентровое исследование диетических вмешательств на здоровых добровольцах, изначально потреблявших диету с высоким содержанием клетчатки. Исследование было зарегистрировано на сайте clinictrials.gov под номером NCT03266536. Подходящими участниками были здоровые взрослые (≥ 18 лет) с исходным потреблением клетчатки ≥ 11 г / 1000 калорий / день; <10% дневных калорий из добавленного сахара; ≥ 5 порций фруктов и овощей в день; и ≤ 13% дневных калорий из насыщенных жиров на основе заполненного опросника по частоте приема пищи.Пациенты были исключены из исследования, если они не соответствовали вышеуказанным диетическим требованиям, имели известный диагноз воспалительного заболевания кишечника, микроскопический колит, глютеновую болезнь или другие воспалительные состояния, наличие абдоминальных симптомов на основании исходного анкетного опроса, использование пероральных антибиотиков или пробиотиков в течение последние 4 недели, беременность или планы забеременеть в рамках периода исследования, или любые другие заболевания, состояния или привычки, которые могут помешать завершению исследования. Диетические инструкции и выбор продуктов питания обсуждались на предварительном визите лицензированного диетолога.

Все субъекты прошли скрининг лично или по телефону и заполнили анкету по частоте приема пищи, чтобы убедиться, что они соответствуют критериям включения и исключения. При первичном и последующем посещении им была проведена ФГДС с седацией в сознании. Дуоденальный аспират получали через стандартный отсасывающий катетер, пропускаемый через отсасывающий порт с минимальным надуванием в желудке; аликвоту отправляли в клиническую лабораторию для тестирования на SIBO, а оставшуюся часть хранили для анализа микробиома при -80 ° C.Было получено восемь биопсий двенадцатиперстной кишки для исследований камеры Уссинга, анализа микробиома и последовательности РНК хозяина. При первоначальном и последующем посещении участники заполнили анкету по симптомам и демографию и предоставили образец стула. Симптомы, оцениваемые с помощью анкет, включали: частоту стула, натуживание, неполное опорожнение, твердый / комковатый стул, боль в животе, связанную с дефекацией, диарею / жидкий водянистый стул, вздутие живота, трудности с глотанием, тошноту / рвоту, изжогу, усталость и аппетит.Ответы записывались в двоичном формате (да / нет). В рамках вмешательства все участники соблюдали 7-дневную стандартизированную диету с типичным для США распределением макроэлементов калорий: 50% из углеводов, 35% из жиров и 15% из белка. Диета была с низким содержанием клетчатки (<10 г / 1000 калорий в день) и высоким содержанием простого сахара (≥ 50% дневных углеводов).

Статистический анализ мощности

Мы выполнили апостериорный расчет мощности для сравнения микробиома между здоровыми и симптомными субъектами, сосредоточив внимание на силе дифференциального анализа численности, где у нас была гораздо более низкая статистическая мощность по сравнению с анализами альфа- и бета-разнообразия. , из-за исправления множественного тестирования.Мы использовали сетевой калькулятор мощности микробиома для проведения анализа мощности (http://fedematt.shinyapps.io/shinyMB/), который был основан на моделировании Монте-Карло и тесте Уилкоксона – Манна – Уитни 44 . Мы использовали коэффициент ложного обнаружения 5%, чтобы исправить множественное тестирование. Предполагая, что мы тестируем 65 родов, при этом численность 10 родов с умеренной численностью (6–15 ранги) снижается на 50% у пациентов с симптомами (по сравнению с 26 дифференциальными родами со средним снижением на 59% в наблюдаемых данных), мы имели средняя мощность 75% для обнаружения этих 10 дифференциальных родов и мощность 100% для обнаружения хотя бы одного значимого рода при текущем размере выборки.Таким образом, исследование было достаточно мощным, чтобы обнаружить умеренную разницу таксонов при сравнении здоровых субъектов и субъектов с симптомами.

Ex vivo функция эпителиального барьера

Исследования камеры Уссинга были выполнены для измерения барьерной функции слизистой оболочки двенадцатиперстной кишки и секреторных ответов, как было описано ранее 45 . Вкратце, биопсии двенадцатиперстной кишки помещали в камеры Ussing объемом 4 мл (Physiologic Instruments, Сан-Диего, Калифорния), экспонируя 0,031 см области 2 в течение 45 минут после сбора.Камеры были заполнены Кребсом с 10 мм маннитом (сторона слизистой оболочки) и Кребсом с 10 мм глюкозы (подслизистая сторона). Базовое трансэпителиальное сопротивление и ток короткого замыкания каждой ткани измеряли с использованием пары электродов Ag / AgCl с агар-солевыми мостиками и пары токоподводящих платиновых электродов для поддержания условий фиксации напряжения. Парацеллюлярный поток через биопсии измеряли с использованием 4 кДа FITC-декстрана, вводимого на слизистую (концентрация в камере 1 мг / мл). Отбор образцов производился со стороны подслизистой оболочки каждые 30 минут в течение всего 3 часов, и кумулятивная флуоресценция измерялась с помощью Multi-Mode Microplate Reader (BioTek, VT) и преобразовывалась в концентрацию с использованием стандартных кривых.Кумулятивный поток в конце 3 ч был рассчитан для FITC – декстрана. Корреляции Спирмена (непараметрические) использовались для проверки связи между разнообразием микробиома и потоком FITC – декстрана.

RNA seq

Образцы биопсии размораживали на льду, гомогенизировали и центрифугировали при 13000 об / мин, а супернатант переносили в новую пробирку. РНК получали с использованием набора RNeasy Mini Kit (QIAGEN, Hilden, Германия) и секвенировали на Illumina HiSeq 2500. Анализ данных выполняли с использованием Mayo Analysis Pipeline for RNA Sequencing (MAP-RSeq) с выравниванием по строению генома человека (GRCh48.78) 46 . Вкратце, конвейер MAP-RSeq выполняет оценку качества чтения последовательностей из файла FASTQ, выравнивает оставшиеся считывания с TopHat 47 , а количество генов агрегируется с библиотекой Python HTSeq 48 . Средняя общая глубина считывания составила 57 052 ​​595 (стандартное отклонение 8,5 × 10 6 ) и в среднем 87,0% (стандартное отклонение 2,0%) от общего числа считываний, сопоставленных с моделями генов. Условная квантильная нормализация была выполнена для учета длины гена и ошибок содержания GC 49 .

1 H-ЯМР подготовка образцов метаболомики

Образцы аспирата центрифугировали при 4 ° C при 12000 × g в течение 5 мин. 162 мкл супернатанта смешивали с 18 мкл буфера ЯМР (1,5 мкл KH 2 PO 4 , 1 г / л TSP и 0,13 г / л NaN 3 , Sigma-Aldrich) и переносили в Трубка для ЯМР 3 мм. Образцы фекалий предварительно взвешивали (~ 100 мг), рандомизировали и помещали в пробирку с завинчивающейся крышкой, содержащую 50 мг 1.Циркониевые шарики диаметром 0 мм, к которым было добавлено 400 мкл ACN: H 2 O (1: 3). Пробирку помещали в миксер Biospec на 30 с. Затем гомогенизированный образец центрифугировали в течение 20 мин при 16000 × g . Супернатант осторожно переносили в пробирки с центрифугированием и центрифугировали в течение 30 мин при 16000 × g . 80 мкл отфильтрованной фекальной воды вносили аликвотами в 96-луночный планшет и 10 мкл использовали для контроля качества. Отфильтрованную фекальную воду в 96-луночном планшете сушили в токе азота перед восстановлением 540 мкл D 2 O (Sigma-Aldrich) и 60 мкл буфера ЯМР.Восстановленную фекальную воду и смесь буфера переносили в 5-миллиметровые экспериментальные пробирки для ЯМР.

1 H-ЯМР эксперимент

Метаболические профили измеряли на спектрометре Bruker 600 МГц (Bruker Biospin, Rheinstetten, Германия), установленном на постоянную температуру 300 К для образцов мочи, аспирата и фекалий и 310 К для образцов плазмы. Стандартный одномерный эксперимент NOSY был выполнен для каждого образца мочи, аспирата и фекальной воды, а эксперимент CPMG - для образцов плазмы.Всего было выполнено 64 сканирования для каждого образца в 64 тыс. Точек данных для мочи, аспиратов и плазмы; Было собрано 128 сканирований на образец в 64 тыс. Точек данных для фекальной воды.

1 Предварительная обработка данных H-ЯМР

Данные спектров были импортированы в MATLAB (версия 8.3.0.532 R2014a, Mathworks Inc, Натик, Массачусетс, США). Для следующих исполнений использовалась серия сценариев собственной разработки. Фазирование, корректировка базовой линии и спектральная калибровка до TSP (0 ppm).Спектры выравнивались вручную. Чтобы учесть разницу в концентрации образцов, к образцам применялась нормализация вероятностного коэффициента. Собственные скрипты использовались для построения моделей PCA и OPLS-DA и интеграции интересующих пиков. Корреляции характеристик и тенденции были проанализированы в R.

Сводка отчетов

Дополнительная информация о дизайне исследования доступна в Сводке отчетов по исследованиям природы, связанной с этой статьей.

«Синдром дырявого кишечника» - NHS

«Синдром дырявого кишечника» - это предложенное заболевание, которое, по утверждению некоторых практикующих врачей, является причиной широкого спектра долгосрочных состояний, включая синдром хронической усталости и рассеянный склероз (РС).

Сторонники «синдрома дырявого кишечника» утверждают, что многие симптомы и состояния вызваны реакцией иммунной системы на микробы, токсины или другие вещества, попавшие в кровоток через пористый («дырявый») кишечник.

Хотя верно то, что некоторые состояния и лекарства могут вызывать «дырявую» кишку (то, что ученые называют повышенной кишечной проницаемостью), в настоящее время мало доказательств, подтверждающих теорию о том, что пористый кишечник является прямой причиной каких-либо серьезных, широко распространенных проблем.

Также имеется мало свидетельств того, что «методы лечения», которые, по утверждению некоторых людей, помогают уменьшить проницаемость кишечника, например, пищевые добавки и лечебные травы, оказывают какое-либо благотворное влияние на большинство состояний, которые они якобы помогают.

Что может вызвать негерметичность кишечника?

Внутренняя часть кишечника выстлана одним слоем клеток, которые составляют слизистую оболочку (барьер между внутренней частью кишечника и остальной частью тела).

Этот барьер эффективен при абсорбции питательных веществ, но предотвращает попадание большинства крупных молекул и микробов из кишечника в кровоток и потенциально вызывает широко распространенные симптомы.

В некоторых случаях этот барьер может стать менее эффективным и «негерметичным», хотя это само по себе обычно не считается достаточным, чтобы вызвать серьезные проблемы.

Алкоголь и некоторые обезболивающие

Алкоголь, аспирин и нестероидные противовоспалительные препараты (НПВП), такие как ибупрофен, являются хорошо известными раздражителями слизистой оболочки кишечника.Они могут повредить перемычки между клетками, позволяя некоторым веществам проходить через щели в кровоток.

Гастроэнтерологи (специалисты по заболеваниям кишечника) в целом согласны с тем, что эти раздражители обычно не вызывают ничего, кроме легкого воспаления определенной области кишечника.

Обычно это не вызывает явных симптомов и со временем улучшится, если вы перестанете принимать лекарства или пить алкоголь. В худшем случае воспаление может быть достаточно сильным, чтобы иногда вызывать язвы на слизистой оболочке кишечника.

Некоторые условия и методы лечения

Следующие условия и методы лечения также могут повредить уплотнения слизистой оболочки кишечника:

Как правило, даже в этих ситуациях лечение «дырявого» кишечника не требуется. Однако при определенных обстоятельствах люди с болезнью Крона, например, могут получить пользу от жидкой диеты, чтобы уменьшить воспаление кишечника, которое также улучшает проницаемость кишечника (подробнее о лечении болезни Крона).

Теория «синдрома дырявого кишечника»

Сторонники «синдрома проницаемой кишки» - в основном практикующие комплементарную и альтернативную медицину - полагают, что слизистая оболочка кишечника может стать раздраженной и негерметичной в результате гораздо более широкого спектра факторов, включая чрезмерный рост дрожжевых грибков или бактерий в кишечнике, плохой диета и злоупотребление антибиотиками.

Они считают, что непереваренные частицы пищи, бактериальные токсины и микробы могут проходить через «дырявую» стенку кишечника в кровоток, вызывая иммунную систему и вызывая стойкое воспаление по всему телу. По их словам, это связано с гораздо более широким кругом проблем со здоровьем, в том числе:

Однако в настоящее время мало свидетельств того, что эти состояния на самом деле вызваны повышенной кишечной проницаемостью.

Продвигаемые товары

Люди, пропагандирующие идею синдрома дырявого кишечника, предложили множество различных "методов лечения", включая диетические книги, пищевые добавки (например, содержащие пробиотики), лечебные травы, безглютеновые продукты и другие специальные диеты, такие как диеты с низким содержанием глютена. FODMAP, диета с низким содержанием сахара или противогрибковая диета.

Однако вам следует с осторожностью относиться к лечению, предлагаемому людьми, которые утверждают, что могут «вылечить синдром дырявого кишечника», поскольку существует мало научных доказательств того, что они полезны при многих состояниях, которые, как они утверждают, помогают.

Некоторые диетические изменения, предлагаемые при «синдроме дырявого кишечника» (например, диета с низким содержанием FODMAP), могут помочь людям с синдромом раздраженного кишечника (СРК), но они, похоже, работают независимо от наличия «дырявого» кишечника.

Как правило, исключение продуктов из рациона - не лучшая идея, если только это не является строго необходимым (например, если у вас глютеновая болезнь) и сделано по совету врача, поскольку это может привести к дефициту питательных веществ.

Рекомендации и дополнительная информация

Если у вас есть симптомы, которые не объясняются диагнозом, может быть полезно прочитать раздел о симптомах, необъяснимых с медицинской точки зрения. Такие загадочные симптомы удивительно распространены, составляя до пятой части всех консультаций терапевта в Великобритании.

Если вам поставили диагноз определенного состояния здоровья, вы можете найти его в нашем индексе лечения и состояний от А до Я, где вы найдете надежную, основанную на доказательствах информацию о его лечении.

В целом, разумно относиться к веб-сайтам «целостного» и «естественного здоровья» со скептицизмом - не предполагать, что предоставляемая ими информация верна или основана на научных фактах или доказательствах.

Последняя проверка страницы: 9 марта 2018 г.
Срок следующей проверки: 9 марта 2021 г.

границ | Антибиотики как основные разрушители кишечной микробиоты

Введение

Научные достижения последних десятилетий привели к растущему признанию роли микробиоты кишечника человека в здоровье и болезнях (Ananthakrishnan et al., 2019). До этого было проведено мало исследований непатогенных микроорганизмов, населяющих желудочно-кишечный тракт (Guarner, 2012). Поскольку большинство этих микроорганизмов невозможно культивировать, они оставались в значительной степени неизученными до появления молекулярных методов. Обширные экспериментальные и клинические данные показывают, что кишечные микроорганизмы необходимы для оптимального функционирования человеческого организма (Guarner, 2015).

В 1885 году Луи Пастер предположил, что животные, выращенные в стерильных условиях, не смогут выжить (Pasteur, 1885).Бернард С. Востманн и его команда доказали неверность гипотезы Пастера, когда разработали методы разведения животных в стерильных условиях (Wostmann, 1981). Однако они обнаружили, что стерильным животным требуется большое количество пищи, богатой питательными веществами, но при этом они по-прежнему задерживают рост и развитие по сравнению с нормальными животными. У здоровых животных были меньшие сердца, легкие и печень, более низкий сердечный выброс, более тонкие стенки кишечника, сниженная перистальтика желудочно-кишечного тракта, более низкие уровни сывороточного гамма-глобулина и атрофированные лимфатические узлы (Wostmann, 1981).Большинство этих недостатков можно восстановить путем введения кишечной микробиоты животных, выращенных в нормальных условиях. Следовательно, хотя колонизация микробов может и не иметь существенного значения для жизни, она имеет решающее значение для здоровья (Guarner and Malagelada, 2003; O’Hara and Shanahan, 2006).

Знания, полученные на беспроблемных животных моделях, в настоящее время используются в физиологии и медицине человека посредством исследований комменсальных микроорганизмов (Gilbert et al., 2018). Экологические ниши, расположенные вдоль желудочно-кишечного тракта, от рта до ануса, содержат самые крупные микробные сообщества, обнаруженные в организме человека, включая примерно 3.9 × 10 13 бактериальных клеток, которые можно исследовать в образцах фекалий, используя комбинацию геномного и культурального подходов (Browne et al., 2016; Sender et al., 2016). Магнитно-резонансная томография показывает, что толстый кишечник населен несколькими сотнями граммов микробов, что неудивительно, поскольку в нем созданы оптимальные условия для размножения микробов (т.е. постоянная температура, анаэробиоз и медленная моторика) (Bendezú García et al., 2016 ).

Разработка антибиотиков широко считается одним из величайших достижений медицины 20 века (Bud, 2007; Королевский колледж врачей Эдинбурга, 2010).В период с 2000 по 2015 год использование антибиотиков во всем мире увеличилось на 65% (Klein et al., 2018). Хотя большинство курсов лечения антибиотиками не имеют явных побочных эффектов, антибиотики могут вызывать значительные изменения в микробиоте кишечника, которые имеют как краткосрочные, так и долгосрочные последствия для здоровья (Dethlefsen and Relman, 2011). Долгое время подозревалась связь между ранним воздействием антибиотиков и детской астмой, аллергией и заболеваниями дыхательных путей (Foliaki et al., 2009). Наблюдательные исследования также указывают на участие антибиотиков в патогенезе других все более распространенных состояний, включая желудочно-кишечные инфекции, увеличение веса и ожирение, воспалительное заболевание кишечника (ВЗК) и колоректальный рак (Lange et al., 2016). Еще одно серьезное последствие использования антибиотиков - развитие устойчивости бактерий к антибиотикам (Giedraitiene et al., 2011).

Целью данной статьи является обзор литературы о микробиоте кишечника и ее значении для здоровья человека, а также описание рисков, связанных с использованием антибиотиков, и описание некоторых подходов, которые могут минимизировать эти риски.

Микробиота кишечника человека

Микробиота определяется как совокупность микроорганизмов, присутствующих в конкретной среде, в то время как термин «микробиом» относится ко всей среде обитания, включая микроорганизмы (бактерии, археи, низшие и высшие эуркариоты и вирусы), их геномы и условия окружающей среды, существующие в этой среде обитания (Marchesi and Ravel, 2015).Бактерии, археи, эукариоты (грибы и протисты) и вирусы, населяющие желудочно-кишечный тракт человека, в совокупности называют микробиотой кишечника человека.

Состав

Генома одного симбиотического вида микробов, вероятно, недостаточно для выживания (Guarner, 2015). В результате многовидовые сообщества, организованные вокруг сложной сети метаболических взаимозависимостей, например, в кишечнике человека, представляют собой естественную среду для большинства симбиотических микробов (Guarner, 2015).

Развитие независимых от культуры методов исследования, сочетающих генетическое секвенирование с биоинформатикой, привело к быстрому прогрессу в изучении микробиоты кишечника человека (Guarner, 2015). Одним из наиболее распространенных методов, используемых для таксономической идентификации и оценки видового разнообразия прокариот (бактерий и архей), является секвенирование гена, кодирующего малую субъединицу рибосомной РНК (16S рРНК) (Guarner, 2015). Из 55 типов, составляющих домен Bacteria, только от семи до девяти обнаружены в кишечнике человека, при этом большинство (90%) принадлежит типам Bacteroidetes и Firmicutes (Eckburg et al., 2005). Другие типы, постоянно идентифицируемые в кишечнике человека, включают Proteobacteria , Actinobacteria , Fusobacteria и Verrucomicrobia , при этом было обнаружено очень мало видов архей (Eckburg et al., 2005).

Другой метод исследования, не зависящий от культуры, - это секвенирование всего генома, которое позволяет составить перечень всех генов, присутствующих в образце. Секвенирование всего генома также позволяет анализировать функциональные и метаболические сети, а также обнаруживать гены, принадлежащие небактериальным членам микробного сообщества, таким как вирусы, дрожжи и протисты.Всего в образцах фекалий человека было идентифицировано около 10 миллионов неизбыточных микробных генов (Li et al., 2014). В среднем в желудочно-кишечном тракте человека присутствует 600 000 неизбыточных микробных генов, из которых 300 000 генов являются общими для людей, живущих в Европе, Северной Америке и Китае (Li et al., 2014).

Существуют различия между микробными сообществами, населяющими просвет и слизистую оболочку одного и того же человека (Eckburg et al., 2005; Donaldson et al., 2016). Кроме того, виды бактерий, обнаруживаемые в просвете, варьируются от слепой до прямой кишки. В слепой кишке медленное время прохождения и отсутствие простых сахаров способствуют размножению ферментативных разлагающих полисахариды анаэробов, в частности Prevotella , Roseburia , Faecalibacterium , Lachnospira и Eubacterium . В дистальных отделах толстой кишки распространены муколитические и протеолитические виды (например, Bacteroides , Ruminococcus , Akkermansia , Bifidobacterium , Methanobrevibacter , Desulfovibrio , Proteus и Escherichia ).Бактерии, ассоциированные со слизистой оболочкой, от терминального отдела подвздошной кишки до прямой кишки, как правило, более стабильны на уровне филума и рода, но были описаны участки гетерогенности в пределах одной и той же области кишечника (Donaldson et al., 2016).

Большинство штаммов, составляющих микробиоту кишечника, являются резидентами в течение десятилетий, хотя их относительная численность меняется со временем у каждого конкретного человека (Donaldson et al., 2016). Однако продольные исследования показывают, что такие факторы, как диета, прием лекарств, образ жизни (курение, путешествия, физическая активность), сопутствующие заболевания или время прохождения через толстую кишку, влияют на микробный состав образцов фекалий, полученных от уникального хозяина (Gilbert et al. al., 2018; Allaband et al., 2019; Zmora et al., 2019). Хотя внутриличностные изменения в составе микробиоты кишечника могут быть значительными, например, из-за эпизода острой инфекционной диареи или после лечения антибиотиками, со временем она имеет тенденцию возвращаться к своему состоянию, предшествующему нарушению, - качеству, известному как устойчивость (Gilbert et al. др., 2018; Allaband et al., 2019). Разнообразие кишечной микробиоты также изменяется с возрастом, увеличиваясь от младенчества до взрослого возраста и уменьшаясь у пожилых людей. Микробные изменения кишечника у пожилых людей коррелируют с показателями слабости, нутритивного статуса и маркеров воспаления, что позволяет предположить, что изменения микробиоты, обусловленные диетой, играют роль в различных темпах ухудшения здоровья, связанного с возрастом (Kuipers, 2019).

Микробиота кишечника каждого отдельного человека содержит множество уникальных штаммов, не обнаруженных у других людей, и межличностные различия в составе микробиоты намного больше, чем внутрииндивидуальные вариации (Allaband et al., 2019). Пол, этническая принадлежность и географическое положение влияют на таксономический состав микробиома (Gaulke and Sharpton, 2018). Например, фекальная микробиота взрослых из мегаполисов Европы и Северной Америки менее разнообразна по сравнению со взрослыми из сельских жителей Африки и Южной Америки (Clemente et al., 2015; Зонненбург и Зонненбург, 2019).

Энтеротипы

Несмотря на внутри- и межиндивидуальные различия, анализ микробного состава образцов фекалий американских, европейских и японских особей показал сходство в структуре кишечной микробиоты на уровне рода (Arumugam et al., 2011 ). Многомерное масштабирование и анализ главных координат выявили существование трех кластеров, или энтеротипов, каждый из которых характеризовался преобладанием одного рода: Bacteroides (энтеротип 1), Prevotella (энтеротип 2) или Ruminococcus (энтеротип 3).Кластеризация не зависела от возраста, пола, национальности или индекса массы тела (Arumugam et al., 2011). Результаты этого исследования показывают, что существует ограниченное количество хорошо сбалансированных симбиотических состояний микробиоты и хозяина. Кроме того, дискретная природа этих состояний предполагает, что структура микробиоты кишечника человека в первую очередь определяется взаимодействиями между различными родами бактерий (Guarner, 2015).

Клинические последствия энтеротипов были предметом нескольких исследований (Costea et al., 2018). Энтеротип Bacteroides был связан со снижением генетического разнообразия микробов, резистентностью к инсулину и риском ожирения и неалкогольного стеатогепатита (Le Chatelier et al., 2013; Costea et al., 2018). Возможно, неудивительно, что длительный режим питания может быть одним из факторов, определяющих энтеротип (Wu et al., 2011). Рационы, богатые животным белком и жирами, связаны с энтеротипом Bacteroides , тогда как диеты, характеризующиеся преобладанием растительных углеводов, связаны с энтеротипом Prevotella (Wu et al., 2011).

Функции

Функции микробиоты кишечника человека делятся на три категории, а именно метаболические, защитные и трофические функции (Guarner and Malagelada, 2003) (рис. 1).

Рис. 1 Функции микробиоты кишечника человека.

Метаболическая функция включает ферментацию неперевариваемых пищевых субстратов и восстановление энергии и питательных веществ. У людей переваривание овощей, фруктов, орехов и цельнозерновых злаков в основном осуществляется кишечными микробами, поскольку наши ферментные ресурсы для переваривания углеводов ограничены амилазами и дисахаридазами.Кроме того, ферментация сложных углеводов в толстой кишке производит короткоцепочечные жирные кислоты, которые абсорбируются хозяином (Litvak et al., 2018). Бутират, продуцируемый Faecalibacterium prausnitzii и другими, ингибирует интерлейкин-17, генерирует регуляторные Т-клетки и оказывает противовоспалительное действие в экспериментальных моделях (Litvak et al., 2018). Микроорганизмы толстой кишки также расщепляют ксенобиотики и другие чужеродные соединения, способствуют синтезу аминокислот и витаминов и обеспечивают различными питательными веществами людей, соблюдающих монотонную диету (Zmora et al., 2019).

Микробиота кишечника выполняет защитную функцию, конкурируя за места прикрепления и питательные вещества с местными грибами или бактериями с патогенным потенциалом, такими как Candida и Clostridioides difficile , тем самым предотвращая инвазию или чрезмерный рост этих организмов (McFarland, 2008). Резидентные микроорганизмы также подавляют рост своих конкурентов, производя бактериоцины (McFarland, 2008).

Трофическая функция кишечной микробиоты включает стимулирование пролиферации и дифференцировки эпителиальных клеток, стимуляцию двигательной активности кишечника и нейроэндокринных путей кишечного происхождения, а также регуляцию иммунной системы и центральной нервной системы (Mayer et al., 2015).

Индукция и регуляция адаптивной иммунной системы - один из основных аспектов трофической функции кишечной микробиоты. Большая площадь поверхности желудочно-кишечного тракта постоянно подвергается воздействию различных антигенов. В результате кишечный иммунитет является самой большой и сложной частью общей иммунной системы, поскольку не менее 80% всех антител, вырабатываемых у взрослых, происходят из слизистой оболочки кишечника (Brandtzaeg, 2010). Кишечная иммунная система должна быть способна различать патогены и антигены, полученные из пищи или от комменсальных непатогенных микробов, потому что воспалительная реакция на чужеродный антиген также может нанести вред хозяину (Tanoue et al., 2016). Микробиота кишечника влияет на развитие адаптивной иммунной системы, стимулируя рост лимфоидных структур, дифференцировку Т- и В-клеток и формирование иммунной толерантности (Zhao and Elson, 2018).

Нарушение микробиоты кишечника

Термин дисбиоз относится к стойкому нарушению микробиоты кишечника и определяется как изменение как в составе, так и в функции микробиоты, вызванное факторами, связанными с хозяином и окружающей средой, которые подавляют сопротивление. и возможности устойчивости микробной экосистемы (Levy et al., 2017). Изменения микробиоты кишечника могут быть вовлечены в патогенез некоторых неинфекционных заболеваний и в переход этих состояний в хроническую форму. Многочисленные исследования показали связь между изменениями в составе микробиоты кишечника и заболеваниями, в том числе рецидивирующей диареей, связанной с C. difficile , некоторыми расстройствами кишечника (включая ВЗК), колоректальным раком, неалкогольным стеатогепатитом, диабетом 2 типа, ожирением и т. Д. и запущенное хроническое заболевание печени (Duvallet et al., 2017; Wirbel et al., 2019). Однако по некоторым из этих примеров исследования противоречивы, возможно, из-за того, что методология не была стандартизирована. Более того, эти связанные изменения микробиоты не обязательно указывают на причинную роль в патогенезе заболевания, они могут быть следствием самого заболевания. Таким образом, необходимы последующие когортные исследования, особенно исследования вмешательств, которые могут восстановить состав кишечной микробиоты.

Тем не менее, исследования на грызунах показали, что можно использовать фекальные трансплантаты для передачи определенных фенотипов болезней, включая резистентность к инсулину, ожирение, беспокойство и воспаление кишечника.Это говорит о том, что некоторые изменения микробиоты кишечника могут иметь причинную роль в этих заболеваниях. У людей трансплантация фекальной микробиоты хорошо зарекомендовала себя в лечении рецидивирующей диареи, вызванной инфекцией C. difficile (CDI) (Cammarota et al., 2017). Пересадка кала стала стандартной терапией этого состояния в соответствии с национальными рекомендациями (Mullish et al., 2018). Менее успешные результаты наблюдались при попытках лечения ВЗК. Существует четыре рандомизированных испытания, в которых трансплантат фекалий оценивался как индукционная терапия для достижения ремиссии при активном язвенном колите, и в совокупности они показали статистическое улучшение по сравнению с контролем.Через 8 недель у 37% участников в группе трансплантации стула была ремиссия по сравнению с 18% участников в контрольной группе (Imdad et al., 2018). Необходимы дополнительные исследования для дальнейшего определения материала трансплантата, богатого микробными популяциями, которые определены как отсутствующие у пациента, и избежания трансплантатов, богатых агрессивными, избыточно представленными микробами.

Утрата видового разнообразия, по-видимому, является общей чертой нарушенной микробиоты кишечника. Низкое микробное богатство связано с избытком противовоспалительных видов микробов, что может привести к воспалению кишечника и нарушению функции слизистого барьера.В исследовании, в котором количество микробных генов в образцах фекалий использовалось как показатель разнообразия, люди с низким количеством генов с большей вероятностью имели резистентность к инсулину или лептину, ожирение или дислипидемию, а также более выраженный воспалительный фенотип по сравнению с людьми с большое количество генов (Le Chatelier et al., 2013). Эта связь может указывать на то, что низкое микробное богатство увеличивает риск развития метаболического синдрома (т. Е. Ожирения, артериальной гипертензии, диабета 2 типа, дислипидемии и неалкогольного стеатогепатита).

С точки зрения функциональной способности микробиоты кишечника, низкое количество микробных генов, по-видимому, связано со сниженным образованием короткоцепочечных жирных кислот (особенно бутирата) для хозяина (Le Chatelier et al., 2013). Неспособность производить бутират увеличивает поток кислорода к слизистой оболочке и нарушает микроэкосистему таким образом, что способствует выживанию устойчивых к кислороду бактерий и препятствует восстановлению строгих анаэробов (Litvak et al., 2018). Таким образом, дисбактериоз описывают как нарушение симбиотического баланса между микробиотой и хозяином.Такие изменения критически влияют на способность экосистемы к сопротивлению и увеличивают вероятность того, что дисбаланс станет хроническим.

Влияние антибиотиков на микробиоту кишечника

Лечение антибиотиками снижает общее разнообразие видов кишечной микробиоты, включая потерю некоторых важных таксонов, что вызывает метаболические сдвиги, увеличивает восприимчивость кишечника к колонизации и стимулирует развитие устойчивости бактерий к антибиотикам (Lange et al. др., 2016).

Уменьшение разнообразия

Использование антибиотиков связано с уменьшением разнообразия микробиоты.Сообщается, что у детей восстановление микробного разнообразия после лечения антибиотиками занимает примерно 1 месяц (Yassour et al., 2016). У взрослых введение комбинации меропенема, гентамицина и ванкомицина привело к увеличению распространенности Enterobacteriaceae и других патобионтов и уменьшению количества Bifidobacterium и видов, продуцирующих бутират (Palleja et al., 2018) ( Фигура 2). В то время как исходный состав микробиоты кишечника в основном восстановился в пределах 1.Через 5 месяцев несколько обычных видов оставались необнаруженными до конца периода наблюдений (180 дней) (Palleja et al., 2018).

Рис. 2 Четырехдневное лечение антибиотиками вызвало большие сдвиги в численности бактерий. Графики показывают относительную численность репрезентативных видов в соответствии с их схемой изменения после четырехдневного лечения антибиотиками в течение 180-дневного периода наблюдения. По материалам Palleja et al. (2018).

Антибиотики также могут нарушить баланс, который обычно существует между различными видами кишечной микробиоты.Например, вызывая уменьшение видового разнообразия, антибиотики могут привести к чрезмерному росту патобионтов, таких как токсигенный C. difficile (Ianiro et al., 2020).

Следует отметить, что уменьшение разнообразия не обязательно означает уменьшение количества бактерий в целом. По мере уничтожения чувствительных к антибиотикам бактерий, устойчивые к антибиотикам бактерии размножаются и занимают их место. Фактически, общая микробная нагрузка может увеличиваться после лечения антибиотиками, даже несмотря на сокращение видового разнообразия.В исследовании пациентов, получавших антибиотики широкого спектра действия, лечение β-лактамами в течение 7 дней увеличивало микробную нагрузку в образцах фекалий в два раза (Panda et al., 2014). В этом исследовании использование антибиотиков широкого спектра действия также увеличило соотношение Bacteroidetes к Firmicutes (Panda et al., 2014).

Измененный метаболом

Полный набор малых молекул (<1500 Да), обнаруженных в биологической системе, называется метаболомом этой системы (Lamichhane et al., 2018). Действие антибиотиков на метаболом кишечника изучено хуже, чем их влияние на разнообразие кишечных микробов. Одним из факторов, усложняющих исследование этой связи, является метаболомная избыточность. Несмотря на эти проблемы, некоторые эффекты антибиотиков на метаболом кишечника у мышей были описаны (Cho et al., 2012; Choo et al., 2017). В исследовании на молодых мышах низкие дозы антибиотиков приводили к увеличению ожирения и повышению уровня гормонов, связанных с метаболизмом углеводов, липидов и холестерина (Cho et al., 2012). В другом исследовании введение ванкомицин-имипенема привело к повышению уровня арабинита и сахаров (например, сахарозы) в кале (Choo et al., 2017). Повышенные уровни этих соединений были связаны с повышенной восприимчивостью к ИКД, потенциально выступая в качестве субстрата для роста. Ванкомицин / имипенем также снижал относительную численность бактерий Lachnospiraceae и Ruminococcaceae , которые обычно превращают арабинитол в пентозные сахара. Сразу после прекращения приема ванкомицина / имипенема наблюдалось небольшое, но значительное снижение уровня аргинина, что коррелировало с увеличением распространенности видов Escherichia и Shigella и снижением распространенности Ruminococcaceae и Bacteroides .Увеличение аргинина, наблюдаемое через 9 дней после окончания приема ванкомицина / имипенема, коррелировало с увеличением распространенности организмов из рода Enterobacter и снижением распространенности Alistipes . Аргинин служит предшественником ряда иммуномодулирующих соединений (Choo et al., 2017).

Воздействие антибиотиков вызывает изменения в метаболоме кишечника, которые могут коррелировать или не коррелировать с изменениями в микробиоме. У пациентов с метаболическим синдромом пероральный прием ванкомицина снижает количество вторичных желчных кислот в кале с одновременным повышением первичных желчных кислот в плазме после приема пищи.Одновременно ванкомицин влиял на физиологию хозяина, снижая периферическую чувствительность к инсулину (Vrieze et al., 2014). Вызванные антибиотиками изменения метаболизма желчных кислот могут повлиять на физиологию хозяина и восприимчивость к инфекции.

Устойчивость к антибиотикам

Устойчивость к антибиотикам определяется как способность определенного вида бактерий выживать при концентрациях антибиотиков, которые подавляют или убивают другие бактерии того же вида (Sabtu et al., 2015). Впервые он появился у бактерий, продуцирующих антибиотики, как способ защиты от собственных продуктов и конкуренции с другими микробами (Rolain, 2013).Во всем мире устойчивость к антибиотикам стала серьезной проблемой для общественного здравоохранения. В период с 2000 по 2015 год потребление антибиотиков в мире увеличилось на 65% (Klein et al., 2018), причем наиболее часто используемыми антибиотиками были амоксициллин и амоксициллин / клавулановая кислота (Всемирная организация здравоохранения, 2018). В период с 2000 по 2015 год наибольший рост использования антибиотиков наблюдался в развивающихся странах, и разрыв между развивающимися и развитыми странами сократился. Устойчивость к антибиотикам является причиной примерно 35 000 смертей в США и 25 000 смертей в Европе ежегодно (Европейское агентство по лекарственным средствам и Европейский центр профилактики и контроля заболеваний, 2009 г .; Центры по контролю и профилактике заболеваний, 2019 г.).Согласно одной из оценок, к 2050 году количество смертей в год, вызванных устойчивостью к антибиотикам, составит 317 000 в Северной Америке, 390 000 в Европе, 392 000 в Латинской Америке, 4 150 000 в Африке и 4 730 000 в Азии (Sugden et al., 2016). По оценкам Всемирной организации здравоохранения, к 2050 году число смертей, связанных с устойчивостью к антибиотикам, может достигнуть 10 миллионов (Всемирная организация здравоохранения, 2019). В Китае резистентность резко возросла из-за широкомасштабного использования антибиотиков в животноводстве (Van Boeckel et al., 2015). Неправильное использование антибиотиков, чему способствует их доступность без рецепта и в Интернете, является основным фактором устойчивости к антибиотикам (Sabtu et al., 2015). Повышенная распространенность устойчивых к антибиотикам бактерий приводит к возникновению инфекций, которые трудно и дорого лечить. Поскольку старые антибиотики теряют эффективность из-за резистентности, необходимо использовать новые антибиотики. Однако эти лекарства более дорогие и могут быть недоступны для многих из тех, кто в них нуждается, особенно в странах с высоким бременем инфекционных заболеваний (Klein et al., 2018).

Бактерии разработали ряд процессов, позволяющих избежать воздействия антибиотиков, включая защиту от поглощения антибиотиков через их клеточные мембраны, разработку ферментативных процессов, которые изменяют или разлагают антибиотик, изменение молекул, на которые нацелены антибиотики, и активное удаление антибиотиков из клетка через специализированных белков оттока (Giedraitiene et al., 2011). Бактериальные ферменты, которые способны нейтрализовать антибиотики, включают β-лактамазы, ферменты, модифицирующие аминогликозиды, и ацетилтрансферазы хлорамфеникола (Giedraitiene et al., 2011). Бактерии также способны мутировать молекулярные мишени антибиотиков, вмешиваясь в высокоспецифичное взаимодействие между антибиотиком и его молекулой-мишенью посредством небольших структурных модификаций. Например, мутации в пенициллин-связывающих белках снижают эффективность β-лактамов, мутации в 23S рРНК придают устойчивость к макролидам, линкозамидам и стрептограмину B, а мутации ДНК-топоизомеразы II и IV приводят к устойчивости к хинолонам и фторхинолонам (Giedraitiene et al. ., 2011). Бактерии могут устранять противомикробные агенты, выкачивая их через выходящие белки , расположенные в мембране бактериальной клетки. Хотя эти белки могут быть специфичными для антибиотиков, большинство из них являются переносчиками нескольких лекарственных препаратов. Другой механизм устойчивости - снижение проницаемости внешней мембраны, что приводит к снижению поглощения антибиотиков (Giedraitiene et al., 2011).

У человека микробиота кишечника содержит пул генов устойчивости к антибиотикам. Лечение антибиотиками быстро увеличивает пул генов устойчивости, присутствующих в кишечнике, который постепенно уменьшается после прекращения лечения (Rolain, 2013).Устойчивые к антибиотикам кишечные бактерии могут передаваться новорожденному от его / ее матери при рождении и после этого могут сохраняться в течение нескольких недель. В шведском исследовании устойчивость к тетрациклину была обнаружена у 12% комменсальных штаммов E. coli от младенцев, не получавших тетрациклин (Karami et al., 2006).

Клинические последствия использования антибиотиков

Краткосрочные и среднесрочные последствия

Диарея, связанная с антибиотиками

Диарея, связанная с антибиотиками (AAD), определяется как диарея, которая возникает в связи с приемом антибиотиков и не может быть объяснена иным образом (Бартлетт, 2002).Диарея может возникать во время лечения антибиотиками и до 8 недель после прекращения лечения (McFarland, 2008).

В нормальных условиях гомеостаз кишечного эпителия поддерживается рядом механизмов, включая толстый слой слизи и плотные соединения для поддержания целостности кишечного эпителия (Willing et al., 2011). Количество кишечных бактерий контролируется антимикробными пептидами (лектины C-типа, дефенсины и кателицидины), которые секретируются в слой слизи вместе с секреторным иммуноглобулином A (IgA) в ответ на микробные паттерны, связанные с микроорганизмами.Воздействие антибиотиков устраняет подгруппы нормальных кишечных микробов, тем самым снижая воздействие микробных структур, связанных с микроорганизмами, и уменьшая секрецию антимикробных пептидов (Willing et al., 2011). Кроме того, некоторые антибиотики вызывают истончение слизистого слоя и нарушение плотных контактов, что делает эпителий кишечника более восприимчивым к повреждениям. Изменения микробных протеаз также могут влиять на барьерную функцию слизистых оболочек. В совокупности эти процессы способствуют успешной инвазии кишечных патогенов (Willing et al., 2011).

Распространенность ААД среди пациентов, получающих антибиотики, составляет примерно 5–35% (McFarland, 2008). В исследовании взрослых амбулаторных пациентов, получающих антибиотики в течение 5–10 дней, частота ААД составила 17,5% (Beaugerie et al., 2003). Клиническое течение ААД различается в зависимости от того, был ли вовлечен C. difficile , при этом большинство эпизодов ААД, отличных от C. difficile , были легкой степени тяжести и самоограничивались, продолжаясь всего несколько дней (Beaugerie et al., 2003 ).

Мета-анализ показал, что определенные штаммы пробиотиков могут быть полезны для профилактики ААД. По сравнению с плацебо или отсутствием лечения, риск ААД среди взрослых и детей, получавших антибиотики, был значительно снижен при терапии пробиотиками, состоящей из Lactobacillus rhamnosus GG (относительный риск 0,49; 95% ДИ 0,29–0,83) (Szajewska and Kolodziej, 2015a) или Saccharomyces boulardii (отношение рисков 0,47; 95% ДИ 0,38–0,57) (Szajewska and Kolodziej, 2015b).

Руководящие принципы Европейского общества детской гастроэнтерологии, гепатологии и питания 2016 года по пробиотикам и пребиотикам рекомендуют L. rhamnosus GG и S. boulardii для профилактики ДПА у детей, в обоих случаях как сильная рекомендация с умеренным качеством доказательств. (Szajewska et al., 2016).

C. difficile - ассоциированная диарея

C. difficile - это грамположительная спорообразующая анаэробная палочка со спорами, которые обладают высокой устойчивостью к высыханию, химическим веществам и экстремальным температурам и могут сохранять жизнеспособность в течение многих лет. (Эдвардс и др., 2016). C. difficile продуцирует токсины A и B, которые могут повреждать слизистую оболочку кишечника (Kuehne et al., 2010).

В 2011 году в США было зарегистрировано 453 000 случаев ИКД и 29 000 смертей, связанных с ИКД (Leffler and Lamont, 2015). Значительная часть ИКД является нозокомиальной, при этом частота ИКД составляет примерно 20 случаев на 100 000 человеко-лет в сообществе и примерно 15 случаев на 1000 выписок из больниц (Leffler and Lamont, 2015). Наиболее значительным фактором риска ИКД является прием антибиотиков, при этом наиболее часто ассоциируемыми препаратами являются ампициллин, амоксициллин, цефалоспорины, клиндамицин и фторхинолоны.И продолжительность антибактериальной терапии, и количество используемых препаратов положительно коррелируют с более высоким риском ИКД. К другим факторам риска относятся пожилой возраст, ослабленный иммунитет и госпитализация, особенно в отделении интенсивной терапии (Leffler and Lamont, 2015).

Диагностика ИКД у пациентов с диареей основана на наличии бактерий в стуле. ИКД считается тяжелой, если уровень сывороточного альбумина <3 г / дл и либо количество лейкоцитов ≥15000 на мм 3 , либо присутствует болезненность в животе (Surawicz et al., 2013). Был предложен двухэтапный алгоритм обнаружения C. difficile в образцах стула, который позволяет быстро диагностировать в течение 4 часов. Этап 1 состоит из обнаружения C. difficile -специфического антигена глутаматдегидрогеназы, а этап 2 - обнаружения токсина A или B. Приблизительно 87,3% подозреваемых случаев могут быть исключены на первом этапе. Если на втором этапе токсин не обнаружен, следует провести посев (Fenner et al., 2008).

Рекомендуемые методы лечения ИКД включают метронидазол 500 мг перорально три раза в день в течение 10 дней в легких и умеренных случаях и ванкомицин 125 мг четыре раза в день в течение 10 дней в тяжелых случаях.По возможности следует прекратить прием антибиотиков, которые привели к ИКД (Surawicz et al., 2013; Neut et al., 2017).

Несколько метаанализов оценили использование пробиотиков для профилактики ИКД у детей и взрослых, получающих антибиотики. Два метаанализа показали, что частота ИКД ниже у взрослых пациентов, получающих пробиотики в дополнение к лечению антибиотиками, чем у тех, кто получал плацебо (Johnson et al., 2012; Goldenberg et al., 2013), в то время как другой метаанализ получили аналогичные результаты у детей (Goldenberg et al., 2015). Несмотря на эти результаты, доказательств того, что пробиотики предотвращают ИКД, было сочтено недостаточным для поддержки их повседневного использования (Surawicz et al., 2013).

Инфекция Helicobacter pylori

Helicobacter pylori (Hp) - это грамотрицательная спиралевидная микроаэрофильная бактерия, которая колонизирует слизистую оболочку желудка человека (Perez-Perez and Blaser, 1996; Suerbaum and Michetti, 2002) . Инфекция Hp вызывает воспалительную реакцию слизистой оболочки желудка. В большинстве случаев это протекающая бессимптомная реакция.Однако у некоторых людей инфекция может приводить к язве желудка и двенадцатиперстной кишки, кишечной метаплазии и раку желудка (Suerbaum and Michetti, 2002).

В настоящее время в регионах с высокой устойчивостью к кларитромицину (> 15%) рекомендуется четырехкратная или невисмутовая сопутствующая терапия (например, ингибитор протонной помпы, амоксициллин, кларитромицин и метронидазол) (Malfertheiner et al., 2017) . Однако в регионах с высокой устойчивостью к кларитромицину и метронидазолу в качестве терапии первой линии рекомендуется четырехкратная терапия висмутом (Malfertheiner et al., 2017).

Эрадикация Hp может иметь как положительные, так и отрицательные эффекты. С одной стороны, эрадикация Hp восстанавливает состав микробиоты в соответствии с Hp-отрицательными контролями (Li et al., 2017). С другой стороны, эрадикация Hp, как сообщается, вызывает изменения в составе микробиоты, которые могут негативно повлиять на хозяина (Yap et al., 2016). Эрадикация Hp была связана с уменьшением относительной численности Bacteroidetes и увеличением Firmicutes .Увеличение распространенности бактерий, продуцирующих короткоцепочечные жирные кислоты, может привести к повышенному риску метаболических нарушений (Yap et al., 2016). Неудача эрадикационной терапии Hp была связана с плохим соблюдением режима лечения из-за побочных эффектов, связанных с антибиотиками (Losurdo et al., 2018).

Стратегия эрадикации Hp, сочетающая пробиотики ( S. boulardii ) с тройной терапией, была более эффективной и имела лучший профиль побочных эффектов, чем плацебо или отсутствие вмешательства плюс тройная терапия (Szajewska et al., 2010; Szajewska et al., 2015). Добавление пробиотиков, содержащих Lactobacillus и Bifidobacterium , к эрадикационной терапии Hp также было связано с улучшением профиля эффективности и безопасности по сравнению с эрадикационной терапией без пробиотиков (Wang et al., 2013; Losurdo et al., 2018). В метаанализе исследований у пациентов, получавших антибиотикотерапию для эрадикации Hp, добавление L. acidophilus , L. casei DN-114001, L. gasseri и Bifidobacterium infantis 2036 было связано со значительно более высокой степенью эрадикации. показатели по сравнению с контролем (без пробиотических добавок) (Dang et al., 2014).

Долгосрочные последствия

Антибиотики широко используются у младенцев и детей, причем системные антибиотики являются наиболее часто назначаемыми лекарствами для детей в США (Chai et al., 2012). Использование антибиотиков в детстве было связано с несколькими негативными последствиями в более позднем возрасте, включая развитие ожирения, астмы, аллергии и ВЗК (Cho et al., 2012; Bokulich et al., 2016; Korpela et al., 2016; Turta и Раутава, 2016).

Воздействие антибиотиков в младенчестве связано с задержкой развития кишечной микробиоты.В исследовании младенцев в возрасте до 2 лет задержка развития микробиоты после приема антибиотиков была особенно выражена в возрасте от 6 до 12 месяцев (Bokulich et al., 2016). Виды Enterobacteriaceae , Lachnospiraceae и Erysipelotrichaceae были среди рабочих таксономических единиц, которые были истощены антибиотиками (Bokulich et al., 2016). Кроме того, частое использование макролидных антибиотиков в первые 2 года жизни было в значительной степени связано либо с текущей астмой и ожирением, либо с последующим развитием этих состояний (Korpela et al., 2016).

Считается, что раннее воздействие антибиотиков и возникающий в результате дисбактериоз вносят вклад в патогенез ВЗК. Популяционное когортное исследование показало, что у младенцев, получавших антианаэробные антибиотики на первом году жизни, вероятность диагностирования ВЗК выше, чем у детей, не получавших антибиотики (Kronman et al., 2012). Точно так же общенациональное датское когортное исследование детей показало, что вероятность развития ВЗК была самой высокой в ​​первые 3 месяца после приема антибиотиков, а также у детей, прошедших не менее семи курсов антибиотиков (Hviid et al., 2011). Общенациональное финское исследование «случай-контроль» также показало более сильную связь между болезнью Крона и применением антибиотиков у мальчиков, чем у девочек; класс антибиотиков с наиболее сильной ассоциацией с болезнью Крона - цефалоспорины (Virta et al., 2012).

Известно, что генетика человека и диета играют важную роль в определении массы тела; однако в настоящее время широко признано, что увеличение распространенности ожирения за последние 30 лет также может быть связано с изменениями в составе микробиоты кишечника (Biedermann and Rogler, 2015).В частности, воздействие антибиотиков в раннем возрасте было связано с развитием ожирения у людей (Trasande et al., 2013).

Выводы

Недавние исследования показали, что микробиота кишечника представляет собой сложную сеть метаболически взаимозависимых микроорганизмов. Симбиотическая микробиота кишечника выполняет несколько жизненно важных функций, помогая пищеварению, стимулируя и регулируя иммунную систему и предотвращая рост патогенов. Все более широкое использование антибиотиков является серьезной причиной для беспокойства, поскольку антибиотики разрушают микробиоту кишечника.Чтобы решить эту проблему, необходимы дальнейшие исследования, чтобы улучшить наше понимание микробиоты кишечника и стратегии по обращению вспять этих нарушений, включая использование пробиотиков.

Вклад авторов

Все авторы (JR, LB, VS, FG, AM и HC) написали, отредактировали и рецензировали черновики рукописи и соглашаются нести ответственность за содержание работы. Все авторы внесли свой вклад в статью и одобрили представленную версию.

Финансирование

Разработка этой обзорной статьи финансировалась Biocodex France.Спонсор не участвовал в разработке, сборе, анализе, интерпретации данных, написании этой статьи или решении представить ее для публикации.

Конфликт интересов

FG является членом консультативных советов Biocodex и Instituto Danone; и получил гранты на исследования от AB Biotics, Takeda и Abbvie. AM является спикером и членом консультативного совета Biocodex France. HC является консультантом Biocodex и Megapharma.

Остальные авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Благодарности

Мы хотели бы поблагодарить Георгия Филатова из Springer Healthcare Communications, оказавшего помощь в редактировании этой рукописи, и Сару Грейг, PhD, Springer Healthcare Communications, которая оформляла рукопись для подачи. Эта помощь в написании медицинских документов финансировалась Biocodex.

Ссылки

Allaband C., McDonald D., Vazquez-Baeza Y., Minich J. J., Tripathi A., Brenner D. A., et al. (2019). Микробиом 101: изучение, анализ и интерпретация данных микробиома кишечника для врачей. Clin. Гастроэнтерол. Гепатол. 17, 218–230. doi: 10.1016 / j.cgh.2018.09.017

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Анантакришнан А. Н., Сингал А. Г., Чанг Л. (2019). Микробиом кишечника и здоровье пищеварительной системы - новые рубежи. Clin. Гастроэнтерол. Гепатол. 17, 215–217. doi: 10.1016 / j.cgh.2018.10.040

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Beaugerie L., Flahault A., Barbut F., Atlan P., Lalande V., Кузен П. и др. (2003). Диарея, связанная с антибиотиками, и Clostridium difficile в сообществе. Aliment Pharmacol. Ther. 17, 905–912. doi: 10.1046 / j.1365-2036.2003.01531.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Bendezú García R., Barba E., Burri E., Cisternas D., Accarino A., Quiroga S., et al. (2016). Содержание толстой кишки в здоровье и его связь с функциональными симптомами кишечника. Нейрогастроэнтерол. Мотил. 28, 849–854.doi: 10.1111 / nmo.12782

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Бокулич Н. А., Чанг Дж., Батталья Т., Хендерсон Н., Джей М., Ли Х. и др. (2016). Антибиотики, способ родов и диета влияют на созревание микробиома в молодом возрасте. Sci. Пер. Med. 8, 343ra82. doi: 10.1126 / scitranslmed.aad7121

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Браун Х. П., Форстер С. К., Анонье Б. О., Кумар Н., Невилл Б. А., Старес М.D., et al. (2016). Культивирование «некультивируемой» микробиоты человека обнаруживает новые таксоны и обширное спороношение. Природа. 533, 543–546. DOI: 10.1038 / nature17645

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Cammarota G., Ianiro G., Tilg H., Rajilic-Stojanovic M., Kump P., Satokari R., et al. (2017). Европейская консенсусная конференция по трансплантации фекальной микробиоты в клинической практике. Gut. 66, 569–580. doi: 10.1136 / gutjnl-2016-313017

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Чай Г., Говернэйл Л., МакМахон А. В., Тринидад Дж. П., Стаффа Дж., Мерфи Д. (2012). Тенденции амбулаторного использования рецептурных лекарств среди детей в США, 2002-2010 гг. Педиатрия. 130, 23–31. doi: 10.1542 / peds.2011-2879

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Чо И., Яманиши С., Кокс Л., Мете Б. А., Завадил Дж., Ли К. и др. (2012). Антибиотики в раннем возрасте изменяют микробиом толстой кишки и ожирение у мышей. Природа. 488, 621–626. doi: 10.1038 / nature11400

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Choo J.М., Канно Т., Заин Н. М., Леонг Л. Э., Абелл Г. К., Кибл Дж. Э. и др. (2017). Дивергентные отношения между фекальной микробиотой и метаболомом после различных нарушений, вызванных антибиотиками. мСфера 2, e00005–17. doi: 10.1128 / mSphere.00005-17

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Clemente J. C., Pehrsson E. C., Blaser M. J., Sandhu K., Gao Z., Wang B., et al. (2015). Микробиом индейцев, не вступавших в контакт. Sci. Adv . 1, e1500183.doi: 10.1126 / sciadv.1500183

CrossRef Полный текст | Google Scholar

Costea P. I., Hildebrand F., Arumugam M., Backhed F., Blaser M. J., Bushman F. D., et al. (2018). Энтеротипы в структуре микробного сообщества кишечника. Nat. Microbiol. 3, 8–16. doi: 10.1038 / s41564-017-0072-8

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Dang Y., Reinhardt J. D., Zhou X., Zhang G. (2014). Влияние добавок пробиотиков на скорость эрадикации Helicobacter pylori и побочные эффекты во время эрадикационной терапии: метаанализ. PloS One 9, e111030. doi: 10.1371 / journal.pone.0111030

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Детлефсен Л., Релман Д. А. (2011). Неполное восстановление и индивидуальные ответы микробиоты дистальных отделов кишечника человека на повторяющееся воздействие антибиотиков. Proc. Natl. Акад. Sci. США. 108 Приложение 1, 4554–4561. DOI: 10.1073 / pnas.1000087107

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Duvallet C., Gibbons S.М., Гарри Т., Иризарри Р. А., Алм Э. Дж. (2017). Мета-анализ исследований микробиома кишечника определяет специфические для болезни и общие реакции. Nat. Commun. 8, 1784. doi: 10.1038 / s41467-017-01973-8

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Eckburg P. B., Bik E. M., Bernstein C. N., Purdom E., Dethlefsen L., Sargent M., et al. (2005). Разнообразие микробной флоры кишечника человека. Наука. 308, 1635–1638. DOI: 10.1126 / science.1110591

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Эдвардс А.Н., Карим С. Т., Паскуаль Р. А., Джоухар Л. М., Андерсон С. Э., Макбрайд С. М. (2016). Химическая и стрессоустойчивость спор и вегетативных клеток Clostridium difficile. Фронт. Microbiol. 7, 1698. doi: 10.3389 / fmicb.2016.01698

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Феннер Л., Видмер А. Ф., Гой Г., Рудин С., Фрей Р. (2008). Быстрый и надежный алгоритм диагностики Clostridium difficile . J. Clin. Microbiol. 46, 328–330. doi: 10.1128 / JCM.01503-07

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Foliaki S., Pearce N., Bjorksten B., Mallol J., Montefort S., von Mutius E., et al. (2009). Использование антибиотиков в младенчестве и симптомы астмы, риноконъюнктивита и экземы у детей 6 и 7 лет: Международное исследование астмы и аллергии в детстве, фаза III. J. Allergy Clin. Иммунол. 124, 982–989. doi: 10.1016 / j.jaci.2009.08.017

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гедрайтиене А., Виткаускене А., Нагиниене Р., Павилонис А. (2011). Механизмы устойчивости к антибиотикам клинически важных бактерий. Medicina (Каунас). 47, 137–146. doi: 10.3390 / medicina47030019

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гилберт Дж. А., Блазер М. Дж., Капорасо Дж. Г., Янссон Дж. К., Линч С. В., Найт Р. (2018). Современное понимание микробиома человека. Nat. Med. 24, 392–400. DOI: 10,1038 / нм.4517

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гольденберг Дж.З., Ма С. С., Сакстон Дж. Д., Мартцен М. Р., Вандвик П. О., Торлунд К. и др. (2013). Пробиотики для профилактики диареи, ассоциированной с Clostridium difficile , у взрослых и детей. Кокрановская база данных Syst. Ред. 5, CD006095. doi: 10.1002 / 14651858.CD006095.pub3

CrossRef Полный текст | Google Scholar

Гольденберг Дж. З., Литвин Л., Стойрих Дж., Паркин П., Махант С., Джонстон Б. С. (2015). Пробиотики для профилактики детской диареи, связанной с приемом антибиотиков. Кокрановская база данных Syst. Ред. 12, CD004827. doi: 10.1002 / 14651858.CD004827.pub4

CrossRef Полный текст | Google Scholar

Guarner F. (2012). Кишечная микробиота (Сан-Рафаэль, Калифорния: Morgan & Claypool Publishers).

Google Scholar

Яниро Г., Маллиш Б. Х., Келли К. Р., Кассам З., Куиджпер Э. Дж., Нг С. С. и др. (2020). Реорганизация служб трансплантации фекальной микробиоты во время пандемии COVID-19. Gut. 69, 1555–1563.doi: 10.1136 / gutjnl-2020-321829

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Имдад А., Николсон М. Р., Таннер-Смит Э. Э., Закуляр Дж. П., Гомес-Дуарте О. Г., Больё Д. Б. и др. (2018). Трансплантация кала для лечения воспалительного заболевания кишечника. Кокрановская база данных Syst. Ред. 11, CD012774. doi: 10.1002 / 14651858.CD012774.pub2

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Johnson S., Maziade P. J., McFarland L.В., Трик В., Донски К., Карри Б. и др. (2012). Возможна ли первичная профилактика инфекции Clostridium difficile с помощью определенных пробиотиков? Внутр. J. Infect. Дис. 16, e786 – e792. doi: 10.1016 / j.ijid.2012.06.005

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Карами Н., Новрузиан Ф., Адлерберт И., Волд А. Э. (2006). Устойчивость к тетрациклину у Escherichia coli и устойчивость в микробиоте толстой кишки у младенцев. Антимикробный.Агенты Chemother. 50, 156–161. doi: 10.1128 / AAC.50.1.156-161.2006

PubMed Реферат | CrossRef Полный текст | Google Scholar

Кляйн Э. Ю., Ван Бекель Т. П., Мартинес Э. М., Пант С., Гандра С., Левин С. А. и др. (2018). Глобальный рост и географическая конвергенция потребления антибиотиков в период с 2000 по 2015 гг. Proc. Natl. Акад. Sci. США. 115, E3463 – E3E70. DOI: 10.1073 / pnas.1717295115

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Корпела К., Салонен А., Вирта Л. Дж., Кекконен Р. А., Форслунд К., Борк П. и др. (2016). Кишечный микробиом связан с пожизненным употреблением антибиотиков финскими дошкольниками. Nat. Commun. 7, 10410. doi: 10.1038 / ncomms10410

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Кронман М. П., Заутис Т. Э., Хейнс К., Фенг Р., Коффин С. Э. (2012). Воздействие антибиотиков и развитие ВЗК у детей: популяционное когортное исследование. Педиатрия. 130, e794 – e803.doi: 10.1542 / peds.2011-3886

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Кюне С. А., Картман С. Т., Хип Дж. Т., Келли М. Л., Кокейн А., Минтон Н. П. и др. (2010). и токсин B при инфекции Clostridium difficile . Природа. 467, 711–713. DOI: 10.1038 / nature09397

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Кейперс Э. Дж. (2019). Энциклопедия гастроэнтерологии (Амстердам, Нидерланды: Elsevier Science).

Google Scholar

Ламичхейн С., Сен П., Диккенс А. М., Оресич М., Бертрам Х. С. (2018). Метаболом кишечника встречается с микробиомом: методологическая перспектива для понимания взаимоотношений между хозяином и микробом. Методы. 149, 3–12. doi: 10.1016 / j.ymeth.2018.04.029

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Le Chatelier E., Nielsen T., Qin J., Prifti E., Hildebrand F., Falony G., et al. (2013). Богатство микробиома кишечника человека коррелирует с метаболическими маркерами. Природа. 500, 541–546. doi: 10.1038 / nature12506

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Li J., Jia H., Cai X., Zhong H., Feng Q., Sunagawa S., et al. (2014). Интегрированный каталог эталонных генов микробиома кишечника человека. Nat. Biotechnol. 32, 834–841. doi: 10.1038 / nbt.2942

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ли Т. Х., Цинь Ю., Шам П. К., Лау К. С., Чу К. М., Леунг В. К. (2017).Изменения в микробиоте желудка после эрадикации H. pylori и на различных гистологических стадиях канцерогенеза желудка. Sci. Rep. 7, 44935. doi: 10.1038 / srep44935

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Losurdo G., Cubisino R., Barone M., Principi M., Leandro G., Ierardi E., et al. (2018). Монотерапия пробиотиками и эрадикация Helicobacter pylori : систематический обзор с анализом объединенных данных. Мир J.Гастроэнтерол. 24, 139–149. doi: 10.3748 / wjg.v24.i1.139

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Malfertheiner P., Megraud F., O’Morain C.A., Gisbert J.P., Kuipers E.J., Axon A.T. и др. (2017). Управление инфекцией Helicobacter pylori - Маастрихтский V / Флорентийский консенсусный доклад. Кишечник 66, 6–30. doi: 10.1136 / gutjnl-2016-312288

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Маллиш Б. Х., Кураиши М.Н., Сигал Дж. П., МакКьюн В. Л., Бакстер М., Марсден Г. Л. и др. (2018). Использование трансплантации фекальной микробиоты для лечения рецидивирующей или резистентной инфекции Clostridium difficile и других потенциальных показаний: совместные рекомендации Британского общества гастроэнтерологии (BSG) и Общества инфекционистов здравоохранения (HIS). Кишечник 67, 1920–1941 гг. doi: 10.1136 / gutjnl-2018-316818

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Neut C., Mahieux S., Dubreuil L.J. (2017).Чувствительность пробиотических штаммов к антибиотикам: разумно ли комбинировать пробиотики с антибиотиками? Med. Mal. Заразить. 47, 477–483. doi: 10.1016 / j.medmal.2017.07.001

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Паллея А., Миккельсен К. Х., Форслунд С. К., Кашани А., Аллин К. Х., Нильсен Т. и др. (2018). Восстановление кишечной микробиоты здоровых взрослых после воздействия антибиотиков. Nat. Microbiol. 3, 1255–1265. doi: 10.1038 / s41564-018-0257-9

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Panda S., Эль-хадер И., Каселлас Ф., Лопес Виванкос Дж., Гарсия Корс М., Сантьяго А. и др. (2014). Кратковременное действие антибиотиков на микробиоту кишечника человека. PloS One 9, e95476. doi: 10.1371 / journal.pone.0095476

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Пастер Л. (1885). Наблюдения за родственниками à la précédente de M. Duclaux. C. R. Acad. Sci. 100, 68–69.

Google Scholar

Перес-Перес Г., Блазер М. (1996). «Глава 23: Campylobacter и Helicobacter» в Медицинская микробиология .Эд. Барон С. (Галвестон, Техас: медицинский филиал Техасского университета в Галвестоне).

Google Scholar

Суравич К. М., Брандт Л. Дж., Бинион Д. Г., Анантакришнан А. Н., Карри С. Р., Гиллиган П. Х. и др. (2013). Рекомендации по диагностике, лечению и профилактике инфекций, вызванных Clostridium difficile . г. J. Gastroenterol. 108, 478–98; викторина 99. doi: 10.1038 / ajg.2013.4

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Szajewska H., Колоджей М. (2015а). Систематический обзор с метаанализом: Lactobacillus rhamnosus GG в профилактике антибиотико-ассоциированной диареи у детей и взрослых. Aliment Pharmacol. Ther. 42, 1149–1157. doi: 10.1111 / apt.13404

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Szajewska H., Kolodziej M. (2015b). Систематический обзор с метаанализом: Saccharomyces boulardii в профилактике диареи, связанной с антибиотиками. Aliment Pharmacol. Ther. 42, 793–801. doi: 10.1111 / apt.13344

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Szajewska H., Horvath A., Piwowarczyk A. (2010). Мета-анализ: влияние добавки Saccharomyces boulardii на скорость эрадикации Helicobacter pylori и побочные эффекты во время лечения. Aliment Pharmacol. Ther. 32, 1069–1079. doi: 10.1111 / j.1365-2036.2010.04457.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Szajewska H., Хорват А., Колодзей М. (2015). Систематический обзор с метаанализом: добавление Saccharomyces boulardii и искоренение инфекции Helicobacter pylori . Aliment Pharmacol. Ther. 41, 1237–1245. doi: 10.1111 / apt.13214

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Szajewska H., Canani R. B., Guarino A., Hojsak I., Indrio F., Kolacek S., et al. (2016). Пробиотики для профилактики диареи, связанной с приемом антибиотиков. J. Pediatr. Гастроэнтерол. Nutr. 62, 495–506. DOI: 10.1097 / MPG.0000000000001081

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Trasande L., Blustein J., Liu M., Corwin E., Cox L.M., Blaser M.J. (2013). Воздействие антибиотиков на младенцев и масса тела в раннем возрасте. Внутр. J. Obes. (Лондон). 37, 16–23. doi: 10.1038 / ijo.2012.132

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ван Бекель Т. П., Брауэр К., Гилберт М., Гренфелл Б. Т., Левин С. А., Робинсон Т. П. и др. (2015). Мировые тенденции использования противомикробных препаратов для пищевых животных. Proc. Natl. Акад. Sci. США. 112, 5649–5654. DOI: 10.1073 / pnas.1503141112

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Вирта Л., Аувинен А., Хелениус Х., Хуовинен П., Колхо К. Л. (2012). Связь повторного приема антибиотиков с развитием болезни Крона у детей - национальное финское исследование методом случай-контроль на основе регистров. г. J. Epidemiol. 175, 775–784. DOI: 10.1093 / aje / kwr400

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Vrieze A., Out C., Fuentes S., Jonker L., Reuling I., Kootte R. S., et al. (2014). Влияние перорального ванкомицина на микробиоту кишечника, метаболизм желчных кислот и чувствительность к инсулину. J. Hepatol. 60, 824–831. doi: 10.1016 / j.jhep.2013.11.034

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Wang Z. H., Gao Q. Y., Fang J.Ю. (2013). Мета-анализ эффективности и безопасности препарата пробиотического соединения, содержащего Lactobacillus и Bifidobacterium , в эрадикационной терапии Helicobacter pylori . J. Clin. Гастроэнтерол. 47, 25–32. doi: 10.1097 / MCG.0b013e318266f6cf

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Виллинг Б. П., Рассел С. Л., Финли Б. Б. (2011). Сдвиг баланса: влияние антибиотиков на мутуализм хозяина и микробиоты. Nat. Rev. Microbiol. 9, 233–243. doi: 10.1038 / nrmicro2536

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Wirbel J., Pyl P. T., Kartal E., Zych K., Kashani A., Milanese A., et al. (2019). Мета-анализ фекальных метагеномов выявляет глобальные микробные сигнатуры, специфичные для колоректального рака. Nat. Med. 25, 679–689. doi: 10.1038 / s41591-019-0406-6

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ву Г.Д., Чен Дж., Хоффманн К., Биттингер К., Чен Ю. Ю., Кейлбо С. А. и др. (2011). Связь долгосрочных диетических моделей с кишечными микробными энтеротипами. Наука 334, 105–108. DOI: 10.1126 / science.1208344

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Яп Т. В., Ган Х. М., Ли Ю. П., Леоу А. Х., Азми А. Н., Франсуа Ф. и др. (2016). Ликвидация Helicobacter pylori вызывает нарушение микробиома кишечника человека у молодых людей. PloS One 11, e0151893.doi: 10.1371 / journal.pone.0151893

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Яссур М., Ватанен Т., Сильяндер Х., Хамалайнен А. М., Харконен Т., Риханен С. Дж. И др. (2016). Естественная история микробиома кишечника младенца и влияние лечения антибиотиками на разнообразие и стабильность бактериальных штаммов. Sci. Пер. Med. 8, 343ра81. doi: 10.1126 / scitranslmed.aad0917

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Дисбактериоз кишечника связан с симптомами IBS-D

Литература: 1. Rezaie A, Heimanson Z, McCallum R, Pimentel M. Дыхательный тест на лактулозу как прогностический фактор ответа на рифаксимин у пациентов с синдромом раздраженного кишечника с диареей. Am J Gastroenterol. 2019; 114 (12): 1886-1893. 2. Кэрролл И.М., Рингель-Кулька Т., Сиддл Дж. П., Рингель Ю. Изменения в составе и разнообразии кишечной микробиоты у пациентов с синдромом раздраженного кишечника с преобладанием диареи. Нейрогастроэнтерол Мотил. 2012; 24 (6): 521-530. 3. Чжун В., Лу Х, Ши Х и др. Определенные микробные популяции существуют в микробиоте слизистой оболочки, связанной с преобладанием диареи, синдрома раздраженного кишечника и язвенного колита. Дж Клин Гастроэнтерол. 2019; 53 (9): 660-672. 4. Кассинен А., Крогиус-Курикка Л., Мякивуокко Х. и др. Микробиота кала пациентов с синдромом раздраженного кишечника значительно отличается от таковой здоровых людей. Гастроэнтерология. 2007; 133 (1): 24-33. 5. Casén C, Vebø HC, Sekelja M, et al.Отклонения в микробиоте кишечника человека: новый диагностический тест для определения дисбактериоза у пациентов с СРК или ВЗК. Aliment Pharmacol Ther. 2015; 42 (1): 71-83. 6. Пиментел М., Лембо А., Чей В.Д. и др. Терапия рифаксимином у пациентов с синдромом раздраженного кишечника без запоров. N Engl J Med. 2011; 364 (1): 22-32. 7. Рингель Ю. Микробиом кишечника при синдроме раздраженного кишечника и других функциональных расстройствах кишечника. Gastroenterol Clin North Am. 2017; 46 (1): 91-101. 8. Ringel-Kulka T., Choi CH, Temas D, et al. Измененная бактериальная ферментация толстой кишки как потенциальный патофизиологический фактор синдрома раздраженного кишечника. Am J Gastroenterol. 2015; 110 (9): 1339-1346. 9. Кинг Т.С., Элия М., Хантер Дж. Аномальное брожение толстой кишки при синдроме раздраженного кишечника. Ланцет. 1998; 352 (9135): 1187-1189. 10. Онг Д.К., Митчелл С.Б., Барретт Дж. С. и др. Манипуляции с пищей с короткоцепочечными углеводами изменяют характер газообразования и генезис симптомов синдрома раздраженного кишечника. J Gastroenterol Hepatol. 2010; 25 (8): 1366-1373. 11. Серра Дж., Аспироз Ф., Малагелада Дж. Р. Нарушение транзита и толерантности кишечных газов при синдроме раздраженного кишечника. Gut. 2001; 48 (1): 14-19. 12. Houghton LA, Lea R, Agrawal A, Reilly B., Whorwell PJ. Связь вздутия живота с вздутием живота при синдроме раздраженного кишечника и влияние привычки кишечника. Гастроэнтерология. 2006; 131 (4): 1003-1010. 13. Dunlop SP, Hebden J, Campbell E, et al.Аномальная кишечная проницаемость в подгруппах синдромов раздраженного кишечника с преобладанием диареи. Am J Gastroenterol. 2006; 101 (6): 1288-1294. 14. Аткинсон В., Локхарт С., Уорвелл П.Дж., Кивил Б., Хоутон Л.А. Нарушение передачи сигналов 5-гидрокситриптамина у пациентов с синдромом раздраженного кишечника с преобладанием запора и диареи. Гастроэнтерология. 2006; 130 (1): 34-43. 15. Gargari G, Taverniti V, Gardana C, et al. Распределение фекальных Clostridiales и короткоцепочечных жирных кислот отражает привычки кишечника при синдроме раздраженного кишечника. Environ Microbiol. 2018; 20 (9): 3201-3213. 16. Tack J, Broekaert D, Corsetti M, Fischler B, Janssens J. Влияние острого ингибирования обратного захвата серотонина на сенсомоторную функцию толстой кишки у человека. Aliment Pharmacol Ther. 2006; 23 (2): 265-274. 17. Chey WY, Jin HO, Lee MH, Sun SW, Lee KY. Нарушение моторики толстой кишки у пациентов с синдромом раздраженного кишечника с болью в животе и диареей. Am J Gastroenterol. 2001; 96 (5): 1499-1506. 18. Хаутон Л.А., Аткинсон В., Локхарт С., Уорвелл П.Дж., Кивил Б. Сигмовидно-толстая кишка в здоровье и синдром раздраженного кишечника: роль 5-гидрокситриптамина. Нейрогастроэнтерол Мотил. 2007; 19 (9): 724-731. 19. Торнблом Х., Ван Ауденхове Л., Садик Р., Абрахамссон Х., Тэк Дж., Симрен М. Время прохождения через толстую кишку и симптомы СРК: какая связь? Am J Gastroenterol. 2012; 107 (5): 754-760. 20. Cremon C, Gargano L, Morselli-Labate AM, et al.Иммунная активация слизистой оболочки при синдроме раздраженного кишечника: гендерная зависимость и связь с пищеварительными симптомами. Am J Gastroenterol. 2009; 104 (2): 392-400. 21. Либрегтс Т., Адам Б., Бредак С. и др. Иммунная активация у пациентов с синдромом раздраженного кишечника. Гастроэнтерология. 2007; 132 (3): 913-920. 22. Гиларте М., Сантос Дж., Де Торрес И. и др. У пациентов с СРК с преобладанием диареи наблюдается активация тучных клеток и гиперплазия тощей кишки. Gut. 2007; 56 (2): 203-209. 23. Zhou Q, Zhang B, Verne GN. Проницаемость кишечных мембран и гиперчувствительность при синдроме раздраженного кишечника. Боль. 2009; 146 (1-2): 41-46. 24. Piche T., Barbara G, Aubert P, et al. Нарушение целостности кишечного барьера в толстой кишке у пациентов с синдромом раздраженного кишечника: участие растворимых медиаторов. Gut. 2009; 58 (2): 196-201. 25. Shulman RJ, Jarrett ME, Cain KC, Broussard EK, Heitkemper MM.Связь между проницаемостью кишечника, маркерами воспаления и симптомами у пациентов с синдромом раздраженного кишечника. Дж Гастроэнтерол. 2014; 49 (11): 1467-1476. 26. Mearin F, Lacy BE, Chang L, et al. Расстройства кишечника. Гастроэнтерология. 2016; 150 (6): 1393-1407.

Использование пробиотиков для коррекции дисбактериоза нормальной микробиоты после болезни или разрушительных событий: систематический обзор

Введение

Популярность пробиотиков в последнее время выросла в геометрической прогрессии, но наряду с их возросшим использованием ведутся споры о том, как следует регулировать пробиотики и следует ли рассматривать пробиотики в качестве лечебного питания, лекарства или пищевой добавки.В США пробиотики обычно доступны в виде пищевых добавок и, таким образом, ограничиваются заявлением о «структуре или функции» для здоровья и, в отличие от лекарств, отпускаемых по рецепту, не имеют права заявлять, что «лечат» или «излечивают» болезнь. В Европе и Великобритании пробиотики имеют право заявить о своей полезности или полезности. Эти утверждения должны быть подтверждены хорошо проведенными испытаниями на людях в целевой популяции или на здоровых добровольцах, но Европейское управление по безопасности пищевых продуктов (EFSA) отклонило> 80% поданных им заявлений.1–3 Во многих случаях научное обоснование конкретного заявления о пользе для здоровья было сочтено недостаточным или основанным на косвенном эффекте4. Одно из таких функциональных заявлений, сделанных для пробиотических продуктов, заключается в том, что они устраняют дисбактериоз (или нарушение жизнедеятельности бактерий и грибов после применения антибиотиков или других препаратов). разрушительное воздействие) и, таким образом, может быть полезным для поддержания здоровья. Пробиотики активны в течение этого чувствительного окна с момента разрушительного события до момента восстановления нормальной микробиоты. Для пробиотиков задокументировано множество механизмов действия (от блокирования участков прикрепления патогенов, разрушения патогена бактериоцинами или протеазами, разлагающими токсины до регуляции иммунной системы) 5, 6, и хотя клинические данные подтверждают Эффективность некоторых пробиотических штаммов, доказательства, связывающие эти механизмы действия с определенными заявлениями о здоровье или функции, не так однозначны.

Классическим примером последствий дисбактериоза является диарея, связанная с антибиотиками (AAD) .7, 8 Хотя антибиотики могут быть эффективными в уничтожении патогенных организмов, обычным, непреднамеренным эффектом является уничтожение или подавление полезных микробов из-за общей восприимчивости к антибиотику. Одна из многих функций нормальной микробиоты - это способность противостоять заражению патогенными организмами, называемая «резистентностью к колонизации» 9, 10. Например, потеря субпопуляции нормальной микробиоты может привести к потере способности разрушаться. пуховые волокна и крахмалы в абсорбируемые короткоцепочечные жирные кислоты, что приводит к высокому уровню непереваренных углеводов, которые могут вызвать диарею.11 Было показано, что нарушение нормальной микробиоты приводит к более высокому уровню инфекций в других системах организма, помимо кишечного тракта, включая кожу, 12, 13 влагалище, 14, 15 дыхательные пути, 16, 17 и ротовую полость18. –20

Основной проблемой при установлении причин и следствий улучшения дисбактериоза пробиотиками является отсутствие стандартного определения «нормальной» микробиоты. Виды микробов, присутствующих в разных нишах тела, существенно различаются между индивидуумами, которые также зависят от возраста, географического района и состояния здоровья хозяина.Кроме того, полный учет микробиоты в настоящее время невозможен, поскольку нет анализов для обнаружения всех> 10 13 –10 14 организмов в кишечнике, а стандартные методы культивирования микробов пропускают 75–95% этих организмов. 21, 22 Развитие метагеномики (каталогизация профилей индивидуальных и специфичных для болезней бактериальных генов) и создание международного проекта «Микробиом человека» открыли новую эру в нашем понимании сложности этих взаимодействий в организме.23, 24 Этот сдвиг парадигмы от культивирования к метагеномному анализу расширил наши возможности документировать изменения микробных популяций до беспрецедентной степени, но интерпретация этих сдвигов продолжает оставаться предметом дискуссий.25-28 С появлением этих новых метагеномных инструментов, пересматривается роль пробиотиков в восстановлении нормальной микробиоты.29

В свете новых руководящих документов и рекомендаций цель этого систематического обзора состоит в том, чтобы определить, как требования о восстановлении нормальной микробиоты и коррекции дисбактериоза изучались с помощью хорошо спланированных испытаний и какие штаммы пробиотиков имеют доказательные данные. чтобы поддержать эти утверждения.

Методы

Цель исследования

Систематический обзор литературы для анализа доказательств того, что пробиотики могут исправить дисбактериоз нормальной микробиоты по результатам рандомизированных контролируемых испытаний.

Стратегия поиска

Поисковые запросы включали: пробиотики + заявления о здоровье, восстановление нормальной микробиоты, дисбиоз, нормальная микробиота, фармакокинетика, метагеномика, пробиотики, пищевые добавки, рандомизированные контролируемые испытания, AAD, Clostridium difficile инфекция (CDI), воспалительное заболевание кишечника (IBD), синдром раздраженного кишечника (IBS), диарея путешественника (TD), искоренение Heliobacter pylori, бактериального вагиноза (BV) или вагинита, лечение острой детской диареи и специфические штаммы или продукты пробиотиков.Первоначально стратегии поиска были широкими, а затем сузились до клинических испытаний пробиотиков.

Источники данных

PubMed (1985–2013), EMBASE (1985–2013), Кокрановская база данных систематических обзоров (1990–2013), CINAHL (1985–2013), AMED (1985–2013) и ISI Web of Science (2000–2013). Был проведен поиск по трем онлайновым регистрам клинических испытаний: Кокрановскому центральному регистру контролируемых испытаний (http://www.cochrane.org), метарегистру контролируемых испытаний (http://www.controlled-trials.com/mrct) и Национальным институтам здравоохранения. (http: // www.Clinicaltrials.gov).

Критерии отбора исследований и извлечения данных

Отрывки из всех цитат были рассмотрены одним автором и оценены для включения в рандомизированные контролируемые испытания пробиотических препаратов. Полные статьи были извлечены, если были упомянуты нормальные анализы микробиоты. Испытания на языках, отличных от английского, переводились и включались, когда это было возможно. Критерии исключения включали доклинические исследования (модели на животных или анализы in vitro), исследования безопасности или фазы 2, обзоры, испытания эффективности без анализов для нормальных видов микробиоты, только метагеномные методы, механизм действия нормальной микробиоты или пробиотика, перекрестные исследования, отчеты о случаях или серии случаев, повторяющиеся отчеты или исследования неуказанных типов пробиотиков.Были рассмотрены все фармакокинетические исследования на людях, поскольку в их рефератах часто не указывались данные нормального анализа микробиоты. Процесс извлечения данных и обзора соответствовал руководящим принципам заявления о предпочтительных элементах отчетности для систематических обзоров и метаанализов (PRISMA) с использованием контрольного списка из 27 пунктов и блок-схемы.30 Для сбора данных о пробиотике (тип штамма) использовалась стандартизированная форма извлечения данных. , суточная доза, продолжительность), тип контроля (плацебо, активное лечение или отсутствие лечения), дизайн исследования (состояние микробиоты на исходном уровне и время последующего наблюдения), тип анализа микробиоты (микробное культивирование, молекулярные биомаркеры и т. д.), включенное исследование популяция (взрослые и дети, здоровые добровольцы, болезненное состояние), тип и время действия деструктивного агента (антибиотики, химиотерапия и т. д.), размер и отсев исследования, оценка результатов (эффективность и / или статус микробиоты в конце исследования, нежелательные явления) и тип заявления о состоянии здоровья.

Результаты и определения

Первичный результат - это степень коррекции или улучшения микробиоты с помощью определенного (ых) пробиотического штамма (ов). Вторичный результат - это связь между степенью коррекции дисбиоза и чистой эффективностью, обнаруженной в рандомизированных контролируемых испытаниях пробиотических вмешательств. Дисбиоз определяется как изменение или нарушение нормальной микробиоты (бактериальные или грибковые виды) из-за воздействия разрушающего фактора (например, антибиотиков, хронических заболеваний, стресса, медицинских процедур или лекарств и т. Д.).Поскольку в настоящее время не существует стандартного определения «нормальной» микробиоты, для этого обзора восстановление нормальной микробиоты определяется как возвращение к анализируемым видам или профилю микробов, полученным у здорового человека (до того, как произойдет разрушительное событие). Включенные исследования должны иметь, по крайней мере, анализ лечения препробиотиками и анализ лечения постпробиотиками. В течение периода поиска (1985–2013) было доступно множество микробных анализов, включая документирование микробиоты либо с помощью микробных культур, либо с помощью метагеномных методов (нацеленные на 16s рРНК зонды с использованием флуоресцентной гибридизации in situ (FISH) или другого метода ПЦР) 8, 21, 28, 31 или косвенными методами (по шкале Ньюджента).15 баллов по шкале Ньюджента (от 0 до 10) используются для диагностики бактериального вагиноза (баллы ≥7) или нормальной микробиоты влагалища (баллы 0–3) на основе количественных морфотипов малых грамотрицательных палочек ( Gardnerella vaginalis / bacteroides spp) и изогнутые грамотрицательные палочки ( Mobiluncus spp), полученные при окраске по Граму мазков из влагалищных выделений. Микробные анализы только штаммов, содержащихся в пробиотическом продукте, считаются фармакокинетическими исследованиями и не включаются в профили нормальной микробиоты.

Модели дисбактериоза

Для определения воздействия на нормальную микробиоту были включены только прямые доказательства изменения микробиоты (виды, профили, индексы разнообразия или диагностические критерии), а косвенные эффекты были исключены (изменения кишечных ферментов, параметров иммунной системы или симптомов заболевания). Степень улучшения дисбактериоза подразделяется на три уровня: (1) восстановление нормальной микробиоты до исходного уровня; (2) изменение или улучшение нормальной микробиоты; и (3) отсутствие изменений нормальной микробиоты.

Литература содержала три модели дисбиоза: модель A (восстановление нормальной микробиоты), в которой анализировали пациентов, зарегистрированных со здоровой, ненарушенной микробиотой, а затем снова анализировали после разрушительного события (такого как воздействие антибиотиков) и терапии пробиотиками; модель B (изменение микробиоты) исследовала пациентов с уже существующей нарушенной микробиотой (например, уже существующее хроническое заболевание или активное заболевание), а затем после пробиотической терапии; Модель C (без дисбактериоза) тестировали добровольцев без каких-либо деструктивных событий (до или во время клинического испытания) как в препробиотический, так и в постпробиотический периоды, как показано на рисунке 1.«Восстановление» нормальной микробиоты определяется как восстановление микробиоты до нормального здорового исходного уровня. Восстановление может быть полным (все проанализированные уровни микробов вернулись к исходному уровню) или неполным восстановлением (частичное восстановление некоторых штаммов микробов, но не все вернулись к исходным уровням). В исследованиях, в которых участвовали участники с дисбактериозом на исходном уровне (обычно из-за хронических заболеваний), невозможно показать восстановление нормального уровня микробиоты, потому что нормальная, ненарушенная микробиота не присутствовала у этих типов участников исследования на момент включения в исследование.Таким образом, наиболее веские аргументы в пользу конструкции модели B - это «изменение или улучшение» микробиоты. В этой статье были проанализированы только данные участников, подвергшихся воздействию пробиотиков. Данные из контрольных групп использовались для подтверждения дисбактериоза у участников с хроническими заболеваниями или после разрушительного воздействия, такого как антибиотики или химиотерапия, не затронутых воздействием пробиотиков.32–34

Рис. 1

Временная последовательность событий и три модели дизайна исследования, определяющие три различные степени коррекции дисбиоза пробиотиками.

Оценка методологической прочности и качества

Система GRADE (классификация рекомендаций, оценка, разработка и оценка) для оценки общего качества исследования будет использоваться для каждого пробиотического штамма или типа (отдельные штаммы и смеси штаммов) .35 Рекомендация для поддержки заявления о каждом пробиотическом штамме. или смесь могут быть оценены по общей силе доказательств («сильные», многие рандомизированные контролируемые испытания показывают значительное восстановление микробиоты, или «умеренные» - только одно рандомизированное контролируемое испытание; или «слабые», только серии случаев или отчеты, ограниченное количество малых испытаний и т. д.).

Качество доказательств основано на дизайне исследования и оценивается как «высокое качество» (четко определенный дизайн исследования для определения восстановления при нормальной микробиоте, модель A) или «среднее качество» (нарушение микробиоты на исходном уровне, модель B) или «низкое качество» (нарушение работы не произошло, модель C). Измерение систематической ошибки публикации в этом обзоре не оценивалось, поскольку объединенные оценки эффективности результатов не проводились, что типично для метаанализа, но все исследования с анализами микробиоты были включены для ограничения систематической ошибки.

Рейтинг чистой эффективности

Чтобы определить, связана ли способность корректировать дисбактериоз с клинической эффективностью, используйте опубликованную литературу для рандомизированных контролируемых исследований (РКИ) или мета-анализы пробиотиков для различных показаний заболевания, включая AAD, 5, 36, 37 CDI, 5, 38 IBD , 39 IBS, 40 TD, 41 эрадикация H. pylori , 36, 37 BV42 и лечение острой детской диареи были рассмотрены.43–45 Чистый рейтинг был рассчитан путем вычитания количества РКИ, показавших незначительную или эквивалентную эффективность из числа РКИ, показавших значительную эффективность.Ранги были разделены на следующие категории: ++, ≥2 чистых РКИ, показывающих значительную эффективность; +, чистых РКИ, показывающих значительную эффективность; 0, равное количество РКИ, показывающих значимые и незначимые результаты эффективности, и -, ≥1 чистое отрицательное или незначимое РКИ. Пробиотики, не прошедшие РКИ, не оценивались.

Результаты

Обзор литературы за 1985–2013 гг. Обнаружил 353 статьи, посвященные лечению пробиотиками и их потенциальному влиянию на нормальную микробиоту.

Исключенные исследования

Как показано на рисунке 2, в общей сложности 272 статьи были исключены по следующим причинам: обзоры (n = 116), исследования эффективности пробиотиков без данных о нормальных анализах микробиоты (n = 54), модели пробиотиков на животных и изменения микробиоты. (n = 38), только метагеномные методы или методы микробиоты (n = 17), исследования нормальной микробиоты, но без использования пробиотиков (n = 14), анализы микробиоты in vitro (n = 10), дублирующие отчеты (n = 2 ) или разные (n = 21), которые включали исследования механизма действия пробиотиков, исследования безопасности, дублирующие отчеты, перекрестные исследования и два с плохо описанными пробиотическими вмешательствами.46, 47 В общей сложности была рассмотрена 81 полная статья, в которой упоминались изменения в нормальной микробиоте или указывались на полезность пробиотиков и их влияние на нормальную микробиоту.

Рис. 2

Блок-схема результатов обзора литературы (1985–2013) включенных и исключенных исследований по восстановлению или улучшению нормальной микробиоты с помощью пробиотиков. РКИ - рандомизированные контролируемые испытания; МОА, механизм действия; НМ, нормальная микробиота.

Фармакокинетические исследования пробиотиков (n = 18), в которых сообщалось о концентрациях пробиотических штаммов до и после лечения, но не анализировались на другие виды нормальной микробиоты, были исключены.Хотя в нескольких исследованиях, использующих этот дизайн исследования, утверждается, что пробиотики оказали влияние на нормальную микробиоту, тип полученных данных - это фармакокинетическое поведение самих пробиотиков, а не нормальная микробиота. Несколько исследований заявили, что нормальная микробиота была изменена, потому что после введения пробиотиков наблюдалось увеличение количества различных видов бактерий, но проанализированные виды были теми, которые содержались в пробиотическом продукте, поэтому это увеличение не является неожиданным. Фармакокинетические исследования документально подтвердили, что пробиотические штаммы, принимаемые перорально, могут выжить при прохождении через кишечный тракт с уровнем выделения с фекалиями от <1% до 22%.48, 49 Эти фармакокинетические исследования были исключены из этого анализа, поскольку они не тестировали другие типы нормальной микробиоты, не обнаруженные в пробиотическом продукте.

Включенные исследования

Из 63 включенных клинических испытаний пять испытаний включали несколько групп лечения, в результате чего в общей сложности было проанализировано 69 групп лечения. Engelbrektson и др. 50 тестировали смесь из пяти штаммов пробиотиков на добровольцах, подвергавшихся воздействию антибиотиков, а также тестировали смесь из четырех штаммов пробиотиков на здоровых добровольцах, не подвергавшихся воздействию антибиотиков.Zoppi и др. 51 использовали восемь различных групп лечения в своем исследовании, и в наш анализ были включены группы пробиотиков ( только Saccharomyces boulardii и только Lactobacillus rhamnosus GG ), смесь двух пробиотиков ( L. acidophilus и Bifido bifidum ) и смесь трех пробиотических штаммов ( L. acidophilus, L. rhamnosus и B. bifidum ). Orrhage et al. 52 использовали две группы лечения (только Bifido longum и смесь B.longum и L. acidophilus ). Ларсен и др. 53 тестировали два отдельных пробиотика ( B. lactis и L. acidophilus ) в разных группах лечения. Lidbeck et al. 54 давали либо эноксацин, либо клиндамицин и рандомизировали пациентов либо L. acidophilus , либо плацебо.

Нормальные методы анализа микробиоты

Из 69 лечебных групп, в которых проводились нормальные анализы микробиоты, для профилирования микробиоты использовались различные методы.Во многих исследованиях использовались только стандартные микробиологические анализы культур (37, 54%), в то время как в других (28, 40%) использовались методы обнаружения некультивируемых бактериальных штаммов, которые включали метагеномные анализы (FISH, TRFLP, секвенирование 16 s рРНК) или другие ПЦР. техники. В некоторых исследованиях (4,6%) использовалась косвенная мера нормальной микробиоты с использованием шкалы Nugent для диагностики бактериального вагиноза, которая основывается на окрашивании по Граму вагинальных выделений, pH влагалища и симптомах для определения наличия или отсутствия нормальной микробиоты.15

Штаммы пробиотиков

В 69 группах лечения большинство (36, 52%) использовали один штамм пробиотика, в то время как 14 (20%) тестировали смесь двух пробиотических штаммов и 19 (28%) тестировали смесь трех или более пробиотических штаммов. Распределение пробиотиков с одним штаммом по сравнению с множественными пробиотиками незначительно варьировалось в зависимости от модели дизайна исследования (= 2,3, p = 0,32). Из 15 групп реставрационного исследования (модель A) 47% использовали один штамм пробиотика и 53% использовали несколько штаммов. Из 25 групп лечения с нарушенной микробиотой на исходном уровне (модель B) 44% использовали один штамм и 56% использовали несколько штаммов.Из 29 групп исследования с неповрежденной микробиотой (модель C) 62% использовали один штамм и 38% использовали несколько штаммов.

Модель восстановления нормальной микробиоты (модель A)

Было найдено только 10 исследований (с 15 группами лечения) с использованием модели А для определения восстановления микробиоты (таблица 1) 32, 34, 50–52, 54–58 Тип включенных участников варьировался от здоровых добровольцев до детей с нелеченными респираторные инфекции, педиатрическим онкологическим больным. Для участников с острыми инфекциями или раком базовые анализы проводились перед разрушающим агентом (антибиотиками или химиотерапией).Число участников, получавших пробиотики, составляло в среднем 20 на исследование и варьировалось от 5 до 83. В 93% разрушающим фактором было воздействие антибиотиков, а в одном исследовании химиотерапия вызвала нарушение микробиоты. Только 8 (53%) групп исследования выполнили анализ в течение периода наблюдения 1–8 недель после прекращения приема пробиотика.

Таблица 1

Доказательные данные о восстановлении нормальной микробиоты (НМ) для 12 пробиотиков из 10 исследований (15 лечебных групп; модель A)

Анализ пробиотических штаммов по отдельности выявил только два пробиотических продукта в более чем одном рандомизированном контролируемом исследовании.Пробиотическая смесь L. acidophilus и B. bifidum показала полное восстановление в одном исследовании, но только частичное восстановление в другом (сила: сильная, качество: высокое). Пробиотическая смесь L. acidophilus (2 штамма) с B. bifidum и B. animalis показала полное восстановление в одном исследовании, но только частичное восстановление в другом (сила: сильная, качество: высокое). Пять других пробиотических продуктов только в одном подтверждающем клиническом исследовании показали восстановление микробиоты ( B.longum , Clost. butyricum , L. acidophilus , смесь L. acidophilus с L. paracasei и B. lactis и смесь L. acidophilus с L. paracasei и B. bifidum и два штамма B. lactis ; Прочность: умеренная, Качество: высокое). Три пробиотических продукта с одним подтверждающим клиническим испытанием показали частичное восстановление ( S. boulardii , L. rhamnosus GG, смесь L.rhamnosus с L. bifidus и L. acidophilus ; Прочность: умеренная, Качество: высокое). Только два пробиотических продукта с использованием модели A не показали изменений в микробиоте ( B. breve и смесь L. acidophilus и B. longum ; сила: умеренная, качество: высокое). Таким образом, 10 из 12 (83%) пробиотических продуктов показали полное или частичное восстановление нормальной микробиоты.

Из 11 пробиотических продуктов с заявлением о «восстановлении или улучшении нормальной микробиоты» 10 (91%) были поддержаны этим обзором, но только семь показали полное восстановление, а пять - частичное восстановление микробиоты (таблица 1).Смесь L. acidophilus и B. longum не показала никаких изменений в микробиоте. Wada и др. 32 заявили, что B. breve «усилены кишечными анаэробами», но это сравнивали только с группой плацебо. Их данные показали, что химиотерапия является разрушительным событием, приводящим к увеличению количества энтеробактерий в кишечнике в группе плацебо, но к концу 8-недельного периода наблюдения в группе пробиотиков или плацебо не наблюдалось значительных различий по сравнению с исходной микробиотой. уровни.

Нарушение нормальной микробиоты при исходных исследованиях (модель B)

Двадцать четыре исследования (с 25 группами лечения) использовали модель B, в которую были включены участники с ранее существовавшей нарушенной микробиотой, связанной с текущим заболеванием или состояниями (таблица 2) .33, 53, 59–80 Среднее количество участников, получавших пробиотики, составляло 23 ± 16 / исследование и варьировались от 7 до 83 участников. Типы ранее существовавших факторов, нарушающих микробиоту, включали пациентов с атопическим дерматитом, аллергии, цирроз, бактериальный вагиноз, синдром раздраженного кишечника, воспалительные заболевания кишечника (язвенный колит и поучит), идиопатическую диарею, энтеральное питание, синдром короткой кишки и рак толстой кишки. .Только 10 (40%) исследуемых групп проводили анализ в течение периода последующего постпробиотического наблюдения.

Таблица 2

Доказательные данные по улучшению или изменению нормальной микробиоты (NM) в 18 пробиотиках из 24 исследований (25 групп лечения) с нарушенной микробиотой на исходном уровне (модель B)

Три пробиотика прошли несколько клинических испытаний, чтобы подтвердить утверждение об улучшении микробиоты за счет пробиотика. S. boulardii использовался в двух испытаниях либо с пациентами с энтеральным питанием, либо с пациентами с активной диареей, и было обнаружено улучшение привычной микробиоты у пациентов с активной диареей, 66 но только косвенные доказательства изменений короткоцепочечных жирных кислот в другое исследование65 (Сила: сильная, Качество: умеренное).Смесь из четырех пробиотических штаммов (2 штамма L. rhamnosus , P. freudenreichii + B. breve ) показала улучшение микробиоты в двух клинических испытаниях74, 75 (сила: сильная, качество: умеренное). Из четырех клинических испытаний смеси семи пробиотических штаммов, два не показали значительных изменений в микробиоте, 77, 78 одно показало большее количество анаэробов при постпробиотической обработке79, а одно обнаружило уменьшение количества видов бактероидов80 (сила: сильная, качество: умеренная). Три клинических испытания определили, что не было значительных изменений в связи с Lactobacillus plantarum 299v62–64 (сила: сильная, качество: умеренное).Из этих пробиотиков только одно подтверждающее клиническое испытание (сила: умеренная, качество: умеренное), два отдельных штамма пробиотиков ( E. coli, Nissle и L. casei rhamnosus ) и пять различных смесей пробиотических штаммов подтверждают утверждение о том, что пробиотик изменяет микробиоту (таблица 2). Таким образом, 10 из 18 (56%) пробиотических продуктов изменили или улучшили микробиоту у людей с ранее существовавшим заболеванием.

Из 25 лечебных групп утверждение статьи было подтверждено в 14 (56%) исследованиях.Не было значительных изменений микробиоты из-за пробиотика в девяти группах лечения и только изменение микробиоты в пяти других (таблица 2). Наш обзор не согласился с заявленными результатами в 11 (46%) других группах лечения. В семи группах лечения было заявлено, что тестируемый пробиотик «восстановил нормальную микробиоту», но неясно, как был сделан этот вывод, поскольку не было времени, когда нормальная неповрежденная микробиота присутствовала. Из семи исследований, в которых утверждалось, что пробиотики «восстановили» нормальную микробиоту, наш анализ показал, что ни одно из них не способно документально подтвердить восстановление, но подтверждено, что пробиотики улучшили или изменили микробиоту в этих исследованиях.В четырех исследованиях утверждалось, что пробиотик «изменил или улучшил» нормальную микробиоту, но в этом обзоре не было обнаружено значительных различий при сравнении постпробиотических и исходных анализов для групп пробиотиков. Girard-Pipau и др. 65 пришли к выводу, что S. boulardii «изменил нормальную флору», поскольку в группе пробиотиков было обнаружено больше грамположительных анаэробов по сравнению с контрольной группой, а в группе наблюдалось увеличение содержания трех короткоцепочечных жирных кислот. Группа S. boulardii .Однако, когда анализ ограничивается тенденциями, наблюдаемыми только в группе пробиотиков, не наблюдалось значительных различий в профилях микробиоты препробиотиков и постпробиотиков. Вентури и др. 77 пришли к выводу, что смесь из семи пробиотических штаммов увеличивает концентрацию некоторых полезных штаммов в кишечнике. Однако единственными штаммами, у которых наблюдалось значительное увеличение, были штаммы, содержащиеся в смеси пробиотиков, а не конкретно нормальная микробиота хозяина. Поскольку это исследование не имело исходного уровня микробиоты, увеличенное количество лактобацилл и бифидобактерий могло не отражать их нормальные уровни.Van der Aa и др. 59 утверждали, что B. breve «успешно модулирует кишечную флору», но не наблюдалось значительных изменений в группе пробиотиков при сравнении исходного уровня с уровнями постпробиотика. Odamaki и др. 33 действительно показали увеличение Faecalibacterium spp и Bacteroides fragilis spp в конце лечения B. longum BB536, но такое же увеличение наблюдалось и в группе плацебо.

Непрерывные исследования нормальной микробиоты (модель C)

В 29 испытаний были включены здоровые взрослые люди, у которых не было разрушающего фактора во время исследования (либо отсутствие антибиотика, либо отсутствие воздействия лекарств, либо наличие острого или хронического заболевания), которые могли бы повлиять на нормальную микробиоту, как показано в таблице 3.14, 49, 50, 81–106. Среднее количество участников, получавших пробиотики, составляло 23 человека в исследовании и варьировалось от 7 до 160 в исследовании. Из 29 групп исследования анализы проводились в течение периода наблюдения только в 52%. Fujiwara и др. 84 культивировали семь здоровых добровольцев и обнаружили энтеробактерии и клостридиальных видов после B. longum было снижено на 10 1 / г по сравнению с исходным уровнем (p <0,03), но никаких других изменений в микробиоте не произошло. были обнаружены. Karlsson и др. 94 обнаружили значительное увеличение кишечного разнообразия у девяти добровольцев мужского пола с атеросклерозом, получавших L.plantarum 299v, но поскольку тесты полиморфизма длин концевых рестрикционных фрагментов использовались вместо культур для видов бактерий, специфические изменения в видах микробиоты не могли быть определены. Ян и Шеу культивировали 63 ребенка (55% с Helicobacter pylori ), которым давали йогурт с L. acidophilus и B. lactis , но обнаружили снижение только E. coli в H.pylori отрицательных. в подгруппе детей, существенных изменений нормальной микробиоты у H.pylori - положительные дети. 100 Кубота и др. 103 проанализировали 29 участников с аллергией на пыльцу японского кедра и обнаружили, что молоко, ферментированное L. rhamnosus GG и L. gasseri TMC0356, подавляло изменения микробиоты (меньше изменений профиля кишечника), но не удалось определить изменения конкретных видов бактерий из-за типа используемого анализа (FISH и TRFLP) .103 Таким образом, только 4 из 19 (21%) пробиотических продуктов изменили микробиоту у здоровых людей, у которых не было разрушительного события.

Таблица 3

Модель C: Доказательные данные по улучшению или изменению нормальной микробиоты (NM) в 19 пробиотиках у здоровых добровольцев, включенных в 29 исследований (29 лечебных групп) в исследованиях без разрушительного воздействия

Из семи исследований, в которых утверждалось, что их пробиотики «восстанавливают или изменяют» нормальную микробиоту, только четыре утверждения были подтверждены. Сьерра и др. 96 заявили, что Lactobacillus salivarius дали 20 здоровым взрослым «улучшенная микробиота кишечника», но были обнаружены только повышенные уровни лактобацилл и никаких других изменений у нормальных видов микробиоты обнаружено не было.Единственное другое свидетельство было косвенным из наблюдаемых изменений иммунных параметров. He et al. 99 заявили о смеси B. longum и B. animalis «модифицированной» микробиоты, но изменения наблюдались только во время приема йогурта, а не после периода наблюдения в течение 1 недели. Витали и др. 14 утверждали, что смесь из четырех штаммов лактобактерий и трех штаммов бифидобактерий «модулировала вагинальную микробиоту», но единственные значительные изменения были связаны с увеличением видов бактерий, содержащихся в смеси пробиотиков.

из пробиотиков, подтвержденных многочисленными клиническими испытаниями ( B. animalis , B. longum , L. casei , L. plantarum 299v, смесь B. animalis и B. lactis ), 13 испытаний (87%) подтверждают отсутствие значительных изменений нормальной микробиоты, если микробиота не нарушена (сила: сильная, качество: низкое).

Ассоциация клинической эффективности и восстановления нормальной микробиоты

В нескольких исследованиях одновременно сравнивалась клиническая эффективность и способность восстанавливать или улучшать нормальную микробиоту после дисбактериоза.Был проведен синтез литературы по РКИ по восьми распространенным показаниям болезни, и была оценена общая сила сети. Эффективность пробиотиков, способных восстанавливать нормальную микробиоту, часто подтверждается РКИ, как показано в таблице 4. Из 10 пробиотиков с доказательствами восстановления 7 (70%) также прошли по крайней мере одно РКИ по крайней мере для одного из восьми. болезней, в то время как 30% не имели поддерживающих РКИ по эффективности. Из семи пробиотиков, включенных в ассоциированные РКИ, только два пробиотика ( S.boulardii и L. acidophilus ) имеют убедительные доказательства эффективности при большинстве показаний к болезни, в то время как пять пробиотиков, способных восстанавливать микробиоту, имели слабые доказательства эффективности или отсутствовали. Например, S. boulardii , у которого есть исследования, поддерживающие восстановление, имеет убедительные доказательства клинической эффективности для AAD (рейтинг ++: 11 РКИ имели значимые результаты, а 6 имели незначительные результаты), CDI (рейтинг ++: было проведено два РКИ со значительными результатами. ), IBD (с рейтингом ++: было два РКИ со значительными результатами), IBS (с рейтингом 0: было одно РКИ со значительной эффективностью и одно РКИ с незначительными результатами), TD (с рейтингом +: 3 РКИ со значительной эффективностью и 2 с незначительными эффективность), H.pylori (ранжирование -: 2 РКИ со значительными результатами и 4 с незначительными результатами) и отсутствие исследований по BV. L. acidophilus , который частично восстановил микробиоту в исследовании, связан с клинической эффективностью в отношении AAD, IBS и BV, но не в отношении TD или ликвидации H. pylori и лечения острой детской диареи (рейтинг ++: имел 19 РКИ со значительной защитой и пять с незначительными результатами). Напротив, L. rhamnosus GG, еще один пробиотик, способный восстанавливать микробиоту, часто упоминается в метаанализе как обладающий значительной эффективностью при ААД.Наши результаты обновленного обзора литературы указывают на чистую слабую оценку клинической эффективности по всем показаниям болезни: AAD (оценено -: 3 РКИ имели значимые результаты, а 6 - незначительные результаты), CDI (оценено -: два РКИ с несущественные результаты), IBD (ранг -: одно РКИ с незначительными результатами), IBS (оценка 0: 2 РКИ со значительной эффективностью и два РКИ с незначительными результатами), TD (ранг 0: одно РКИ со значительной эффективностью и один с незначительной эффективностью), H.pylori (рейтинг -: 3 РКИ с незначительными результатами), отсутствие РКИ по БВ и лечению острой детской диареи (рейтинг ++: 10 РКИ со значительной эффективностью и одно с незначительными результатами).

Таблица 4

Сравнение способности пробиотика восстанавливать или улучшать дисбактериоз с ранжированной клинической эффективностью при различных показаниях заболевания

Испытания эффективности не проводились так часто для пробиотиков, которые, как было показано, способны только изменять или улучшать, но не восстанавливать микробиоту после дисбактериоза.Из девяти пробиотиков, которые могут изменять микробиоту, 6 (67%) имели поддерживающие РКИ по крайней мере для одного заболевания, но разнообразие исследованных заболеваний было более ограниченным. L. casei имел умеренную чистую силу для AAD и бактериального вагиноза, но был нейтральным в отношении способности уничтожить H. pylori , а другие показания к болезни не тестировались в РКИ с L. casei . Смесь пробиотиков L. reuteri и L. fermentum имеет убедительные доказательства бактериального вагиноза, но не показаний для каких-либо других заболеваний, перечисленных в таблице 4.

Из восьми пробиотиков, не способных изменять или восстанавливать нормальную микробиоту, только L. plantarum 299v имели РКИ на ААД и СРК, оба с чистой отрицательной или слабой клинической эффективностью. B. lactis и смесь L. rhamnosus и L. reuteri имели чистую нейтральную оценку эффективности для лечения острой детской диареи. Для других четырех пробиотических продуктов, не влияющих на нормальную микробиоту, не было РКИ клинической эффективности.В исследованиях с Bacillus clausii не проводился анализ на нормальную микробиоту, и были получены незначительные результаты испытаний по искоренению H. pylori и лечению диареи у детей.

Из шести пробиотиков с данными только о фармакокинетике самого пробиотика и без других исследований других нормальных штаммов микробиоты, пять имели РКИ, показывающие различную чистую эффективность при различных показаниях, как показано в таблице 4.

Шесть популярных пробиотиков ( B.clausii , B. infantis , L. reuteri , L. acidophilus + L. helveticus , L. acidophilus + L. casei и L. acidophilus + B. animalis ) имеют только РКИ клинической эффективности, но не опубликовали исследования, посвященные их роли в восстановлении или улучшении нормальной микробиоты.

Обсуждение

Разработка и оценка заявлений о полезности или функциональности пробиотиков является важной проблемой и в настоящее время определена как приоритетная для исследований несколькими международными организациями, включая Всемирную гастроэнтерологическую организацию107 и Американское общество питания.2 Управление по санитарному надзору за качеством пищевых продуктов и медикаментов США борется с обоснованными утверждениями о пользе для здоровья пробиотических продуктов и в настоящее время рекомендует использовать утверждения о структуре / функции, такие как «поддерживает регулярность кишечника», но утверждение о восстановлении нормальной микробиоты все еще обсуждается. 108 Европейское управление по безопасности пищевых продуктов (EFSA) предоставляет руководящие материалы, которые рекомендуют, чтобы заявления о здоровье или функциональности пробиотиков имели положительный физиологический эффект и имели соответствующие научные испытания для подтверждения заявлений о пользе для здоровья.3 Приемлемые утверждения о здоровье кишечника могут включать функциональные утверждения (улучшенное время прохождения, более мягкая консистенция стула, уменьшение желудочно-кишечного дискомфорта, защита от патогенов). Поскольку в настоящее время невозможно определить стандартный профиль нормальной микробиоты, EFSA рекомендует, чтобы функциональные заявления о восстановлении нормальной микробиоты документировали восстановление здоровой микробиоты и сопровождались благоприятным физиологическим или клиническим результатом. и механизмы зависят от штамма и могут варьироваться в зависимости от штамма пробиотика, доказательства должны быть проанализированы для каждого пробиотического продукта индивидуально.5, 6, 9, 109 - 112

Недооцененным открытием было влияние дизайна исследования и исследуемых групп на интерпретацию результатов исследования. В литературе обычно встречаются пять различных типов дизайна исследований, связанных с пробиотиками. Наиболее распространенным типом исследований является рандомизированное контролируемое испытание, в котором проверяются результаты эффективности и безопасности у пациентов, но эти испытания обычно не документируют влияние пробиотика на нормальную микробиоту. Вторым наиболее распространенным типом дизайна исследования являются фармакокинетические исследования (документирование восстановления пероральной дозы пробиотика или увеличения пробиотических штаммов после лечения по сравнению с предварительной обработкой или клиренсом пробиотика).Несмотря на то, что в этих кинетических исследованиях не проводился анализ на штаммы, не являющиеся пробиотиками, некоторые экстраполировали их результаты и пришли к выводу, что их пробиотики наблюдали некоторый эффект или улучшение нормальной микробиоты.19, 111 Эти два первых типа исследований не поддерживают доказательную базу. выводы о восстановлении или изменении нормальной микробиоты и были исключены из этого обзора.

Для изучения дисбактериоза подходят три типа исследований. В первом типе исследования нормальная микробиота анализировалась как минимум дважды (на исходном уровне, то есть до воздействия разрушительного события или пробиотиков, а затем еще раз во время или после лечения пробиотиками), чтобы показать фактическое восстановление исследуемой нормальной микробиоты до здоровых исходных уровней.Второй тип дизайна исследования начался с неподходящих исходных условий (исходные образцы, взятые после того, как нормальная микробиота была нарушена хроническим заболеванием). Для пациентов с установленными хроническими заболеваниями не существует исходного уровня «нормальной микробиоты» ни в группе пробиотиков, ни в контрольной группе. Даже если исходные данные взяты во время ремиссии, на микробиоту все еще могут влиять хронические заболевания или острая диарея. Исследования пробиотиков при хронических заболеваниях или острых заболеваниях обычно сообщают о «пре-пробиотическом лечении» и «пост-пробиотическом лечении» и могут показывать значительные изменения в микробных видах, но неясно, отражает ли это истинное восстановление нормальных профилей микробиоты. .В исследование третьего типа были включены здоровые добровольцы, которым не вводили антибиотики (так что нормального нарушения микробиоты не происходило) и которые демонстрируют только влияние пробиотиков на здоровую микробиоту (обычно слабое или нулевое воздействие). Контрольные группы не требовались для нашей оценки воздействия пробиотиков на микробиоту, но контрольные группы могут задокументировать степень нарушения нормальной микробиоты провоцирующими агентами (антибиотик, начало болезни и т. Д.).

Пять пробиотиков с одним штаммом ( B.longum , Clost. butyricum , L. acidophilus, L. rhamnosus и S. boulardii ) и пять пробиотических смесей (( L. acidophilus + B. bifidum) , ( L. rhamnosus + 54 L. bifidus + L. acidophilus) , ( L. acidophilus + L. paracasei + B. lactis), (L. acidophilus , 2 штамма, B. bifidum, B. animalis) и (L . acidophilus + L. paracasei + B. bifidum + 2 штамма B.lactis )) задокументировано полное или частичное восстановление нормальной микробиоты (модель A). Только две смеси пробиотиков ((смесь 2 штаммов: L. acidophilus + B. bifidum ) и (смесь 4 штаммов: L. acidophilus , 2 штамма, B. bifidum, B. animalis )) были поддержаны подтверждающее исследование. Доказательства того, что пробиотики могут изменять или улучшать нормальную микробиоту (модель B), были обнаружены для трех пробиотиков одного штамма ( E. coli Nissle, S. boulardii и L.casei rhamnosus ) и семь смесей из 2-7 пробиотических штаммов. Из этих 10 пробиотиков, обнаруживших изменение микробиоты, только три прошли несколько испытаний: S. boulardii , смесь из четырех штаммов (2 штамма L. rhamnosus + P. freudenreichii + B. breve ) и смесь из семи штаммов. (4 лактобациллы и 3 штамма бифидобактерий), но только у одного были стабильные результаты, свидетельствующие об улучшении микробиоты.74, 75 Очевидно, что для подтверждения воздействия пробиотика на нормальную микробиоту необходимо более одного исследования.Из 19 штаммов (или смесей) пробиотиков, изученных на здоровых добровольцах, которые не подвергались воздействию разрушающих факторов (модель C), никаких изменений нормальной микробиоты не наблюдалось для 79%, что указывает на устойчивость микробиоты.

Улучшение нормальной микробиоты за счет определенных штаммов пробиотиков, по-видимому, было связано с лучшими клиническими конечными точками. В рамках восьми распространенных заболеваний, обычно лечатся пробиотиками, большее количество испытаний со значительной эффективностью было связано с пробиотическими штаммами, восстанавливающими нормальную микробиоту, и только одно испытание со значительной эффективностью было обнаружено для пробиотиков, которые не влияли на микробиоту.Однако немногие пробиотики прошли испытания на эффективность при всех восьми заболеваниях, а многие не имели испытаний на эффективность.

Некоторые пробиотики, эффективность которых при различных заболеваниях опубликована, не имели исследований, изучающих влияние пробиотика на нормальную микробиоту: B. clausii , B. infantis , L. brevis , L. reuteri , смесь двух штаммов ( L. acidophilus + L. helveticus ), смесь двух штаммов ( L. acidophilus + L.casei ) или ( L. acidophilus + B. animalis ), смесь четырех штаммов ( L. rhamnosus (два штамма), P. freudenreichii + B. animalis )) и смесь семи штаммы ( L. sporogens, L. bifidum, L. bulgaricus, L. thermophilus, L. acidophilus, L. casei, L. rhamnosus) .

Сравнение результатов с другими исследованиями

Другие обзоры в литературе заявлений о пробиотиках, связанных с изменениями в нормальной микробиоте, были сосредоточены на широких вопросах нормативной стандартизации заявлений о здоровье или функциях, использовании надлежащего дизайна исследований и проблеме определения биомаркеров для «здоровой микробиоты». .3, 29, 112 Донован и др. 2 рекомендует, чтобы заявления о пользе пробиотиков для здоровья подтверждались хорошо проведенными испытаниями на людях в целевой группе населения. Эти обзоры также рекомендуют коррелировать биомаркеры кишечника с клиническими конечными точками, однако ни в одном из этих обзоров не предпринималось попыток сделать это.29, 112 В предыдущих обзорах не предпринимались попытки проанализировать связь между штаммами пробиотиков и их влиянием на нормальную микробиоту путем стратификации на качество дизайна исследования111. В этом обзоре эти проблемы были устранены путем анализа штаммов пробиотиков по качеству дизайна исследования и включения только испытаний, в которых оценивалась нормальная микробиота (либо с помощью микробного культивирования, либо с помощью биомаркеров молекулярных штаммов) и оценивалась степень улучшения дисбактериоза с помощью клинических данных. результаты для каждого пробиотического штамма.

Возможности для будущих исследований

В большинстве исследований (80%) с использованием модели А для документирования восстановления нормальной микробиоты использовались только методы микробиологического культивирования, которые позволяют обнаруживать только те организмы, которые растут в культуре. Использование более совершенных молекулярных метагеномных методов показало, что одно культивирование пропускает до 95% этих организмов.21, 22 Использование метагеномных методов было более распространено в исследованиях с использованием модели B (48%) и модели C (45%). ) дизайн исследования, который касается только потенциального изменения микробиоты.Характеристика микробиоты - сложный вопрос, и всесторонний учет всех бактериальных и грибковых штаммов в организме выходит за рамки наших текущих возможностей. Следовательно, любые исследования изменений микробиоты в лучшем случае неполны, но общие тенденции в бактериальных филотипах могут быть задокументированы с помощью ДНК-зондов и метагеномных методов. Ошибка дифференциального обнаружения может присутствовать из-за разнообразия анализов, используемых в этих исследованиях, и ее следует учитывать в будущих исследованиях.

Еще одно предложение для будущих исследований состоит в том, чтобы включить постпробиотический период в соответствующий период наблюдения.Менее половины рассмотренных исследований проводили анализы на нормальную микробиоту в течение соответствующего периода наблюдения. Как было показано, восстановление от разрушающего фактора может быть продлено (обычно 8 недель) 7, 8, и исследования, в которых не удалось обнаружить восстановление микробиоты, могли выявить возврат к нормальным исходным уровням, если для восстановления было уделено достаточно долгое время. произошло. Дальнейшие исследования должны быть направлены на то, чтобы дать время для восстановления нормальной микробиоты.

Поскольку действие пробиотиков зависит от штамма, и во многих исследованиях обычно указывается только род и вид тестируемого пробиотика, будущие отчеты должны включать полное описание пробиотика до уровня окрашивания.5, 112

Сильные и слабые стороны

Сильные стороны этого обзора включали полноту стратегии поиска, которая проверяла несколько баз данных цитирования, реестры клинических испытаний и поиск авторов, использование установленных протоколов PRISMA для обзоров и использование схемы классификации результатов для различных степеней оценки восстановления микробов. Этот анализ контролировал смешанные эффекты различных исследуемых популяций и дизайнов исследований, представленных в литературе.Фармакокинетические исследования только самого пробиотического штамма (ов) были исключены, и были включены только испытания, в которых анализировали другие виды, обнаруженные в микробиоте. Применяя стандартное определение для «восстановления» и «улучшения» нормальной микробиоты, можно различать существенные различия по типу используемых дизайнов исследований и различным эффектам различных штаммов пробиотиков. Ограничения этого обзора включают: один автор проанализировал и извлек литературу, объединил испытания, проведенные в разных популяциях (взрослые и дети), а также использовались разные дозы и схемы пробиотиков.Неполный поиск всех исследований, оценивающих влияние пробиотиков на микробиоту человека, также является потенциальным ограничением любого поиска в литературе. Еще одним ограничением является то, что улучшение дисбактериоза и клиническая эффективность пробиотических штаммов также косвенно связаны, прямая причинно-следственная связь с типами проведенных исследований невозможна. Еще одним ограничением является отсутствие в настоящее время стандартного определения того, что составляет «нормальную микробиоту». Состав микробиоты зависит от человека, возраста, географического положения и состояния здоровья хозяина.Современные микробиологические методы улучшаются, но не могут обнаружить все виды, присутствующие в организме хозяина.

Вызванные антибиотиками изменения микробиоты кишечника человека для наиболее часто назначаемых антибиотиков в учреждениях первичной медико-санитарной помощи в Великобритании: систематический обзор

Введение

В Великобритании с 2000 по 2014 год количество рецептов на антибиотики увеличилось с 14,3 до 19,7 установленных суточных доз (DDD) на 1000 жителей в сутки. С тех пор количество прописанных антибиотиков сократилось до 18.7 DDD на 1000 жителей в день в 2016 г. (http://www.oecd.org/). Неправильное и чрезмерное использование противомикробных препаратов не только в медицинском, но и в ветеринарном и сельскохозяйственном секторах приводит к повышению устойчивости, что в глобальном масштабе ограничивает наши возможности по борьбе с инфекциями. Снижение потребления антибиотиков - ключевая цель решения этой проблемы, и Соединенное Королевство внедрило меры по управлению противомикробными препаратами в первичной медико-санитарной помощи1 и разработало 5-летний план действий по борьбе с устойчивостью к противомикробным препаратам.2

Данные, проанализированные из базы данных The Health Improvement Network (THIN), показали, что средний уровень назначения антибиотиков среди участвующих практик составлял 626 рецептов антибиотиков на 1000 пациентов (543–699 IQR), 69% из которых могут быть связаны с системой организма и / или или клиническое состояние.3 Из этих назначений 46% были связаны с инфекциями дыхательных путей (ИРО) и 22,7% - с инфекциями урогенитального тракта. Около половины всех прописанных антибиотиков составляли пенициллин, из которых примерно 55% составлял амоксициллин; за этим следует 13% макролидов и 12% тетрациклина.3 Частота консультаций с терапевтом (GP) в Англии и Уэльсе показывает, что четверть населения будет посещать своего терапевта из-за ИРО каждый год.4 Использование антибиотиков для лечения такой инфекции варьируется в зависимости от врача и страны, 4–6, но составляет 60% всех назначений антибиотиков в общей практике.7–9 Аналогичным образом, инфекции мочевыводящих путей (ИМП) часто наблюдаются в учреждениях первичной медико-санитарной помощи.10 Пациенты часто лечатся антибиотиками, даже если инфекция часто не подтверждается микробиологически.11 Чрезмерное использование антибиотиков при состояниях, которые не являются серьезными или когда лечение антибиотиками не подходит для болезни, привело к снижению их эффективности и появлению устойчивых бактерий.

Нормальная микробиота кишечника состоит из примерно 800–1000 различных видов бактерий и более 7000 различных штаммов.12 «Нормальный» определяется как виды-комменсалы, преимущественно и постоянно встречающиеся в кишечнике здорового человека. Состав микробиомов пищевода и желудка отличается от микробиомов толстой кишки.Существует большее разнообразие видов и их количество на грамм содержимого в толстой кишке, что отражает более высокий уровень pH.13 14 В ядре микробиома здоровых людей преобладают типы Firmicutes и Bacteroidetes (более 90%), за которыми следуют Verrucomicrobia и Actinobacteria.13 Некоторые важные функции здоровой микробиоты кишечника включают выработку витаминов, метаболизм питательных веществ, иммуномодуляцию и защиту от инфекций путем ингибирования колонизации кишечника патогенами. Исследования микробиомов кишечника в разных странах выявили различия в разнообразии, которые отражают различия в диете, географии, воздействиях в раннем возрасте и генетике.15 Возраст, диета, антибиотики, пробиотики и пребиотики - все это способствует формированию здоровой микробиоты кишечника, и это продолжается динамично на протяжении всей жизни.13 14 16

Эти различия приводят к дисбиозу микробиома, и все больше доказательств того, что изменения в микробиоме человека могут повлиять на насколько хорошо функционирует иммунная система и ее способность противостоять инфекциям17 18; повышают риск развития болезни Паркинсона, рассеянного склероза и болезни Альцгеймера 19, риска депрессии, тревоги или психоза20; и косвенно влияют на здоровье в долгосрочной перспективе и риск ожирения и диабета.21 Появляется все больше доказательств того, что микробиом имеет решающее значение для риска инфекционных осложнений у онкологического пациента.22 Недавние исследования показали, что воздействие антибиотиков в детстве связано с повышенным риском развития ряда заболеваний, включая ожирение, диабет 1 и 2 типов, воспалительные заболевания кишечника и т. Д. Болезнь Крона, целиакия, аутоиммунные заболевания, такие как аллергия, ювенильный идиопатический артрит и астма.23–26. Похоже, что эти эффекты наиболее выражены, если антибиотики потребляются в течение первых 2 лет жизни, и эффекты вполне могут быть кумулятивными.17 27 28 Это особенно важно для маленьких детей, когда микробиом взрослого еще не сформировался полностью 29 30 После прекращения лечения антибиотиками микробиом может обладать определенной степенью устойчивости, будучи способным вернуться к составу, аналогичному исходному. один, но это плохо изучено и может занять месяцы или даже годы.17 31

Различия в представлениях о том, насколько безрисково лечение антибиотиками, могут частично объяснять огромные различия в темпах их использования от практикующего к практикующему врачу, между местностями. и в разных странах, но также и в рамках конкретной группы практикующих врачей, таких как терапевты.Необходимо четко понимать реальную стоимость наиболее часто назначаемых антибиотиков в первичной медико-санитарной помощи, включая различия между отдельными противомикробными препаратами в их воздействии на микробиом. Эта информация будет особенно полезна для управления противомикробными препаратами в первичной медико-санитарной помощи.

Aim

Это исследование было направлено на изучение вызванных антибиотиками изменений в микробиоте кишечника при применении наиболее часто назначаемых антибиотиков в учреждениях первичной медико-санитарной помощи в Великобритании: тех, которые назначаются при ИРО и ИМП.Нашим первичным результатом было определение любых вызванных антибиотиками изменений в составе микробиома кишечника, измеряемых (1) численностью и / или (2) разнообразием микробов, в то время как наш вторичный результат измерял время, необходимое для восстановления микробиома. состояние до антибиотика.

Методы

Был проведен систематический обзор литературы по исследованиям, в которых оценивалась связь между антибиотиками, обычно назначаемыми при ИМП и ИМП в первичной медико-санитарной помощи, и их влиянием на микробиом кишечника.В качестве основы для этого обзора использовались предпочтительные элементы отчетности для систематических обзоров и метаанализов (PRISMA) и контрольный список (см. Дополнительную онлайн-таблицу S1, контрольный список PRISMA) 32. Протокол исследования был зарегистрирован под номером PROSPERO CRD42017073750 (http: // www. .crd.york.ac.uk / ПРОСПЕРО).

Стратегия поиска

Электронные базы данных MEDLINE, EMBASE и AMED использовались для выявления релевантных статей до мая 2020 года на английском языке и доступны в виде полного текста. Комбинация поисковых запросов включала следующие ключевые слова: (антибактериальные средства ИЛИ бактериальные инфекции) И (микробиота ИЛИ микробиом).Стратегия была разработана для выявления исследований, проводимых в любой стране, по изучению вызванных антибиотиками изменений микробиоты кишечника человека; анализируется на индивидуальном или популяционном уровне, публикуется на любом языке (вставка 1). Списки ссылок включенных исследований и соответствующие обзоры были изучены вручную для выявления дополнительных подходящих исследований. Все отобранные рефераты и цитаты были экспортированы из научных баз данных в программу управления ссылками EndNote X9 (Thompson Reuters, Нью-Йорк, Нью-Йорк, США), дубликаты исключены.

Box 1

Стратегия поиска

  • Anti-Bacterial Agents / ae, pd, tu

  • Bacterial Infections / dt, mi

  • Microbiota /

  • (Microbiome or Gut microbiomes (Microbiome or Gut microbiomes) или Microbiota Gut или микробиота) .mp

  • Humans /

  • 1 или 2

  • 3 или 4

  • 6 и 7

  • 5 и 8

    9152 915 критерии

    Исследование соответствовало критериям обзора, если в нем сообщалось о количественных изменениях микробиоты кишечника, вызванных лечением антибиотиками, которые чаще всего назначаются для лечения ИРТ и ИМП в учреждениях первичной медико-санитарной помощи (таблица 1).ИРО включали инфекции верхних дыхательных путей (ИВПТ), включая простуду, ларингит, фарингит / тонзиллит, острый ринит, острый риносинусит и острый средний отит, а также инфекции нижних дыхательных путей (ИДПТ), включая острый бронхит, бронхиолит, пневмонию и трахеит. . Мы включили неосложненные и рецидивирующие инфекции мочевыводящих путей (ИМП и ИМП). Мы исключили исследования на животных или в больницах.

    Таблица 1

    Критерии PICOS для включения и исключения исследований

    Основным проявлением интереса в этом обзоре было влияние обычно назначаемых антибиотиков на микробиом кишечника на основе рекомендаций по рецептам, включенных в Национальный институт здравоохранения и качества ухода (NICE) руководящие принципы1 8 33–35 и о текущем использовании, как описано в национальных отчетах об использовании антибиотиков.1 34 Особый интерес представляют те антибиотики, которые обычно используются в первичной медико-санитарной помощи для лечения ИРО верхних и нижних отделов (амоксициллин, феноксиметилпенициллин, доксициклин, ко-амоксиклав, эритромицин, кларитромицин) и ИМП (триметоприм, нитрофурантоин, амоксициллин) .

    Скрининг, извлечение данных и управление

    Пять рецензентов (VW, KTE, EvdW, LD и AH) независимо проверяли результаты поиска и оценивали каждое потенциальное исследование в соответствии с критериями включения и исключения.Все решения записывались в электронную таблицу. Были получены полнотекстовые статьи для всех подходящих исследований, и три рецензента (VW, KTE, AH) независимо друг от друга проверили выбранные статьи во второй раз.

    Следующие данные были извлечены из включенных исследований в электронную таблицу Excel одним рецензентом (KTE) и процентная доля, подтвержденная на точность другим (VW): автор, журнал, год публикации, дизайн исследования, страна исследования, количество участников , количество участников, представляющих интерес для этого обзора, возрастной диапазон, процент женщин-участников, другие критерии включения, критерии исключения, методы набора, период времени набора, тип образца, первичный результат, вторичный результат, использованный антибиотик (представляющий интерес для этого обзора) , любые другие использованные антибиотики, доза антибиотиков (антибиотика, представляющего интерес для этого обзора), временной ход (антибиотика, представляющего интерес для этого обзора), количество временных точек для сбора образцов, временные точки для каждого сбора образцов, метод тестирования, инфекция или состояние, общее заключение.Для этого обзора была разработана сводная таблица, которая включала идентификатор исследования, страну, дизайн, популяцию, условия, инфекцию, интересующий антибиотик, образец и анализ, первичный результат и основные результаты (таблица 2).

    Таблица 2

    Сводка исследований, включенных в обзор

    Оценка методологического качества

    Систематическая ошибка отбора оценивалась с помощью контрольного списка Программы критических навыков оценки (CASP) (www.casp-uk.net). Каждый компонент исследований (т. Е. Соответствие дизайна исследования исследуемому вопросу, риск систематической ошибки выбора, измерение воздействия и оценка результатов) был оценен, и общая градация использовалась для создания диаграмм оценки качества на основе системы светофора. «низкий», «высокий» и «неясный» или «неприменимо», как рекомендовано Кокраном.36 Три составителя обзора (VW, KTE, EvdW) независимо друг от друга оценили риск систематической ошибки в исследованиях с двумя составителями обзора (KTE, VW), оценивающими все исследования, и расхождения были устранены на основе консенсуса между составителями обзора.

    Синтез и анализ данных

    Из-за недостаточного количества доступных исследований мы не смогли провести какой-либо анализ чувствительности, чтобы определить надежность результатов и качество исследований.36 Результаты обсуждаются описательно.

    Участие пациентов и общественности

    Это исследование было проведено без участия пациентов.

    Характеристики исследования

    Отбор проб

    Образцы фекалий обычно считаются репрезентативными для кишечной микробиоты. В исследованиях, проведенных до 2000 года, использовались культивированные гомогенизированные образцы фекалий на неселективных и селективных средах для подсчета различных типов колоний. Некоторые изолированные чистые культуры для идентификации на уровне рода. Эффект антибиотика измеряли путем сравнения количества бактерий, присутствующих от каждого рода до обработки, с уменьшением, увеличением чрезмерного роста или размножения других бактерий.Однако известно, что многие типы кишечных бактерий, около 80%, не культивировались.67 В более поздних исследованиях преимущественно использовались более быстрые молекулярные методы.

    Аналитические методы

    Во всех исследованиях анализировались образцы фекалий либо с помощью культуральных (17 исследований), либо молекулярных методов (13 исследований), в одном исследовании использовались оба метода. В восемнадцати исследованиях принимали участие здоровые добровольцы, в четырех исследованиях изучались пациенты с респираторной инфекцией, в трех исследованиях пациенты страдали ИМП, в одном исследовании сообщалось о пациентах с инфекциями мочевыводящих путей и дыхательных путей, у одного пациента был синусит, в одном исследовании - пародонтит, в другом - исследование основывалось на сообщениях о самооценке инфекций, а в двух исследованиях состояние здоровья субъектов не уточнялось.

    Риск систематической ошибки

    Риск систематической ошибки среди исследований оценивался с помощью контрольных списков CASP для случаев контроля, рандомизированных контролируемых испытаний (РКИ), других испытаний и когортных исследований (рис. 2). Было проведено 1 оценка случай-контроль, 15 когортных исследований и 15 испытаний. Все исследования адекватно излагали цели и гипотезы своих исследований, и эта часть оценки была оценена как «низкий» риск.

    Рисунок 2

    Общий риск оценки систематической ошибки для тематических исследований (A), когортных исследований (B) и испытаний (C).

    Случай - контроль

    В наш обзор было включено одно исследование случай - контроль пациента с началом диареи, не связанной с инфекцией Clostridium , в течение 24 часов после введения антибиотика.49 Было показано, что это было связано с изменениями в разнообразие микробиоты кишечника. Что касается систематической ошибки, исследование имеет тенденцию к общему неясному риску, поскольку отсутствуют средства контроля, а в отчете подробно описывается только один пациент в клинических условиях с интересующим симптомом (рис. 2A).Однако они использовали очень надежные молекулярные методы для изучения этих временных изменений разнообразия микробиоты.

    Когорты

    В наш обзор было включено 15 когортных исследований. Оценка достоверности исследования рассматривается в вопросах 1–6 (рисунок 2B). В целом эти исследования были низкого риска. Надежность исследований, определяемая размером эффекта и тем, насколько точно он был оценен, рассматривается в вопросах 7–9 и имеет низкий или неясный риск.Существует больший неясный риск, когда речь идет о применимости результатов (вопросы 10–12), полезности для принятия клинических решений, часто размер популяции был слишком мал, чтобы экстраполировать результаты на большую популяцию в целом.

    Испытания

    Пятнадцать исследований, включенных в этот обзор, были испытаниями / РКИ, и общий риск был более неясным. Валидность исследований (Q1-6), рандомизация и маскировка назначения лечения в целом были низкого риска. Исходные характеристики исследования имели низкий или неясный риск, поскольку в большинстве исследований указывались возраст, пол и состояние здоровья, за некоторыми исключениями указывались индекс массы тела и этническая принадлежность.Последующее наблюдение за участниками исследования было низким риском, при этом в большинстве исследований образцы берутся в течение 4 недель после введения антибиотика (хотя есть некоторые признаки того, что это должно быть дольше). Контроль вмешивающихся факторов (Q6) не был ясен в большинстве исследований. Величина лечебного эффекта (Q7) была хорошо известна, но точность (Q8) была неясной, в основном из-за небольшого размера популяции и отсутствия статистического анализа. Возможность переноса результатов на другие группы населения (Q9 и 11) представляла неясный риск.

    Воздействие антибиотиков на кишечник

    В проанализированных исследованиях использовались различные методологии для изучения воздействия антибиотиков на микробиоту кишечника. Они последовательно демонстрируют, что дисбактериоз развивается при приеме антибиотиков, что происходит быстро и приводит к потере разнообразия и сдвигу в численности кишечных микробов вверх или вниз. После лечения антибиотиками композиция обычно возвращается к аналогичному состоянию до обработки в течение нескольких недель, но не во всех случаях.Здесь мы описываем результаты более подробно для каждого интересующего антибиотика.

    Амоксициллин

    Десять исследований изучали влияние перорального амоксициллина на нормальную микрофлору кишечника и суммированы в таблице 3.37–46. Вкратце, введение амоксициллина приводит к увеличению или чрезмерному росту энтеробактерий (шесть исследований). Изменения в анаэробной популяции (включая Lactobacillus, Bifidobacterium и Bacteroides ) сильно различались между исследованиями: от без изменений до увеличения и / или уменьшения, а также от изменений в разнообразии.Было два сообщения об изолировании Clostridium и Candida и два, в которых не наблюдалось изменений в количестве. В восьми исследованиях проводилось более длительное наблюдение, и в большинстве из них сообщалось, что популяция вернулась к норме в течение 2–4 недель. В трех исследованиях сообщалось, что значительные изменения в разнообразии или численности микробиома все еще были очевидны в период от 42 дней до 6 месяцев после последней дозы антибиотика. Другими более долгосрочными эффектами были сохранение Candida через 6 недель, появление других аэробных или устойчивых грамотрицательных бактерий (виды не указаны) через 28 дней и стойкое снижение количества Lachnospiraceae через 6 месяцев без сходства в популяциях. обрабатывали.

    Таблица 3

    Влияние амоксициллина на микрофлору желудочно-кишечного тракта

    Christensson et al 42 провели культурально-зависимое рандомизированное исследование 84 субъектов с инфекциями нижних дыхательных путей, 38 из которых завершили лечение амоксициллином (остальные получали цефаклор и не будут получать цефаклор). будет обсуждаться далее здесь). Они показали, что количество энтеробактерий, анаэробных грамположительных лактобактерий, бифидобактерий и эубактерий и анаэробных бактерий значительно увеличилось в группе амоксициллина.Количество анаэробных кокков уменьшилось у 18 пациентов и увеличилось у 11 пациентов. Не было изменений в численности Enterococcus spp, Staphylococcus spp или Streptococcus spp. Четыре пациента были колонизированы Pseudomonas sp и пять - C. albicans . Хотя C. albican s также был выделен у двух пациентов до лечения и у трех пациентов через 6 недель после лечения, C. difficile был выделен у двух пациентов во время лечения.

    Эффект амоксициллина на микрофлору кишечника пациентов с бронхитом был оценен в рандомизированном исследовании Floor et al. .46 Анаэробная флора оставалась неизменной как во время, так и после терапии амоксициллином. Общее количество аэробных грамотрицательных палочек значительно увеличилось, и у 37,5% пациентов с впервые приобретенными бактериями основными идентифицированными видами были Klebsiella . Энтерококки были культивированы только у одного пациента. У трети пациентов были другие аэробные бактерии, отличные от исходного уровня на 21–28 дни.Обилие бактерий и грибков вернулось к исходному уровню через 21 день после лечения.

    Mangin и др. 41 изучали 18-месячных детей с острым бронхитом. Как общее количество бактерий, так и количество бифидобактерий были одинаковыми во время курса лечения антибиотиками. Однако изменения в Bifidobacterium на уровне видов показали снижение разнообразия. Лечение амоксициллином вызвало полное исчезновение видов Bifidobacterium adolescentis , значительное снижение частоты встречаемости Bifidobacterium bifidum , но не повлияло на Bifidobacterium longum и Bifidobacterium pseud10ocatenidulatum / .Они не изучали более долгосрочные эффекты.

    Monreal и др. 38 использовали методы, основанные на культуре, для исследования популяций фекальных бактерий у 22 пациентов с ИРО, получавших амоксициллин. Bacteroides spp, Bifidobacterium spp и Lactobacillus spp были уменьшены при лечении антибиотиками. Однако это было временным явлением, и через 30 дней после окончания лечения уровни Bifidobacterium и Lactobacillu s вернулись к своим нормальным значениям. Бактероиды восстанавливались медленнее.

    Ladirat и др. 45 изучали небольшое количество здоровых добровольцев с амоксициллином и пребиотиком, обращая особое внимание на общее количество бактерий и Bifidobacterium . Количество Bifidobacterium уменьшилось со временем из-за лечения амоксициллином, особенно в группе без пребиотика. Амоксициллин повлиял на численность и разнообразие Bifidiobacterium spp, и наблюдался чрезмерный рост Enterobacteriaceae.Наблюдения были очень индивидуально зависимыми. В период наблюдения (через 3 недели после прекращения лечения амоксициллином) уровни бифидобактерий в кале вернулись к исходным уровням.

    Амоксициллин вводили случайным образом небольшому количеству здоровых добровольцев, а влияние на микрофлору кишечника (и ротоглотки) изучали Brismar и др. .43 В аэробной кишечной флоре наблюдалось незначительное снижение количества стрептококков и стафилококков. наблюдаемый.Разрастание видов Klebsiella наблюдалось у шести субъектов и видов Enterobacter у двух субъектов. Разрастания энтерококков или дрожжей не наблюдалось. В анаэробной микрофлоре уменьшилось только количество эубактерий. Не было колонизации C. difficile . Через две недели после введения амоксициллина микробиота вернулась к исходному уровню.

    Другое исследование влияния амоксициллина на микрофлору кишечника здоровых добровольцев показало лишь небольшие изменения в аэробной микрофлоре фекалий.44 Все основные группы анаэробных бактерий не были затронуты амоксициллином, и не было колонизации C. difficile . Наблюдался чрезмерный рост Klebsiella spp у шести субъектов и Enterobacter у двух субъектов. Микрофлора кишечника нормализовалась через 2 недели после прекращения лечения.

    Шесть здоровых добровольцев получали амоксициллин перорально в течение 5 дней, а их фекальную микробиоту исследовали с помощью амплификации гена 16S рРНК и градиентного гель-электрофореза до 60 дней.37 Профили доминирующего видового разнообразия сравнивались на основе сходства с процентным соотношением при первой выборке в диапазоне от 93% до 99%. В течение 5-дневного курса лечения амоксициллином эти проценты снизились в среднем до 73%, но между людьми наблюдались огромные различия. К 60 дню пять из шести испытуемых гелевых профилей вернулись к своему почти исходному составу. Образцы полос геля были изучены более подробно для трех человек, и было показано, что они соответствуют Clostridium nexile , Ruminococcus Torques и β- Proteobacteria .

    Abeles et al. 40 изучали сожителей в течение 6 месяцев, когда одному давали антибиотик, а другому плацебо. Микробиота субъектов, принимавших амоксициллин, со временем становилась все более разнородной, хотя и не статистически значимой, поскольку аналогичные тенденции наблюдались и у субъектов, принимавших плацебо. Таксономический состав кишечника отличался после терапии амоксициллином. Lachnospiraceae были значительно уменьшены и оставались уменьшенными через 6 месяцев. Veillonellaceae, Bacteroidales и Porphyromonadaceae были значительно снижены в ответ на амоксициллин, тогда как Fusobacteriaceae были увеличены. Bifidobacteriales и Erysipelotrichaceae первоначально были уменьшены, а затем увеличены по сравнению с их соседями по дому, принимавшими плацебо.

    Паллав и др. 39 изучали эффект лечения амоксициллином с пребиотиком и без него. У восьми субъектов, получавших только антибиотик, произошли существенные изменения микробиома, в первую очередь увеличение количества Escherichia / Shigella . В контрольной группе изменений численности не было. Изменения, связанные с приемом антибиотиков, сохранялись до конца исследования, через 42 дня после окончания антибактериальной терапии.

    Амоксициллин с клавулановой кислотой

    В семи исследованиях изучалось влияние амоксициллина в комбинации с клавулановой кислотой на микробиоту кишечника.31 47–52 Они суммированы в таблице 4. Вкратце, комбинация амоксициллина с клавулановой кислотой вызывала легкое - умеренные изменения в составе микробиома, в основном увеличение количества энтеробактерий с различным воздействием на анаэробные бактерии Bifidobacterium sp, Lactobacillus sp и Bacteroides sp и общее снижение разнообразия.Одно исследование показало, что численность бактерий не нормализовалась через 2 месяца после прекращения лечения антибиотиками, а четыре сообщенных уровня были аналогичны исходному уровню в течение 35 дней.

    Таблица 4

    Влияние амоксициллина с клавулановой кислотой на микрофлору желудочно-кишечного тракта.

    Введение амоксициллина / клавулановой кислоты здоровым людям привело к увеличению количества энтерококков и штаммов Escherichia coli в аэробной микрофлоре, в то время как количество бифидобактерий, лактобацилл и клостридий значительно снизилось.51 Количество анаэробных кокков и Bacteroides существенно не изменилось. штаммов C. difficile были выделены у трех добровольцев. У всех добровольцев микрофлора нормализовалась через 35 дней.

    Янг и Шмидт49 исследовали краткосрочное воздействие амоксициллина / клавулановой кислоты, назначенного пациенту-мужчине с острым синуситом, у которого развилась диарея, связанная с антибиотиками. Было показано, что основные группы бактерий частично восстановились через 14 дней после лечения антибиотиками, за исключением Bifidobacterium .Во время введения антибиотика не было обнаружено никаких последовательностей, соответствующих продуцирующему бутират Clostridium кластеру XIVa, но через 2 недели после прекращения приема антибиотиков этот кластер снова появился. В этом тематическом исследовании уменьшение этого кластера может быть связано с диареей, связанной с антибиотиками.

    Одна из сторон исследования Engelbrektson et al. 50 наблюдала эффекты лечения пробиотиками одновременно с терапией антибиотиками на фекальные сообщества. Они проанализировали свои данные, измерив индивидуальные отклонения от исходного уровня после лечения, чтобы решить проблему индивидуальной вариабельности.Субъекты делятся на две категории: те, у кого стабильная исходная микробиота, и те, у которых она значительно различается. Данные по культуре показали увеличение количества Bacteroides и Enterobacteriaceae, но отсутствие тенденции для Clostridium , Bifidobacterium и Lactobacillus . В группе антибиотиков (без пробиотика) наблюдалось значительное изменение количества бактерий по сравнению с исходным уровнем на 21 день.

    Forssten et al. 48 также изучали введение антибиотиков в комбинации с пробиотиком.Потребление комбинации пробиотиков в основном приводило к увеличению уровня фекалий видов, включенных в препарат. Антибиотик оказал лишь незначительное воздействие на Lactobacillus , Bifidobacterium , Bacteroides , Enterobacteriaceae и Clostridium .

    Корпела и др. 31 изучили макролиды амоксициллин с клавулановой кислотой и пенициллином V и без них. Использование макролидов снизило численность актинобактерий и увеличило количество бактерий и протеобактерий.Группы пенициллина не имели отчетливо различного филового состава. Фирмикуты сократились. Эффект от использования макролидов был продолжительным и был связан с повышенным риском астмы и набором веса, связанным с приемом антибиотиков.

    Двенадцать здоровых субъектов получали амоксициллин / клавуланат в течение 7 дней, а образцы их стула были проанализированы с использованием пиросеквенирования гена 16s рРНК.52 Изменения, связанные с антибиотиками, включали снижение распространенности рода Roseburia и увеличение числа Escherichia , Parabactero1054 и Энтеробактер .Изменения микробиоты вернулись к исходному уровню, но полностью не восстановились через 2 недели после лечения.

    ПЦР в реальном времени с гель-электрофорезом в временном градиенте температуры (TTGE) показала, что в конце 5-дневного курса амоксициллин-клавулановой кислоты общие концентрации бактерий и бифидобактерий были значительно снижены у 18 здоровых добровольцев47. профили среднего процента сходства были значительно уменьшены, и количество различных видов Bifidobacterium на образец значительно уменьшилось.Через два месяца после воздействия антибиотика средний процент сходства не нормализовался.

    Нитрофурантоин

    В трех исследованиях изучалось влияние макрокристаллов нитрофурантоина на состав фекальной микробиоты.53–55 В двух исследованиях использовалось секвенирование гена 16S рРНК и в одном исследовании бактериальная культура, и они суммированы в таблице 2. Нитрофурантоин ингибирует бактериальную ДНК, РНК и клеточную стенку. синтез белка. Он используется в профилактических целях в качестве мочевого противоинфекционного средства против большинства грамположительных и грамотрицательных организмов, а также для длительного подавления инфекций.При пероральном приеме большая часть нитрофурантоина быстро всасывается в тонком кишечнике и выводится в основном за счет клубочковой фильтрации почек в мочу, где он достигает более высоких и эффективных терапевтических концентраций. Лишь небольшое количество достигает толстой кишки, что может объяснить незначительное влияние на микрофлору кишечника.

    В одном из исследований была изучена небольшая группа женщин (n = 7) с рецидивирующими ИМП, и оно показало, что нитрофурантоин не изменял ни энтеробактерии, ни энтерококки, ни дрожжи кишечной флоры во время лечения.55 Резистентных штаммов грамотрицательных аэробных бактерий обнаружено не было.

    Stewardson et al. 53 лечили пациентов с ИМП (n = 10) макрокристаллами нитрофурантоина и показали, что это не было связано со статистически значимым глобальным влиянием на микробиоту кишечника (слабый эффект). Лечение нитрофурантоином было связано с увеличением доли рода Faecalibacterium и уменьшением доли Clostridium (Clostridiaceae) в конце лечения антибиотиками.В другом небольшом исследовании (n = 8) изучались неосложненные ИМП, и не было выявлено какого-либо значительного влияния лечения нитрофурантоином на фекальную микробиоту, за исключением временного увеличения филума актинобактерий, в частности полезного рода Bifidobacterium 54. до уровней до антибиотиков через 31-43 дня после прекращения лечения антибиотиками, в то время как в другом исследовании не проводилось последующее тестирование.53 54

    Доксициклин

    В четырех исследованиях сообщалось о влиянии доксициклина на фекальную микробиоту, в одном исследовании использовалась субоптимальная дозировка ( 20 мг в течение 9 месяцев) у пациентов с пародонтитом57 и двое в обычной дозе 100-150 мг в течение 7-10 дней, хотя один также с пробиотиком 56 58 и другой в низкой дозе (40 мг в течение 16 недель) 59, как описано в таблице 2.Лечение доксициклином не оказало значительного влияния на подсчет общего количества анаэробных бактерий, кандида, кишечных бактерий, Staphylococcus или доксициклин-резистентных бактерий, выделенных в любой из периодов отбора проб, и не привело к развитию множественной устойчивости к антибиотикам.57 Matto et al. 58 специально оценили влияние терапии доксициклином на состав и чувствительность кишечных бифидобактерий к антибиотикам у девяти субъектов, которые также принимали пробиотики, и сравнили их со взрослыми, потребляющими только пробиотики.Во время терапии доксициклином наблюдалось заметное снижение разнообразия популяций Bifidobacterium . Тетрациклинорезистентные изоляты Bifidobacterium чаще выявлялись в группе антибиотиков, чем в контрольной группе, что увеличивало пул устойчивых комменсальных бактерий в кишечнике.

    В другом исследовании с участием 10 здоровых добровольцев доксициклин уменьшал количество Enterobacteriaceae, Enterococcus spp, E. coli и Streptococcus spp.56 За исключением Fusobacterium spp, который был элиминирован, количество анаэробных бактерий в фекалиях не зависело от доксициклина. 56 После введения доксициклина численность бактерий вернулась к уровню до антибиотика через 9 дней после прекращения лечения. 56 В четвертом исследовании также изучалась низкая доза в течение 16 недель.59 Наблюдалось 2 log уменьшения количества энтерококков и E. coli . Другие аэробные микроорганизмы, включая энтеробактерии, Candida spp, не были затронуты.При введении доксициклина значительных изменений в количестве анаэробных лактобацилл, бифидобактерий, клостридий и Bacteroides не наблюдалось.59 Выделено не было штаммов C. difficile . Аэробная и анаэробная микрофлора была нормальной через 28 дней после прекращения лечения.59 Таким образом, доксициклин влияет на способность микроорганизмов вырабатывать белки. В субоптимальной дозировке он мало влияет на микробиоту кишечника, за исключением энтерококков и E.coli . При нормальной дозировке он заметно влияет на разнообразие популяций бифидобактерий в одном исследовании и элиминировал Fusobacterium sp в другом. Воздействие на популяции других кишечных бактерий кажется временным, и к 28 дням сообщалось о нормализации. Долгосрочные эффекты неизвестны.

    Кларитромицин

    Включены четыре статьи о влиянии кларитромицина. Трое были из одного научно-исследовательского института, и они исследовали микрофлору кишечника здоровых добровольцев до, во время и после введения кларитромицина.Дизайн исследования был одинаковым во всех трех исследованиях и включал небольшое количество участников, 10 (смесь мужчин и женщин) в двух исследованиях60 62 и только 12 мужчин61, как описано в таблице 2. Дозировка и стратегия отбора проб и анализ также были аналогичными, 250 мг два раза в день в течение 7 дней, 59 500 мг два раза в день в течение 7 дней, 60 и 250 мг два раза в день в течение 10 дней, 62 взятия проб три раза во время и три-четыре раза после введения в течение до 35 дней. Субъектам только мужского пола вводили другой антибиотик с 6-недельным периодом вымывания; неясно, было ли это до или после введения кларитромицина.

    Основным результатом более раннего исследования было снижение количества энтеробактерий и стрептококков. Lactobacilli, Bifidobacteria и Bacteroides были подавлены в анаэробной микрофлоре60.

    Кларитромицин вызвал значительное снижение содержания E. coli в течение 7 дней лечения, но уровни вернулись к норме через 28 дней после окончания курса61. устойчивыми аэробными грамотрицательными палочками, Citrobacter , Klebsiella , Proteus и Pseudomonas .Общее количество анаэробных бактерий уменьшилось. Bifidobacteria и Bacteroides были значительно уменьшены, а Lactobacilli и Clostridia были подавлены, но это не было значительным. Не наблюдалось избыточного роста C. difficile или дрожжей. Микрофлора нормализовалась у всех испытуемых через 35 дней.

    В последнем исследовании количество E. coli было значительно снижено, а у шести человек произошло чрезмерное разрастание Klebsiella , Citrobacter и Enterobacter spp.62 Общее количество анаэробных кишечных бактерий не изменилось, но количество лактобацилл и бифидобактерий было значительно снижено, что сохранялось на протяжении всего исследования. Не было значительного избыточного роста Candida spp, и ни один субъект не был колонизирован C. difficile .

    Четвертое исследование, проведенное в другой группе на шести здоровых добровольцах, не показало изменений в численности Candida spp, Enterococcus spp или анаэробных бактерий.Не было новой колонизации C. difficile . Количество Enterobacteriaceae несколько снизилось. Сообщалось, что уровни вернулись к исходному к 21 дню после курса кларитромицина.

    Подводя итог, все четыре исследования сообщили о снижении количества энтеробактерий, а три - о подавлении анаэробных бактерий после введения кларитромицина. Это снижение было временным для большинства видов, за исключением Lactobacilli и Bifidobacteria. Только в одном исследовании сообщалось о выделении C.albicans. 60 Не сообщалось о новой колонизации или чрезмерном росте C. difficile . Все сообщили о нормализации до исходного уровня в течение 28 дней после окончания лечения антибиотиками.

    Феноксиметилпенициллин

    Феноксиметилпенициллин не оказал большого влияния на микробиом кишечника, как показали два исследования, в которых изучалось его влияние на ротоглоточную и кишечную микрофлору здоровых добровольцев (таблица 2) .64 65 В очень раннем исследовании сообщалось об отсутствии эффекта феноксиметилпеницилла на обилие различных видов, составляющих аэробную и анаэробную флору фекальных проб.64 Более позднее исследование показало, что никаких значительных изменений в общей аэробной и анаэробной микрофлоре кишечника не наблюдалось, хотя три добровольца были вновь колонизированы Klebsiella sp, а один имел большое количество неферментативных грамотрицательных палочек. На количество стрептококков viridans, энтерококков и Bacillus не повлияло введение феноксиметилпенициллина, в то время как незначительные изменения были замечены в количестве E. coli .Средние значения видов Clostridium увеличились во время введения, в то время как количество видов Bacteroides не изменилось в течение периода исследования. Через 2 недели после отмены препаратов микрофлора нормализовалась.

    Эритромицин

    В раннем исследовании 66 было показано, что введение 500 мг эритромицина два раза в день в течение 7 дней 10 добровольцам привело к снижению численности как аэробной, так и анаэробной фекальной флоры. Кроме того, всех субъектов колонизировали потенциально патогенные устойчивые к эритромицину энтеробактерии, клостридии или дрожжи.66 Брисмар и его коллеги60 вводили эритромицин перорально в течение 7 дней 10 добровольцам и оценивали его влияние на бактерии толстой кишки. Они обнаружили уменьшение количества стрептококков, энтерококков и энтеробактерий во время приема, увеличение количества стафилококков и изменение анаэробных бактерий.

    Обсуждение

    Основные результаты

    В этом систематическом обзоре изучалось использование наиболее часто назначаемых антибиотиков в первичной медико-санитарной помощи для лечения ИРТ и ИМП и их влияние на микробиоту кишечника.Во-первых, исследования показали, что антибиотики влияют на численность бактерий в кишечном сообществе, вызывая быстрое снижение уровня бактериального разнообразия и таксономического богатства, увеличение и уменьшение относительной численности определенных таксонов, что также приводит к дисбактериозу. как антибиотик и индивидуальные специфические эффекты хозяина.

    Во-вторых, после прекращения лечения имелись некоторые, но скудные доказательства того, что кишечные бактерии демонстрируют устойчивость и способны в некоторой степени восстанавливаться до исходного состояния.Однако микробиота часто не восстанавливается полностью, что позволяет предположить, что некоторые антибиотики оказывают стойкое воздействие на определенные виды. Эти наблюдения подчеркивают важность ограничительного и правильного использования антибиотиков для предотвращения долгосрочных экологических нарушений местной микробиоты.

    Сравнительные наблюдения

    В других обзорах также сообщается и обобщается, как антибиотики изменяют численность и разнообразие кишечной микробиоты.68–70 Здесь мы сосредоточимся на тех антибиотиках, которые обычно назначаются врачами общей практики в первичной медико-санитарной помощи.Часто врачи ненадлежащим образом назначают антибиотики при инфекциях, вызванных вирусами, или назначают антибиотики широкого спектра действия, когда следует использовать антибиотики для определенных бактерий. Они также могут прописать неправильную дозу или на неправильный период времени. Медицинские работники обеспокоены тем, что антибиотики используются слишком часто и неправильно, что способствует устойчивости к противомикробным препаратам, а с дополнительным нарушением микробиома также может иметь другие негативные (долгосрочные) последствия для здоровья, такие как метаболические и иммунные нарушения.71 72 Эти дополнительные эффекты будут в дальнейшем влиять на пациента и, возможно, на бремя первичной медико-санитарной помощи. Неправильное назначение связано со многими факторами, включая пациентов, которые настаивают на приеме антибиотиков, врачей общей практики, у которых нет времени, чтобы объяснить, почему антибиотики не нужны, тех, кто не знает, как распознать серьезную бактериальную инфекцию, или тех, кто слишком осторожен.

    Количественная оценка воздействия антибактериальной терапии на кишечную флору является сложной задачей. Хотя в литературе описывается «нормальный», на самом деле это означает те комменсальные виды, которые постоянно и преимущественно встречаются в здоровом кишечнике человека.Исследования по количественной оценке изменений флоры было бы легче интерпретировать, если бы в каждом случае были установлены исходные популяции. Мы обнаружили отсутствие крупномасштабных испытаний (включая РКИ) и обсервационных исследований, а также неоднородность методологии и результатов. Неоднородность проявляется в несовпадении дозировки, продолжительности лечения и последующего наблюдения, выбора и спектра используемых антибиотиков, что способствует изменяющейся концентрации в фекалиях. Состояние здоровья и возраст участника также имеют значение, в большинстве исследований четко не определены исходные характеристики, что вызывает проблемы при сравнении результатов.В большинстве исследований не сообщалось о побочных эффектах или каких-либо других факторах, которые могли бы повлиять на эффективность антибиотика, что, в свою очередь, могло бы повлиять на результат для микробиома. В исследованиях использовались различные методы, например, случайное распределение антибиотиков среди здоровых добровольцев или нерандомизированное лечение, при котором все здоровые субъекты в исследовании получали антибиотики, также некоторые участники исследований были скрыты от того, какое лечение они получали, а другие нет. Между исследованиями были различия в способах определения и измерения результатов, например, культивирование и молекулярные методы.Эти различные аналитические методы могут привести к различиям в наблюдаемых эффектах вмешательства. Ряд включенных исследований был проведен одной исследовательской группой, что может добавить дополнительную систематическую ошибку к результатам. Различные классы антибиотиков также по-разному влияют на микробиом, что затрудняет сравнение результатов исследований.

    Состав кишечной микробиоты людей значительно варьируется от субъекта к субъекту. Группирование данных от нескольких лиц может привести к потере статистической значимости.В исследованиях не учитываются какие-либо мешающие факторы, такие как диета, возраст испытуемых, воздействие антибиотиков в детстве, географическое положение, стресс или прием пробиотических добавок, все из которых могут усложнить воздействие конкретных антибиотиков на профиль микробиома кишечника. Эти факторы могут меняться в течение жизни.

    Сильные стороны и ограничения

    Основная сила этого исследования заключается в том, что мы сосредоточили внимание на наиболее часто назначаемых антибиотиках в первичной медико-санитарной помощи и их влиянии на микробиоту кишечника.Информация о том, как эти обычно назначаемые антибиотики влияют на микробиом кишечника, может повлиять на принятие решения терапевтом при назначении антибиотиков. Кроме того, большое значение имеет неблагоприятное воздействие антибиотиков на микробиом кишечника, поскольку в случае его нарушения оно может быть связано с различными заболеваниями, включая восприимчивость к инфекциям, аутоиммунные заболевания (например, воспалительные заболевания кишечника), диабет, депрессию и ожирение. Основные ограничения этого обзора заключаются в том, что большинство включенных исследований были небольшими, не рандомизированными должным образом и не являлись крупными обсервационными исследованиями.Значительная неоднородность подвержена предубеждениям и смешивающим факторам.

    Многие исследования, посвященные влиянию антибиотиков на микробиоту кишечника, ограничены в доступных методах анализа. Многие из них были выполнены с использованием трудоемкой методологии, основанной на культуре, которая не позволяет анализировать большое количество образцов. В более ранних исследованиях, включенных в наш анализ, для изучения состава кишечной микробиоты использовались методы, основанные на культуре, что увеличивает риск систематической ошибки обнаружения.Недостатком использования культивирования является то, что, несмотря на использование специальных селективных сред и анаэробных условий инкубации, остается значительная часть микробиоты, примерно 80% 67, которая еще не была культивирована. Выбор питательной среды и обработка образцов также могут исказить данные.

    Ограничения методов, основанных на культуре, можно в значительной степени преодолеть с помощью молекулярных подходов.73 Эти методы основаны на амплификации гена 16S рРНК и дают нам более широкий, менее предвзятый взгляд на бактериальный состав кишечника.Амплифицированные гены характеризуются такими методами, как полиморфизм длин концевых рестрикционных фрагментов, денатурирующий гель-электрофорез или гель-электрофорез в температурном градиенте, глубокий метагеном и полноразмерное секвенирование, некоторые из которых используются в более поздних статьях нашего обзора. Эти биоинформатические методы также имеют ограничения в том, что их часто труднее понять и интерпретировать. Использование различных методов затрудняет сравнение результатов, и обобщение выводов является результатом такого разнообразия в определении и количественной оценке.

    Дырявый кишечник: что это такое и что это значит для вас?

    До того, как медицинское сообщество стало лучше понимать механизмы, вызывающие заболевания, врачи считали, что причиной определенных заболеваний может быть дисбаланс в желудке. Это называлось ипохондрией. (На древнегреческом языке подреберье обозначает верхнюю часть живота, область между грудиной и пупком.) Эта концепция была отвергнута по мере развития науки, и, например, мы могли смотреть под микроскопом и видеть бактерии, паразитов. , и вирусы.Значение этого термина изменилось, и в течение многих лет врачи использовали слово «ипохондрик» для описания человека, который имеет стойкий, часто необъяснимый страх перед серьезным заболеванием.

    Но что, если в этой древней концепции болезней кишечника действительно есть доля правды? Могут ли некоторые из хронических заболеваний, с которыми сегодня сталкивается наше общество, действительно быть связаны с дисфункциональной желудочно-кишечной системой?

    Выражению «дырявый кишечник» в последнее время уделяется много внимания в медицинских блогах и социальных сетях, но не удивляйтесь, если ваш врач не узнает этот термин.Дырявый кишечник, также называемый повышенной кишечной проницаемостью, является нововведением, и большая часть исследований проводится в рамках фундаментальных наук. Однако растет интерес к разработке лекарств, которые могут использоваться пациентами для борьбы с последствиями этой проблемы.

    Что такое дырявый кишечник?

    Внутри нашего живота находится обширная кишечная оболочка, занимающая площадь более 4000 квадратных футов. При правильной работе он образует плотный барьер, который контролирует то, что попадает в кровоток.Нездоровая слизистая оболочка кишечника может иметь большие трещины или отверстия, позволяющие частично переваренной пище, токсинам и насекомым проникать в ткани под ней. Это может вызвать воспаление и изменения кишечной флоры (нормальные бактерии), что может привести к проблемам в пищеварительном тракте и за его пределами. Сегодня мир исследований бурно развивается, и исследования показывают, что модификации кишечных бактерий и воспаление могут играть роль в развитии нескольких распространенных хронических заболеваний.

    У кого дырявый кишечник (и почему)?

    У всех нас есть некоторая степень проницаемости кишечника, поскольку этот барьер не является полностью непроницаемым (и не должен быть таким!).Некоторые из нас могут иметь генетическую предрасположенность и могут быть более чувствительны к изменениям в пищеварительной системе, но виновата не только наша ДНК. Современная жизнь может быть основной причиной воспаления кишечника. Появляются доказательства того, что стандартная американская диета с низким содержанием клетчатки и высоким содержанием сахара и насыщенных жиров может инициировать этот процесс. Чрезмерное употребление алкоголя и стресс также нарушают этот баланс.

    Мы уже знаем, что повышенная кишечная проницаемость играет роль в определенных желудочно-кишечных состояниях, таких как целиакия, болезнь Крона и синдром раздраженного кишечника.Самый большой вопрос заключается в том, может ли повышенная кишечная проницаемость вызывать проблемы в других частях тела. Некоторые исследования показывают, что повышенная кишечная проницаемость может быть связана с другими аутоиммунными заболеваниями (волчанка, диабет 1 типа, рассеянный склероз), синдромом хронической усталости, фибромиалгией, артритом, аллергией, астмой, угрями, ожирением и даже психическими заболеваниями. Однако у нас пока нет клинических исследований на людях, показывающих такую ​​причину и следствие.

    Путь к здоровому кишечнику

    Несмотря на то, что в большинстве кабинетов врачей редко можно встретить термин «повышенная кишечная проницаемость», практикующие врачи альтернативной и интегративной медицины десятилетиями работали над исцелением кишечника как первым шагом к лечению хронических заболеваний.Другие культуры по всему миру часто рекомендуют определенные диеты, чтобы люди чувствовали себя лучше. Даже в Соединенных Штатах часто можно увидеть, как люди меняют свой рацион после болезни. Обычный первый шаг, который предпринимают некоторые практикующие врачи, - это исключить продукты, которые могут вызывать воспалительные процессы и способствовать изменению микрофлоры кишечника. К наиболее распространенным относятся алкоголь, обработанные пищевые продукты, определенные лекарства и любые продукты, которые могут вызывать аллергию или повышенную чувствительность. В своей практике я часто вижу, как пациенты значительно поправляются, когда начинают придерживаться более здоровой диеты.

    До сих пор ведутся споры о том, вызывает ли повышенная кишечная проницаемость развитие заболеваний вне желудочно-кишечного тракта у людей. Тем не менее, всегда полезно придерживаться питательной, необработанной диеты, которая включает продукты, которые помогают подавить воспаление (и избегают продуктов, которые, как известно, вызывают воспаление), что может, по крайней мере теоретически, помочь восстановить слизистую оболочку кишечника и привести к большему балансу. к кишечной флоре. Этот рецепт поможет вам почувствовать себя лучше без каких-либо побочных эффектов. Однозначно стоит попробовать.

    Ресурсы

    Дырявый кишечник как сигнал об опасности аутоиммунных заболеваний.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *