Симптомы 12 перстной кишки: причины, симптомы и лечение всех видов заболеваний в ФНКЦ ФМБА

Содержание

Лечение рака двенадцатиперстной кишки в Москве

Рак двенадцатиперстной кишки — злокачественная опухоль в начале тонкого кишечника, куда поступает содержимое желудка и открывается проток для желчи и секрета поджелудочной железы. Чаще всего это новообразование обнаруживают у людей старше 50 лет, причем оно является вторичным, а первичный очаг располагается в других органах.

Хотя точные причины онкологии 12-перстной кишки неизвестны, к провоцирующим факторам относят особенности питания (большое количество острой и жирной пищи при недостатке клетчатки), контакт с желудочным соком и желчью, ожирение, инфицирование хеликобактериями, наследственность, хронические заболевания и доброкачественные опухоли ЖКТ.

Классификация и стадии

Раковый узел образуется из клеток слизистой и имеет множество разновидностей по гистологии. Выделяют экзофитную и эндофитную форму. Образование может располагаться:

  • в луковице — ближе к желудку;
  • в околососочной зоне — около 75% от всех случаев онкологии этого органа;
  • в верхней части кишки;
  • в горизонтальной области.

Наш эксперт в этой сфере:

Иванов Антон Александрович

Медицинский директор, врач онколог-хирург, к.м.н

Как и для большинства злокачественных опухолей, выделяют 4 основные стадии развития заболевания:

I — небольшие размеры, четкие границы, в пределах слизистой и подслизистой;

II — образование увеличивается до диаметра 5 см, прорастает в другие слои тканей;

III — поражаются регионарные лимфоузлы, идет прорастание новообразования в близлежащие органы;

IV — метастазы доходят до отдаленных органов и лимфатических узлов.

Признаки рака двенадцатиперстной кишки

На начальных этапах симптоматика незаметна, но профилактические осмотры с УЗИ позволяют выявить опухоль и в дальнейшем уточнить диагноз. По мере прогрессирования рака двенадцатиперстной кишки симптомы начинают свидетельствовать о раковой интоксикации и проблемах с пищеварением:

  • повышенная утомляемость, постоянная слабость;
  • головные боли, болезненные ощущения в подложечной зоне, справа под ребрами;
  • тошнота и рвота, отрыжка и изжога, свидетельствующая о повышенной кислотности;
  • потеря аппетита, резкое снижение веса;
  • желтуха.

Такие проявления характерны не только для этой болезни, поэтому для эффективности лечения важно как можно раньше установить правильный диагноз.

Диагностика опухолей двенадцатиперстной кишки

Как правило, желудок, поджелудочная железа, желчевыводящие пути и начало кишечника рассматриваются в комплексе. Могут использоваться:

  • анализы крови (общий, биохимический, на онкомаркеры), кала и мочи;
  • УЗИ;
  • ФГДС или ЭГДС;
  • эндоскопия или эндосонография;
  • рентген с контрастированием;
  • колоноскопия;
  • КТ и МРТ.

Таким образом устанавливается причина недомогания, локализация проблемы, если речь об онкологическом процесс — размеры опухоли, стадия, этиология и т.д. Исходя из этих факторов, а также состояния пациента и его анамнеза определяется дальнейшая тактика. Даже если новообразование возникло в результате распространения первичного очага из другого органа, врачи могут заметно облегчить состояние больного и добиться улучшения.

Отправьте документы на почту [email protected] Возможность проведения лечения рассмотрит главный врач клиники Антон Александрович Иванов, онколог-хирург, кмн

Лечение рака двенадцатиперстной кишки

На ранних стадиях используют хирургическое удаление опухоли и прилегающих тканей, в том числе части желудка и поджелудочной железы, на поздних оно может спровоцировать новый рост. В комплексе проводятся радио- и химиотерапия, которые подавляют размножение раковых клеток, а также терапия для улучшения самочувствия, повышения иммунитета, снятия побочных эффектов и т.д.

Поскольку онкология часто протекает бессимптомно, важно уделять достаточно внимания своему самочувствию, не пренебрегать профилактическими осмотрами и обращаться за диагностикой, не дожидаясь заметного ухудшения. В клинике НАКФФ вы можете пройти все необходимые диагностические процедуры, а также лечение и курс реабилитации. 

Язвенная болезнь желудка или двенадцатиперстной кишки

Язвенная болезнь желудка — заболевание, при котором в желудке и (или) 12-перстной кишке человека образуются дефекты (язвы). Чаще всего болеют язвенной болезнью мужчины от 20 до 50 лет, причем с каждым годом их число постоянно растет.

Для заболевания характерно хроническое течение и цикличность: болезнь подтачивает здоровье своего хозяина годами, периоды обострения сменяются обманчивым спокойствием. Обычно язва дает о себе знать весной и осенью.

Интересно, что язвенная болезнь двенадцатиперстной кишки возникает гораздо чаще, чем язвенная болезнь желудка.

Причины язвенной болезни желудка

Ведущую роль в развитии заболевания играет спиралевидный микроб Helicobacter pylori, который и повреждает слизистую оболочку желудка и 12-перстной кишки. Однако этот микроорганизм можно обнаружить более, чем у 80% жителей России, но при этом болеют язвенной болезнью далеко не все.

Дело в том, язва не развивается без ряда дополнительных факторов:

  • стрессы, тревоги, депрессии;
  • плохая наследственность;
  • неправильное питание: употребление грубой и острой пищи, злоупотребление алкоголем;
  • курение;
  • бесконтрольный прием некоторых лекарств (резерпин, кортикостероидные гормоны, аспирин).

Что происходит?

Микроб Helicobacter pylori передается от человека к человеку при тесном длительном контакте, например, при поцелуях, через общую посуду и полотенца, а также при несоблюдении правил гигиены в туалетах.

Оказавшись в желудке Helicobacter, начинает активно размножаться и вести подрывную деятельность. Он вырабатывает особые ферменты (уреазу, протеазы), которые повреждают защитный слой слизистой (внутренней) оболочки желудка и 12-перстной кишки, нарушает функции клеток, выработку слизи и обменные процессы и вызывает образование язв.
С другой стороны, постоянные стрессы могут изменять работу нервной системы, что приводит к спазму мышц и кровеносных сосудов желудка. В результате он остается без питания и теряет свою неуязвимость: стенки начинают перевариваться едким желудочным соком. Образуется язва.

Как распознать?

В первую очередь о возникновении и развитии язвенной болезни человеку сигнализирует боль в верхней половине живота. Беспокоят ночные боли, при которых человеку необходимо что-нибудь съесть, чтобы «погасить» боль.

Часто беспокоит изжога спустя 2-3 часа после еды. Тошнота, рвота, «кислая» отрыжка, частые запоры все это свидетельствует о том, что вам пора обращаться к гастроэнтерологу.
Имейте ввиду, в некоторых случаях язва может протекать бессимптомно!

Чем опасно?

Если болезнь не лечить, язвенный дефект распространяется вглубь стенки желудка. Этот процесс может завершиться опасными для жизни человека осложнениями: прободением (перфорацией), при котором в стенке желудка или кишки образуется сквозное отверстие, и кровотечениями.

Диагностика

Для установления диагноза язвенной болезни необходимо проведение эзофагогастродуоденоскопии (ЭГДС). Врачи часто называют это исследование просто гастроскопией. Гастроскопия выполняется в амбулаторных условиях: через рот в желудок вводится эндоскоп — узкая гибкая трубка с оптическим прибором на конце, при помощи которой врач осматривает желудочно-кишечный тракт изнутри, забирает пробы желудочного сока и т.п. Если больной почему-то отказывается от гастроскопии, поставить правильный диагноз поможет УЗИ и рентгенография желудка.

Лечение

После открытия микроба, вызывающего язвенную болезнь, для лечения язвы врачи в первую очередь стали назначать пациентам антибиотики (одновременно несколько штук).
Дополнительно больным назначают препараты, нейтрализующие основной компонент желудочного сока — соляную кислоту (антациды), или снижающие ее количество, а также препараты, образующие защитную пленку на поверхности слизистой оболочки желудка.
Все язвенники должны соблюдать правильный режим дня, по возможности не нервничать, на время лечения отказаться от курения и алкогольных напитков и придерживаться специальной диеты.

Активный курс лечения в среднем занимает 2 недели, после чего необходимо продолжать поддерживающее лечение и соблюдать режим питания.

Хирургическое вмешательство требуется лишь при длительно незаживающих язвах желудка, а также при осложнениях язвенной болезни. Во время операции по поводу язвенной болезни чаще всего удаляют пораженный участок желудка или кишки, а также перерезают некоторые нервные веточки, что способствует снижению кислотности желудочного сока.

Профилактика

Для предупреждения новых приступов болезни врачи рекомендуют:

  • принимать противоязвенные препараты курсами, весной и осенью, когда высока вероятность возвращения болезни;
  • соблюдать диету и режим питания, ограничить потребление алкоголя, курение;
  • 1-2 раза в год посещать врача-гастроэнтеролога.

Рак 12-перстной кишки: симптомы, проявление и признаки опухоли двенадцатиперстной кишки, лечение

По раку двенадцатиперстной кишки не создано клинических рекомендаций в онкологии, но их удостоилась анатомически крошечная её структурная часть — дуоденальный большой или фатеров сосочек, в который открывается общий для желчи и панкреатических ферментов проток.

Традиционно все серьёзные дуоденальные заболевания автоматически рассматриваются вместе с патологий желудка, хотя двенадцатиперстная — начальная часть кишечника, а с желудком 12-перстную объединяет только анатомическая близость.

Анатомия двенадцатиперстной кишки

Задача у двенадцатиперстной одна — получив обработанную кислотой желудочного сока пищевую массу, смешиванием с желчью и панкреатическими ферментами подготовить её к вхождению в щелочную среду кишечника.

Похожий на подкову отрезок пищеварительной трубки — длиной всего 12 перстов или пальцев (в поперечнике), соединяется с желудком луковицей, снаружи к 12-перстной плотно прилежит поджелудочная железа.

Луковица двенадцатиперстной названа так за большое сходство, и складки слизистой тоже как у лука — сверху вниз, тогда как в остальных отделах кишечника преимущественно поперечные. В луковице кислый желудочный секрет смешивается с щелочным кишечным и именно здесь чаще всего зарождаются язвы, а злокачественные опухоли, наоборот, развиваются редко — у каждого седьмого из всех страдающих дуоденальными карциномами.

Далее нисходящая часть с открывающимися в неё сосочком панкреатическим и общим желчным протоками, в этот отдел поступает выработанная печенью желчь и агрессивные панкреатические ферменты. В двух из трех случаев именно в этой части двенадцатиперстной развивается злокачественный процесс.

Далее идут горизонтальная и восходящие части, частота злокачественной опухоли тоже идёт по нисходящей — новообразования в этих отделах довольно редки.

Причины рака двенадцатиперстной кишки

Считается, что причины развития злокачественной опухоли 12-перстной кишки почти такие же, как у рака желудка, о них тоже мало известно.

  • Предполагается связь с хеликобактерной инфекцией. Ассоциированные с бактерией язвы в 12-перстной встречаются чаще — в восьми из десяти случаев, тогда как в желудке только у шести больных. Язвенная болезнь вчетверо чаще поражает дуоденальную слизистую, нежели желудочную. Болеют дуоденальными язвами преимущественно женщины, а язвой желудка — мужчины.
  • Замечена связь рака 12-перстной с ожирением.
  • Есть предположение о влияние национальных особенностей питания, не доказанное статистикой.

По большому счёту — ясности нет ни с причинами желудочного рака, тем более с первопричинностью дуоденальных карцином.

Диагностика рака двенадцатиперстной кишки

Злокачественные новообразования справедливо относят к болезням старения, абсолютное большинство пациентов уже встретило свой 65 день рождения, у женщин процесс возникает лет на 5–10 позже.

Российская онкологическая статистика про карциному 12-перстной кишки молчит, никто не знает числа заболевших и не анализирует характеристики пациентов по стадиям на момент выявления. В зарубежье дела обстоят ничуть не лучше.

Как проверить двенадцатиперстную кишку на рак? Так же, как и желудок — сделать ФГДС или фиброэзофагогастродуоденоскопию. При гастроскопии по любой желудочной проблеме обязательно осматривается двенадцатиперстная, с подозрительных участков берётся биопсия. При патологии желчевыводящих путей и поджелудочной железы также в первую очередь обследуется 12-перстная кишка.

Очень эффективна комплексная диагностика — сочетание эндоскопии с УЗИ или эндосонография, позволяющие увидеть всю толщину кишечной стенки.

Доступно и рентгенологическое исследование в разных проекциях — полипозиционное с контрастированием. Прекрасно выявляет патологию КТ, а вот лапароскопия, в отличие от карциномы желудка, используется не всегда, а только при продвинутых стадиях.

Небольшой участок пищеварительного тракта непросто осмотреть даже очень хорошим эндоскопом, поскольку постоянно впрыскивается непрозрачная желчь и кишка в постоянном движении, но это отлично делают специалисты «Евроонко», годами копившие опыт обследования пациентов.

Стадии двенадцатиперстного рака

В подавляющем большинстве в дуоденальной стенке развивается слизистая аденокарцинома, анатомические особенности позволяют диагностировать её на ранних стадиях.

Стадирование базируется на степени вовлечения кишечной стенки в злокачественный процесс и наличии метастазов в лимфатическом коллекторе:

  • Опухоль в пределах слизистой оболочки — 1 стадия;
  • Новообразование в пределах стенки с метастазированием в лимфатические узлы рядом с органом — 2 стадия;
  • Прорастание раком кишечной стенки с выходом в брюшную полость и вовлечение рядом находящихся анатомических структур — 3 стадия;
  • При любом размере опухолевого поражения дуоденальной стенки появление метастазов в других органах — безоговорочно устанавливается 4 стадия.

Прогноз при дуоденальной аденокарциноме

В общем у большинства пациентов прогноз заболевания хороший, потому что и метастазы в ближайшие к органу лимфатические узлы находят только у каждого седьмого больного и рецидивы после лечения карциномы очень нечасты.
Выявление на ранней стадии — залог долгой жизни пациента, после операции 80% переживают первую пятилетку.

Как проявляется рак двенадцатиперстной кишки

Признаки раннего рака малозаметны и не отличаются от симптомов любого другого желудочного заболевания:

  • непонятный дискомфорт,
  • несвязанные с приёмами пищи неясные боли в подложечной области,
  • эпизодическое подташнивание,
  • периодический метеоризм.

Обычно долго страдающие разнообразными «несварениями» желудочно-кишечного тракта принимают эти симптомы за обострение хронического гастрита, колита или язвенной болезни — чего угодно, только не злокачественной опухоли.

Клинические проявления новообразования в 12-перстной в большинстве случаев обусловлены сужением или полным перекрытием просвета пищеварительной трубки:

  • При локализации опухоли в начальном отделе на первый план выходят симптомы стеноза выходного отдела желудка: постоянное переполнение и перерастяжение его застоявшейся пищей, рвотой недавно съеденным.
  • При расположении карциномы в нисходящей части первым симптомом может стать механическая желтуха вследствие блокирования оттока желчи по общему протоку, а также клинические признаки острого панкреатита.
  • При поражении нижней части 12-перстной или полной обтурации просвета кишечника на любом уровне может развиться клиника кишечной непроходимости: прогрессивно ухудшающееся состояние со зловонными рвотами и отсутствием стула более 3 дней, нарастанием интоксикации.
  • Прорастание всей толщи кишечной стенки может манифестировать кровотечением с черным поносом и коричневой рвотой на фоне прогрессирующей слабости.
  • Вовлечение поджелудочной железы в опухолевый конгломерат осложнится выраженным болевым синдромом, похожим на симптомы острого панкреатита.
  • При метастатической стадии симптомы отражают локализацию очагов в органах и тканях, с параллельно прогрессирующей потерей веса и нарастающей слабостью.

Лечение рака двенадцатиперстной кишки

Радикальное лечение включает операцию с удалением поражённого дуоденального сегмента с прилежащими тканями — гастропанкреатодуоденальная резекция или полное удаление всего органа — панкреатодуоденэктомия.

Во всех ситуациях вместе с 12-перстной единым блоком удаляется выходной отдел желудка, головная часть поджелудочной железы с клетчаткой, где расположены лимфатические узлы.

При исходной желтухе на первом этапе с помощью паллиативной операции восстанавливается отток желчи и проводится активное «отмывание» капельницами, и только при нормализации состояния и биохимических показателей крови приступают к специальному лечению — операции или химиотерапии при технически невозможном оперативном вмешательстве.

Стандарт лечения аденокарциномы 12-перстной не разработан, поэтому ориентируются на лечебный подход при раке желудка, так при сомнительной операбельности проводят несколько курсов химиотерапии с включением фторурацила и платиновым производным.

Нет доказательств безусловной эффективности профилактической химиотерапии после операции по поводу 2–3 стадии, тем не менее при низкодифференцированной аденокарциноме или большом поражении такое лечение возможно, но не раньше, чем через 6–8 недель после хирургического вмешательства при полном заживлении раны.

Рак двенадцатиперстной кишки не относится к онкологическим раритетам с заболеваемостью один-два на миллион, но исследователи уделили ему недостаточно внимания и не разработали стандартного подхода, дающего наилучший результат у подавляющего большинства пациентов.

Для каждого больного дуоденальной карциномой разрабатывается персональная программа лечения с учётом всего известного о морфологии рака, поэтому требуется внимание к деталям и отличное знание научного материала, что для нашей клиники абсолютная норма клинической практики.

Список литературы

1. Гусейнов А.З., Истомин Д.А., Гусейнов Т.А./ Объем оперативных вмешательств при раке желудка: современные тенденции // Вестник новых медицинских технологий; 2013, № 1.
2. Spechler S.J. /Peptic ulcer and its complications // Sleisenger & Fordtran’s Gastrointestinal and Liver Disease. Philadelphia-London-Toronto-Montreal-Sydney-Tokyo; 2002; v. 1.
3. Ando T., Goto Y., Maeda O., Watanabe O., et al./ Causal role of Helicobacter pylori infection in gastric cancer // World J.Gastroenterol.; 2006; v. 12.
4. Brenner H., Rothenbacher D., Arndt V. /Epidemiology of stomach cancer // Methods Mol. Biol.; 2009; v. 472.

Лечение прободной язвы желудка и двенадцатиперстной кишки: симптомы, диагностика, услуги, врачи

Гастроэнтерологи Москвы - последние отзывы

У меня была проблема с результатами анализов и поджимало время до операции. Этот доктор смола вывести меня из шокового состояния, успокоила, подбодрила. Дала направление, назначения и рекомендации. Всё понятно рассказала и по полочкам разложила. Внимательная, доброжелательная, чуткая. Мне понравилось как она ведёт себя с пациентами: очень много времени уделяет для объяснений.

На модерации, 15 августа 2021

Понимающий врач, приятный, спокойный, внимательный. Доктор помог мне в некоторых вопросах, назначил терапию, дал рекомендации. Я думаю, что мы еще будем встречаться и продолжать лечение. Мне понравился прием, порекомендовала бы этого специалиста своим знакомым.

Алина, 10 августа 2021

Прием в целом меня устроил, могу только положительно отозваться о докторе Асель Алымовне, была внимательна на приеме. Порекомендую специалиста своим друзьям и знакомым если будет такая необходимость.

Артем, 05 августа 2021

Доктор выявил причины моего плохого самочувствия и выписал рецепт на лечение. Он был внимателен, добрый и знающий. Я остался доволен приемом!

Рашид, 27 июля 2021

Обратился к этому гастроэнтерологу по совету знакомых. Хороший, прямолинейный и отзывчивый доктор. Провел мне осмотр и консультацию. Дал дальнейшие напутствия как вести себя после операции, прописал диету и тд.

Максим, 23 июля 2021

Хороший и вежливый доктор. Он все мне сделал, поставил диагноз и разложил все по полочкам. Врач также четко все объяснил и выписал лекарство. Я приду к нему на повторный прием. В случае необходимости, я бы порекомендовала его знакомым.

Лидия, 22 июля 2021

Я доволен! Врач хороший, дружелюбный, вежливый и аккуратный. Я узнал о Татьяне Михайловне через Интернет. На приёме она меня посмотрела и выписала лекарства, порекомендовала сделать УЗИ и сдать анализы. Повторно пойду к этому специалисту, потому что я у неё уже был, надо чтобы смотрел один доктор.

Асхатжат, 01 июля 2021

Доктор внимательный. Она померила мне давление, пульс, кислород в крови и оказала весь спектр услуг. Я обращусь к ней повторно!

Яна, 06 июня 2021

Врач професисональный и приятный в общении. Она выявила проблему, всё объяснила мне и направвила на сдачу анализов.

Владислав, 29 мая 2021

Доктор внимательный и профессиональный. Она меня выслушала, все рассказала, назначила обследование и лечение.

Динара, 14 января 2021

Показать 10 отзывов из 12142

симптомы, лечение в клинике НЕОМЕД (Санкт-Петербург)

Для постановки точного диагноза в клинике НЕОМЕД используется метод гастроскопии - исследования полости желудка при помощи современного эндоскопического аппарата.

После диагностических процедур и установления состояния органа в случае необходимости назначается схема лечения лекарственными препаратами. Кроме того, особое внимание уделяется лечению сопутствующих заболеваний.

Под наблюдением опытного гастроэнтеролога клиники НЕОМЕД можно достаточно быстро достичь позитивных результатов в лечении язвенной болезни.

Это гастроэнтерологическое заболевание, характеризующееся образованием язв на слизистой желудка и двенадцатиперстной кишки. Проявляется сильной болью в желудке, рвотой - симптомами, свойственными острой форме язвенной болезни.

Хроническая форма заболевания может протекать почти никак себя не проявляя.

Язвенная болезнь – одно из самых распространенных гастроэнтерологических заболеваний, по статистике, она обнаруживается у 8-10% взрослого населения планеты. Известно, что заболеванию в большей степени подвержены мужчины зрелого возраста, однако в последние десятилетия болезнь получила значительное распространение и среди женского пола.

Различают обычную и симптоматическую язвенную болезнь; во втором случае причиной развития болезни могут быть стрессы, травмы, длительный прием лекарств, серьезные заболевания других органов.

Проявления симптомов язвы нельзя игнорировать или заниматься самолечением, поскольку эта болезнь чрезвычайно опасна своими осложнениями, в том числе прободением язвы - образованием сквозных отверстий в желудке или двенадцатиперстной кишке с кровотечением в брюшную полость.

Обратитесь в клинику НЕОМЕД в случае проявления похожих симптомов!

В зависимости от расположения язвы в конкретном отделе желудка или двенадцатиперстной кишки симптоматика несколько отличается. Однако заболевание имеет ряд общих симптомов:

  • боль в желудке, чаще всего на пустой желудок, спустя 2 и более часа после еды; характерны «голодные боли» и боли в ночное время. После принятия пищи болевые ощущения ослабевают
  • тошнота и рвота на пике болевых ощущений в желудке, после которой боль ослабевает
  • изжога и отрыжка
  • язва имеет сезонный характер, то есть обострение чаще всего приходится на весну и осень
  • для пожилых людей не редкость молчащие язвы

В хронической стадии течения самочувствие может быть не нарушено.

Выделяют несколько взаимосвязанных причин язвенной болезни:

  • наследственная предрасположенность
  • сильные стрессы, нервно-психическое переутомление. Они провоцируют нарушение целостности и питания стенки органа, снижение защитных свойств слизистой желудка и 12-перстной кишки
  • бактерия Helicobacter pylori является частым спутником заболевания, её выявляют в 90% случаев

Развитие симптоматических язв часто сопутствует другим  тяжелым заболеваниям (эндокринным патологиям, сердечным заболеваниям, травмам) а также вызывается длительным приемом определенных групп лекарственных препаратов.

Спровоцировать развитие язвенной болезни  может нарушение питания (употребление веществ, раздражающих стенку желудка), курение, алкоголь, а также нелеченные заболевания желудочно-кишечного тракта.

× Текст скрыт. Выберите пункт меню для чтения дополнительной информации.

Когда у вашего ребенка язва желудка или двенадцатиперстной кишки

Язва - это разрушение ткани внутри желудка или тонкой кишки. Это вызывает образование язвы. В желудке может образоваться язва. Это называется язвой желудка. Или может образоваться в первой части тонкой кишки. Это называется язвой двенадцатиперстной кишки. У детей язвы часто возникают из-за инфекции, вызванной бактериями, такими как Helicobacter pylori. Или они могут быть вызваны определенными лекарствами, такими как НПВП (нестероидные противовоспалительные препараты).Они также могут быть вызваны повышенным содержанием кислоты в желудке.

Каковы симптомы язвы?

Общие симптомы язвы желудка или двенадцатиперстной кишки включают:

  • Жжение, спазмы или боль, напоминающую голод в животе. Часто это происходит через 1–3 часа после еды или посреди ночи.

  • Боль, которая уменьшается или усиливается во время еды

  • Тошнота или рвота

  • Признаки крови в рвоте

  • Черный стул, липкий, как смола, что означает кровотечение из язвы

Как диагностируются язвы?

Медицинский работник спросит о симптомах вашего ребенка.Вашему ребенку также может потребоваться тест. Общие тесты на язву включают:

  • Верхний отдел желудочно-кишечного тракта. Это серия рентгеновских снимков пищеварительного тракта.

  • Эндоскопия. В этом тесте используется тонкая гибкая трубка с прикрепленной к ней крошечной камерой (эндоскопом). Эндоскоп вводится ребенку в желудок. Это позволяет врачу увидеть язву. Эту трубку также можно использовать для взятия крошечного образца ткани (биопсия).

  • Анализы крови, дыхания или стула. Это может помочь выявить инфекцию, которая может вызвать язву.

Как лечат язвы?

Язвы у детей лечатся лекарствами. Наиболее распространенными лекарствами являются блокаторы H-2 и ингибиторы протонной помпы (ИПП). Они помогают, предотвращая образование кислоты в желудке. Для облегчения симптомов и заживления язвы у ребенка может потребоваться от 8 до 12 недель приема лекарств.

Долгосрочные проблемы

У ребенка, у которого была язва, больше шансов заболеть ею снова.Следите за появлением у ребенка симптомов язвы. Если у вашего ребенка есть какие-либо симптомы, немедленно обратитесь к его или ее лечащему врачу. Если не лечить язву, может возникнуть серьезная проблема, называемая перфорацией. Это отверстие в стенке желудка или кишечника. Для устранения перфорации, скорее всего, потребуется экстренная операция. Нелеченные язвы также могут вызвать непреднамеренную потерю веса и постоянную боль в животе. Кровоточащая язва также может вызвать низкий уровень эритроцитов в крови (анемию).

Когда звонить поставщику медицинских услуг

Немедленно позвоните поставщику медицинских услуг вашего ребенка, если вы заметили признаки того, что язва вашего ребенка ухудшилась или перфорировалась.Наблюдайте за:

  • Лихорадка

  • Кровь в рвоте

  • Сильная боль в животе

7 Симптомы язвы желудка у детей и их лечение

Изображение: Shutterstock

Язвенная болезнь - это открытая язва или поражение на слизистой оболочке, выстилающей внутреннюю стенку желудка или двенадцатиперстной кишки (верхняя часть тонкой кишки). Эти язвы можно разделить на язвы желудка (желудка) и язвы двенадцатиперстной кишки, в зависимости от их расположения.

Пептические язвы у детей встречаются редко. Если у вашего ребенка симптомы язвы, обратитесь за медицинской помощью. Диета при язве и лекарства, отпускаемые без рецепта, могут не излечить ее, поскольку она часто вызывается бактериальной инфекцией Helicobacter pylori ( H.pylori или HP).

Прочтите этот пост MomJunction, чтобы узнать больше о признаках, симптомах, причинах, факторах риска, диагностике, лечении и профилактике язвенной болезни у детей.

Признаки и симптомы язв желудка и двенадцатиперстной кишки у детей

Иногда язвы могут протекать бессимптомно.Однако часто бывает грызущая или жгучая боль в желудке, которая длится от нескольких минут до часов.

Следующие симптомы также могут наблюдаться при язве желудка и двенадцатиперстной кишки (1).

  1. Тошнота
  2. Частая рвота с появлением «кофейной гущи» или крови
  3. Отсутствие аппетита
  4. Слабость
  5. Вздутие живота
  6. Потеря веса
  7. Анемия (бледная кожа)

Когда звонить врачу

Обратиться за медицинской помощью если у вашего ребенка есть признаки и симптомы язвенной болезни.Язва может вызвать жгучую боль в желудке по утрам и между приемами пищи.

Если вы заметили темный стул и рвоту «кофейной гущей», немедленно обратитесь к педиатру. Внезапное появление резкой боли в животе у ребенка с язвенной болезнью может быть связано с перфорацией, требующей неотложной помощи.

Что вызывает язвенную болезнь у детей?

Основной причиной язв желудка (желудка) и двенадцатиперстной кишки является инфекция Helicobacter pylori, хотя у детей она встречается реже, чем у взрослых.Стресс, диета, желудочная кислота и лекарства могут быть причинами язвы.

Вот список вероятных причин язвенной болезни у детей (2) (3).

  • pylori Инфекция : Эти бактерии поражают внутреннюю оболочку желудка и двенадцатиперстной кишки. Внутренняя слизистая оболочка защищает желудок и стенки кишечника от желудочной кислоты и пищеварительных ферментов, таких как пепсин. H.pylori может вызывать воспаление этих слизистых оболочек, что приводит к образованию язвы.
  • Стресс: Физический стресс, такой как травмы, тяжелые ожоги, тяжелые операции и т. Д., Может вызвать язву желудка. Эти вызванные стрессом язвы желудка называются язвами Керлинга. Однако эмоциональный стресс не является причиной стрессовой язвы. Психологические факторы могут только усилить восприятие язвенной боли.
  • Синдром Золлингера-Эллисона или гастринома : это заболевание вызывает повышенную секрецию кислоты желудочного сока, вызывая, таким образом, язвы. Однако это заболевание редко встречается в педиатрической популяции.
  • Нестероидные противовоспалительные препараты (НПВП) : Лекарства, такие как ибупрофен, аспирин и напроксен, могут вызывать язву желудка. Эти лекарства могут быть основной причиной язв, не связанных с HP.

Похоже, что употребление острой пищи не увеличивает риск развития язвенной болезни (1). Кофеин из кофе может увеличить производство кислоты в желудке. Однако это может усилить боль в существующих язвах (5). Детский гастроэнтеролог может диагностировать причину язв.

Кто подвержен риску пептической язвы?

Дети с повышенным риском заражения инфекцией Helicobacterial pylori имеют повышенный риск развития язвы желудка и двенадцатиперстной кишки. Эти бактерии могут попасть к вашему ребенку через прямой контакт со слюной, рвотой или фекальными массами инфицированного человека или через зараженную пищу и воду.

Следующие факторы могут увеличить риск заражения H.pylori у детей (6).

  • Жизнь в тесноте
  • Отсутствие чистой воды
  • Антисанитарные условия жизни
  • Проживание с инфицированным человеком
  • Совместное использование посуды и других предметов с инфицированным человеком
  • Несоблюдение гигиены рук

Вы можете обратиться за медицинской помощью Будьте осторожны, если вы заметили у ребенка стойкие симптомы, такие как изжога, боль в животе, темный стул и т. д. Ранняя диагностика и лечение инфекции H.pylori может предотвратить ее осложнения.

Как диагностируют пептические язвы у детей?

Педиатры выслушают историю симптомов и признаков и проведут медицинский осмотр. Следующие тесты заказываются на основе оценки (7).

  • Эзофагогастродуоденоскопия (EGD) и биопсия также называется гастроскопией, дуоденоскопией или эндоскопией. Небольшая гибкая трубка (эндоскоп) со специальными камерами и светом используется для наблюдения за внутренней оболочкой пищеварительного тракта.Визуализируются язвы, и при необходимости берутся образцы тканей с помощью специальных инструментов. Образцы ткани желудка проверяются на наличие pylori . Это лучший способ поставить точный диагноз.
  • Верхний отдел желудочно-кишечного тракта (ЖКТ) или рентген брюшной полости или бариевая клизма. Серия Upper GI помогает визуализировать верхнюю часть пищеварительной системы. Ребенку нужно будет выпить бариевую жидкость (контраст) перед рентгенологическим исследованием брюшной полости для проверки видимости.Этот тест проводит радиолог.
  • Экспресс-тест на уреазу (тест CLO ) - это диагностический тест на инфекцию pylori , выполняемый с использованием образцов биопсии.
  • Анализ кала может помочь определить наличие инфекции pylori . Анализ стула на скрытую кровь может помочь определить кровь в стуле.
  • В тесте на дыхание , врач может дать еду или питье с радиоактивным углеродом и через некоторое время попросить подуть в мешок. pylori расщепляет углерод и образует углекислый газ, который можно найти в образце дыхания, если у вашего ребенка инфекция.
  • Анализ крови может помочь определить анемию и наличие воспалительных и инфекционных маркеров в крови.

Лечение язвенной болезни у детей

Лечение язвы может варьироваться в зависимости от причины. Следующие лекарства обычно используются для лечения язвенной болезни у детей (8).

  • Антибиотики уничтожают бактерии в желудке.
  • h3-блокаторы, , такие как циметидин и фамотидин (Pepcid), помогают снизить секрецию кислоты в желудке.
  • Ингибиторы протонной помпы (ИПП) , , такие как омепразол и лансопразол, снижают выработку кислоты в желудке.
  • Антациды помогают нейтрализовать кислоту желудка. Это может помочь облегчить симптомы, но не излечивает язву.
  • Цитопротекторы защищают слизистую оболочку пищеварительного тракта от пищеварительных ферментов и кислоты желудочного сока. Карафат (сукральфат) и Cytotec (мизопростол) являются цитопротективными средствами. Они также используются для профилактики язв (предотвращение язв).
  • Язвы, вызванные НПВП , лечат отменой НПВП и введением ИПП.

Протоколы лечения язвенной болезни и гастрита с H.pylori , известна как Helicobacter pylori протоколы ликвидации . Эти методы лечения направлены на искоренение бактерий и облегчение симптомов.

Любая из перечисленных ниже комбинированных схем с антибиотиками и ингибитором протонной помпы с субсалицилатом висмута или без него применяется для оптимальной эрадикации (9).

  • Тройная терапия : Лечение первой линии с использованием антибиотиков кларитромицин и амоксициллин или метронидазол с пероральным ИПП проводится два раза в день в течение 14 дней.
  • Четверная терапия : Это лечение второй линии с применением ИПП, субсалицилата висмута, тетрациклина и тинидазола или метронидазола в течение десяти дней.
  • Последовательная терапия: Это двойная терапия, включающая лечение ИПП и амоксициллином в течение первых пяти дней. Затем следует стандартная тройная терапия в течение еще пяти дней.

Педиатры могут заменить антибиотики, если у вашего ребенка аллергия на определенный антибиотик и если в вашем регионе есть резистентность к антибиотикам.

Плановые операции по поводу язвенной болезни редко необходимы для лечения язвенной болезни, поскольку большинство детей поправляются с помощью лекарств (5). Однако перфоративная язвенная болезнь требует лапароскопической пластики сальника (лапароскопическая оментопексия) у педиатрических пациентов.

Хотя некоторые лекарства здесь продаются без рецепта, вы можете посетить педиатра для диагностики и точной дозировки лекарств в зависимости от состояния здоровья вашего ребенка.

Осложнения пептических язв

Пептические язвы могут вызвать серьезные осложнения, если их не лечить или лечить плохо.Наиболее частыми осложнениями язвы являются (5):

  • Кровотечение : Если язвы или язвы глубокие и разъедают кровеносные сосуды, это может вызвать сильное внутреннее кровотечение. Это может привести к кровотечению из язв. Рвота «кофейной гущей» и черный дегтеобразный стул - признаки кровотечения из язвенной болезни. Это может привести к анемии и необходимости переливания крови, если не лечить в течение длительного времени.
  • Перфорация : Язва может вызвать отверстие в стенке желудка или двенадцатиперстной кишки.Кислота желудка, пищеварительные ферменты и пища могут пролиться в брюшную полость через это отверстие и привести к перитониту (воспалению брюшной стенки). Это чрезвычайная ситуация, и вам потребуется срочная помощь.
  • Обструкция: Язвы на конце желудка могут заблокировать или сузить отверстие кишечника. Это предотвращает попадание пищи в кишечник и вызывает сильную рвоту.
  • Рак желудка: pylori Инфекция и невылеченные язвы желудка могут вызвать рак желудка в более позднем возрасте.

Советы по профилактике язвенной болезни у детей

Предотвращение инфекции H.pylori - один из лучших способов предотвратить язвенную болезнь. Следующие советы могут помочь вашему ребенку снизить риск развития язвенной болезни (9) (3).

  • Мойте руки водой с мылом
  • Избегайте совместного использования посуды и других предметов с инфицированным человеком
  • Пейте чистую воду
  • Избегайте еды и питья в антисанитарных местах
  • Потребляйте фрукты и овощи после их тщательного мытья
  • Избегайте применения НПВП в течение длительного времени без рецепта
  • Всегда принимайте лекарства, такие как Пантоп (пантопразол), данные для профилактики язвы указаны. предложить лекарство от язвы желудка или двенадцатиперстной кишки (10).

    Часто задаваемые вопросы

    1. Как я могу помочь моему ребенку жить с язвенной болезнью?

    Выполняйте лечение по рецепту педиатра. Хотя симптомы исчезают, следует соблюдать рекомендованный курс лечения, чтобы избежать рецидива инфекции H.pylori . Вы можете попросить ребенка избегать еды, которая может ухудшить симптомы.

    2. Сколько времени нужно для заживления язвы желудка?

    Язвы желудка (желудка) могут потребовать больше времени для заживления, чем язвы двенадцатиперстной кишки, из-за желудочной кислоты.Полное излечение неосложненной язвы желудка и двенадцатиперстной кишки у большинства пациентов может занять до шести недель. Однако симптомы могут исчезнуть намного раньше, и часто язва заживает в течение двух недель (11). Язвы, вызванные НПВП, начинают заживать практически сразу после прекращения приема лекарств. Ингибиторы протонной помпы могут еще больше ускорить процесс заживления (4).

    Блокаторы желудочного сока и ИПП могут вылечить язву и облегчить симптомы. Однако присутствие H.pylori в желудке может вызвать рецидивирующие язвы.Если у вашего ребенка язвенная болезнь и инфекция H. pylori , то всегда обращайтесь за медицинской помощью и соблюдайте рекомендованный режим лечения. Язвы могут быть опасными для жизни, если их не лечить, а более позднее лечение может вызвать повышенный риск рецидива язвы.

    Учите ребенка соблюдать правила гигиены рук с раннего возраста. Частое мытье рук водой с мылом может помочь предотвратить заражение инфекцией H.pylori , а также другими инфекциями.

    Ссылки:
    Статьи о здоровье MomJunction написаны после анализа различных научных отчетов и утверждений авторов-экспертов и организаций.Наши ссылки (цитаты) состоят из ресурсов, созданных властями в соответствующих областях. Вы можете узнать больше о достоверности информации, которую мы представляем, в нашей редакционной политике.


    Рекомендуемые статьи

    Атрезия двенадцатиперстной кишки и симптомы у детей

    Что такое синдром Дауна (трисомия 21)?

    Синдром Дауна - это генетическое заболевание. Младенцы, рожденные с этим заболеванием, имеют дополнительную копию хромосомы 21, что дает им три копии вместо обычных двух.По этой причине синдром Дауна также известен как трисомия 21. Дополнительная хромосома изменяет нормальный ход развития ребенка, что приводит к физическим особенностям и легким или умеренным интеллектуальным нарушениям, связанным с этим заболеванием. Дети, рожденные с синдромом Дауна, чаще страдают сердечными аномалиями, проблемами зрения и слуха, а также другими заболеваниями. Однако благодаря медицинским и другим достижениям современные дети с синдромом Дауна могут вырасти и прожить долгую, счастливую, здоровую и продуктивную жизнь.

    Как лечить атрезию двенадцатиперстной кишки до рождения?

    Пренатальное ведение детей с атрезией двенадцатиперстной кишки начинается с получения как можно большего количества информации о заболевании. Также будут проведены тесты, чтобы определить, присутствует ли синдром Дауна или врожденный порок сердца. Чтобы собрать всю эту информацию, мы используем несколько различных методов, включая ультразвуковое исследование плода с высоким разрешением, эхокардиографию плода и амниоцентез.

    Что такое УЗИ плода с высоким разрешением?

    Ультразвуковое исследование плода с высоким разрешением - это неинвазивный тест, выполняемый одним из наших ультразвуковых специалистов.В тесте используются отраженные звуковые волны для создания изображений ребенка в утробе матери. Мы будем использовать ультразвуковое исследование, чтобы следить за развитием кишечного тракта вашего ребенка и других внутренних органов на протяжении всей беременности. Мы также будем искать признаки избытка околоплодных вод вокруг вашего ребенка (известного как многоводие ), что может повысить риск преждевременных родов.

    Что такое эхокардиограмма плода?

    Эхокардиография плода (сокращенно «эхо») проводится в нашем центре детским кардиологом (врачом, специализирующимся на пороках сердца плода).Эта неинвазивная ультразвуковая процедура с высоким разрешением конкретно исследует структуру и функционирование сердца ребенка в утробе матери. Этот тест важен, потому что у детей с синдромом Дауна и атрезией двенадцатиперстной кишки иногда также есть врожденный порок сердца.

    Что такое амниоцентез?

    Амниоцентез - это тест, который проводится во время беременности, чтобы проверить, есть ли у вашего ребенка генетическое или хромосомное заболевание, например синдром Дауна. Небольшой образец жидкости будет взят из околоплодных вод, окружающих вашего ребенка.Амниотическая жидкость будет содержать клетки вашего ребенка, и в этих клетках будут хромосомы вашего ребенка, которые мы будем анализировать. Процедура проста и может быть проведена в нашей клинике. Для получения образца жидкости необходимо ввести небольшую иглу через брюшную полость и в амниотический мешок. Наша лаборатория обработает результаты тестов в течение нескольких дней. Информация, полученная в результате этого теста, будет очень важна для составления вашего плана ухода и помощи неонатологу в уходе за вашим младенцем после рождения.

    Что произойдет после завершения моей оценки?

    После того, как мы соберем всю анатомическую и диагностическую информацию из тестов, вся наша команда встретится с вами, чтобы обсудить результаты. Атрезию двенадцатиперстной кишки нельзя лечить до рождения ребенка. Тем не менее, мы будем применять активный двоякий подход к управлению этим заболеванием во время вашей беременности. Во-первых, мы будем очень внимательно следить за матерью и ребенком, ища любые возможные осложнения, которые могут привести к преждевременным родам.Одним из таких потенциальных осложнений является накопление в матке лишних околоплодных вод ( многоводия, ), которое может возникнуть, когда атрезия (закупорка) затрудняет глотание ребенка. Если это произойдет, мы будем внимательно следить за признаками преждевременных родов и / или симптомами у матери, связанными с увеличением размера матки и давлением. Иногда выполняется амниоредукция. Эта процедура, похожая на амниоцентез, удаляет часть лишней жидкости и облегчает любые симптомы, которые может испытывать мать.

    Во-вторых, мы постараемся выявить любые осложняющие факторы, такие как синдром Дауна или порок сердца, которые могут потребовать дополнительных методов лечения. Таким образом, мы сможем подготовиться во время и после родов к оптимальному уходу за вашим младенцем.

    Как лечится атрезия двенадцатиперстной кишки после рождения?

    Младенцы с атрезией двенадцатиперстной кишки могут родиться вагинально. Наша цель - сделать так, чтобы ваш ребенок родился как можно ближе к сроку родов. Ваш ребенок родится в Центре матери и ребенка в Эбботт Северо-Западный и Детский Миннесота в Миннеаполисе или в Центре матери и ребенка в Юнайтед и Детский центр Миннесоты в Сент-Луисе.Павел. Детский Миннесота - один из немногих центров по всей стране, где родильный дом расположен на территории больничного комплекса. Это означает, что ваш ребенок родится всего в нескольких футах от нашего отделения интенсивной терапии новорожденных (NICU). Кроме того, многие врачи, с которыми вы уже встречались, будут присутствовать во время или сразу после рождения вашего ребенка, чтобы помочь сразу же позаботиться о нем.

    Вашему ребенку потребуется специализированная медицинская помощь после рождения, поэтому его доставят в наше отделение интенсивной терапии.Большинство детей с атрезией двенадцатиперстной кишки могут свободно дышать самостоятельно, но ваш ребенок не сможет кормить грудью или взять бутылочку, и вместо этого он будет получать питательные вещества внутривенно. Поскольку кишечник вашего ребенка заблокирован атрезией, тонкая гибкая трубка будет вставлена ​​в желудок вашего ребенка через нос или рот. Эта трубка будет использоваться для откачки воздуха или жидкости, которые скапливаются в желудке ребенка.

    Наша цель - как можно быстрее поставить окончательный диагноз атрезии двенадцатиперстной кишки.Этот диагноз можно поставить с помощью простого рентгена, сделанного вскоре после рождения. Также будет проведена эхокардиограмма для выявления любого сопутствующего порока сердца.

    Исследование микробиоты полости рта, желудка и двенадцатиперстной кишки у пациентов с симптомами со стороны верхних отделов желудочно-кишечного тракта

    Материалы и методы

    Исследуемая популяция и процедура сбора образцов

    Пациенты были включены в исследование с декабря 2018 г. по апрель 2019 г. после получения информированного согласия. Возраст пациентов составлял от 17 до 82 лет, и (24/36) 66% составляли женщины.Рутинная эзофагогастродуоденоскопия (ЭГДС) была выполнена 25 пациентам с симптоматикой, соответствующей гастроэзофагеальной рефлюксной болезни, диспепсии и дисфагии. Одиннадцать пациентов с ахалазией рассматривались как «контрольные» на основании доказательств того, что ахалазия возникает из-за потери нервной функции в гладких мышцах пищевода без патологии слизистой оболочки за пределами гастроэзофагеального перехода. У четырех пациентов был гастропарез, подтвержденный исследованием опорожнения желудка. У четырех пациентов был сахарный диабет.Восемнадцать пациентов получали ингибитор протонной помпы (ИПП) при подозрении на кислотно-пептические опосредованные симптомы до эндоскопии. Образцы слюны были получены непосредственно перед эндоскопией. Бактерии слизистых оболочек собирали с помощью стандартной кисточки для цитологического исследования (Olympus), осторожно растирая слизистую второй части двенадцатиперстной кишки и антрального отдела желудка (онлайн-приложение, рис. 1). Биопсии желудка и двенадцатиперстной кишки были взяты для стандартного патологического исследования, в частности, для исключения глютеновой энтеропатии в двенадцатиперстной кишке и оценки инфекции Helicobacter pylori в желудке.

    Эндоскопические данные в контрольной группе включали расширенный пищевод и отсутствие перистальтики. В исследуемой группе эндоскопические данные были следующими: гастрит от легкой до умеренной степени 6/25, атрофия слизистой оболочки желудка 2/25, эзофагит степени A в Лос-Анджелесе 2/25, грыжа пищеводного отверстия диафрагмы 2/25, стеноз нижнего отдела пищевода 2/25, слизистая оболочка лососевого цвета в нижний пищевод 1/25 и кольцо Шацки 1/25. Биопсия желудка выявила H. pylori у пяти пациентов (один в контрольной группе, четыре в основной).Биопсия двенадцатиперстной кишки не выявила признаков притупления литников или ворсинок.

    Экстракция бактериальной ДНК

    Для очистки ДНК использовали мини-набор Pathogen QIAamp UCP (ультрачистое производство) от Qiagen. Что касается слюны, то хранимый образец размораживали, осаждали равным объемом изопропанола и центрифугировали при 4000 об / мин. Осадок ресуспендировали в 1 мл содержащего гуанидин буфера для лизиса QIAamp в 1,5 мл пробирке для микроцентрифугирования с завинчивающейся крышкой, содержащей стеклянные шарики, как описано в наборе.Для щеток буфер для лизиса QIAamp добавляли непосредственно в щетку и инкубировали при 50 ° C в течение 15 минут, затем встряхивали для диспергирования слизистой оболочки и бактерий. Лизат переносили пипеткой в ​​свежую пробирку с завинчивающейся крышкой со стеклянными шариками. После этого все образцы обрабатывались одинаково. Для перемешивания стеклянных шариков использовали диск платформы с 24 пробирками Mo Bio Adapter, прикрепленный к вортексеру Fisher. Перемешивание осуществляли на максимальной скорости вихревого устройства в течение 30 мин при комнатной температуре. Последующие шаги были такими, как описано в наборе.Очищенную человеческую и микробную ДНК элюировали из спин-колонки со стекловолоконным фильтром в конечном объеме 50 мкл 0,2 мМ EDTA, pH 8,0, и хранили при -20 ° C.

    Подготовка библиотеки Illumina и секвенирование 16S рРНК

    Относительно небольшие количества бактерий слизистой оболочки были обнаружены в образцах щеток. Для оптимизации библиотек 5 мкл всех очищенных образцов ДНК подвергали преамплификации с высокой строгостью следующим образом. ПЦР с высокой точностью использовала универсальные праймеры для получения амплимеров размером примерно 930 п.н., которые содержали вариабельные области с V1 по V5 гена 16S рРНК.V1a-for: AGAGTTTGATCATGGCTCAGATTGAACGCT, V1b-for: AGAGTTTGATCCTGGCTCAGGATGAACGCT, V5-rev: TTGTGCGGGCCCCCGTCAATTCHTTTGAGTTT.

    Каждая реакционная смесь 50 мкл содержала 0,5 мкМ V1a-for, 0,5 мкМ V1b-for и 1,0 мкМ обратного праймера V5-rev в стандартной 50 мкл реакции с ДНК-полимеразой Phusion Hot-Start (New England Biolabs, Ипсвич, Массачусетс, США). Цикл температуры: 8 мин при 96 ° C для активации полимеразы, затем 25 циклов по 20 с при 96 ° C, отжиг при 65 ° C в течение 20 с и удлинение при 72 ° C в течение 1 мин, завершение через 5 мин 72 ° C, наконец, выдержка при 4 ° C.ДНК для каждой завершенной реакции ПЦР очищали с использованием системы очистки WizardDNA (Promega, Мэдисон, Висконсин, США) и элюировали со спин-колонки в конечном объеме 50 мкл 0,2 мМ EDTA. Последующая подготовка библиотеки следовала стандартным процедурам Illumina, основанным на амплификации интервала гена V3-V4 16S рРНК ~ 460 п.н. в пределах преамплифицированных последовательностей V1-V5 ~ 930 п.н. Праймерами ампликона Illumina V3-V4 были: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG и GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC.Универсальные гомологичные последовательности 3'-конца 16S выделены жирным шрифтом. 5'-конец этих праймеров ампликона содержал стандартные адаптеры для секвенирования MiSeq. Конструирование библиотеки осуществляли точно так же, как описано ранее 13, в соответствии с инструкциями по подготовке секвенирования Illumina 16S. Вкратце, за 15 циклами ПЦР-амплификации с праймерами Amplicon гена 16S рРНК V3-V4 при температуре отжига 55 ° C с использованием KAPA HiFi HotStart ReadyMix (Sigma) следовали 8 циклов ПЦР с уникальными парами прямого-обратного 96 образцов. Праймеры для штрих-кодирования Illumina Nextera.После измерения выходов дц-ДНК с помощью флуориметра Qubit 2 (Thermo-Fisher) 0,25 мкг ДНК из каждого образца были объединены, чтобы получить 24 мкг библиотеки, которую очистили с помощью WizardDNA Clean-Up. Объединенную библиотеку секвенировали в компании SeqMatic, Фремонт, Калифорния, США, как минимум на 300 п.н. как на прямой, так и на обратной цепях, используя секвенирование парных концов MiSeq. Каждый образец, включая три контроля, давал высококачественную последовательность.

    Обработка последовательности 16S рРНК

    Сырые последовательности обрабатывали с использованием стандартной рабочей процедуры mothur14 с модификациями.Данные были обрезаны и химеры удалены. Каждую последовательность классифицируют с использованием классификатора RDP (Ribosomal Database Project) по базе данных RDP. Весь анализ проводился на уровне филумов и на уровне родов. Для каждой выборки был рассчитан индекс разнообразия Шеннона и измерено попарное расстояние ThetaYC для оценки разнообразия сообществ. Альфа-разнообразие и бета-разнообразие визуализировали с помощью R. Относительные численность каждого образца визуализировали на гистограмме с помощью Phinch.15 Дифференциальное обилие анализировали с помощью линейных измерений размера эффекта (LEfSe).16 Анализ совместной встречаемости был выполнен с использованием MicrobiomeAnalyst.17 Прогностическое функциональное профилирование проводилось с использованием филогенетического исследования сообществ путем реконструкции ненаблюдаемых состояний 18 с подробностями, описанными Hong et al 19.

    Статистический анализ

    Различия в альфа-разнообразии проверяли с помощью критерия суммы рангов Вилкоксона. Значительная кластеризация на графике главного координированного анализа (PCoA) была протестирована с использованием анализа молекулярной дисперсии.20 Анализ совместной встречаемости был проведен на основе корреляции рангов Спирмена.

    Бактериальные культуры

    Образцы кистей двенадцатиперстной кишки от 17 из 25 пациентов, включая 6 контрольных пациентов с ахалазией, были помещены в Центры по контролю и профилактике заболеваний, KV (канамицин ванкомицин) и PEA (агар с фенилэтиловым спиртом), кровяной агар (анэробный ), а также на TSA (триптиказо-соевый агар) с 5% овечьей крови и Levine EMB (эозин-метиленовый синий) (аэробный). Колонии подсчитывали после инкубации и наблюдали гемолитические реакции. Окрашивание по Граму проводили на всех колониях со всех чашек.Каталазный тест проводили на колониях грамположительных кокков. Использовали тест-полоски API Staph, API Coryne, API 20E, API 20NE, Rapid ID32 (BioMerieux, Дарем, Северная Каролина, США).

    Результаты

    Разнообразие микробиоты одинаково для случаев диспепсии и ахалазии

    Для оценки разнообразия микробных сообществ в слюне, желудке и двенадцатиперстной кишке пациентов с диспепсией и ахалазией мы рассчитали индексы разнообразия Шеннона для трех разных места.Никакой разницы в этом параметре не наблюдалось между обеими группами (рисунок 1A).

    Рисунок 1

    Общее разнообразие микробиоты сообщества пациентов с диспепсией и ахалазией в трех местах. (A) Индексы разнообразия Шеннона для микробиоты диспепсии и контроля (CTRL) в слюне, а также в образцах желудка и двенадцатиперстной кишки. (B) Кластеризация PCoA наблюдается в слюне, но не в образцах желудка или двенадцатиперстной кишки. CTRL, контроль; PCoA, принципиальный скоординированный анализ.

    Затем данные были проанализированы для кластеризации с использованием PCoA, сравнивая пациентов с диспепсией и контрольной группой с ахалазией.PCoA показал четкое разделение между пациентами с диспепсией и пациентами с ахалазией в слюне, что было статистически значимым (p = 0,005) (рисунок 1B). Эти результаты предполагают, что, несмотря на такое же разнообразие, состав микробиоты слюны у пациентов с диспепсией отличается от контрольной группы с ахалазией.

    Микробиота верхних отделов ЖКТ различается в случаях диспепсии и ахалазии

    Затем мы проанализировали состав микробиоты в случаях диспепсии и ахалазии.Визуальной группировки не наблюдалось в относительной численности основных филов или родов, когда отдельные образцы отображаются вместе (рис. 2). Не было очевидной общей разницы на уровне филума или рода на трех участках (онлайн-дополнительный рисунок 2).

    Рисунок 2

    Относительная численность отдельных образцов. Гистограмма таксономии, показывающая таксономический состав микробных сообществ для каждого отдельного образца на уровне типа (слева) и по родам (справа). CTRL, контроль.

    Мы использовали LEfSe для определения родов, избыточно представленных в наших двух группах. В слюне у пациентов с диспепсией наблюдалось повышенное присутствие Veilonella, Cohnella, Sporolactobacillus, Propionigenium и Anoxybacter , в то время как в контрольной группе ахалазии наблюдалось повышенное присутствие Scardovia, Brevibacillus, Kinecuscoccus, Phascolariosulphoccus, Prolocolactobacterium, Pscolariosulphoceptostreptostrex , Mycobacterium, Lactonifactor, Trabulsiella, Edwardsiella, Acetobacterium, Parvimonas, Ruminococcus, Aurebacter и Enterorhabdus (рисунок 3A).

    Рисунок 3

    Различно многочисленные роды в (A) слюне, (B) желудке и (C) двенадцатиперстной кишке. Линейный дискриминантный анализ (LDA) в сочетании с анализом измерения размера эффекта (LEfSe), показывающий наиболее дифференциально распространенные роды в образцах диспепсии (зеленый) и контрольных группах ахалазии (красный) на трех участках: слюна, слизистая оболочка желудка и двенадцатиперстной кишки.

    При изучении микробиоты желудка два рода, Pseudoclavibacter и Tannerella , оказались по-разному представлены в образцах, вызывающих диспепсию, в то время как Clostridium, Actinobaculum, Deinococcus, Citricoccus, Pediococcus, Sphingabomonas, Bnorifobactiae , Acetivibrio, Coprococcus, Anoxybacillus, Desulfotomaculum, Anaeroarcus, Serratia и Lactobacillus были увеличены у пациентов с ахалазией (рис. 3B).

    В двенадцатиперстной кишке пациентов с диспепсией было обнаружено более высокое присутствие Rothia, Haemophilus, Eubacterium, Clostridium, Pululanibacillus, Frondihabitans, Cellumonas, Butyvibrio и Pasteurella , в то время как пациенты с ахалазией 92, Geprella, Geprella, и ахалазией имели больше . и Turicibacter (рисунок 3C).

    Не было обнаружено, что какой-либо конкретный род связан с использованием ИПП, полом или диабетом как сопутствующей патологией (данные не показаны).

    Значимые ассоциации родов, выявленные с помощью сетевого анализа

    Затем мы провели сетевой анализ совместного встречаемости бактерий для наиболее распространенных родов на каждом участке.Мы проанализировали верхние роды в слюне и обнаружили, что Veillonella действует как главный узел, который снижает численность различных других анаэробных бактерий (рис. 4A). В области желудка Lactobacillus, , которые были чрезмерно представлены в контрольных группах ахалазии, встречались вместе с Escherichia / Shigella , а также с Lachnospiracea , но подавленные бактерии образуют род Bacillus (рисунок 4B). Rothia была основным узлом в двенадцатиперстной кишке и в значительной степени совпадала с Clostridium, Haemophilus и Actinobacillus (рисунок 4C).

    Рисунок 4

    Значимая ассоциация родов на каждом участке. Сетевой анализ бактериального сосуществования. Коррелированные роды от умеренной до высокой на каждом сайте изображены как связанные узлы. Цвет краев в увеличенном разделе представляет коэффициент корреляции из теста ранговой корреляции Спирмена, где красный цвет означает положительную корреляцию, а синий - отрицательную корреляцию. Каждый узел представляет таксон. Размер узла указывает на относительную численность в группах с диспепсией (оранжевый) и контрольной (зеленый).

    Метаболическое функциональное прогнозирование изменений микробиоты

    Чтобы оценить потенциальное влияние наблюдаемого дисбиоза на метаболические пути микробов, мы исследовали прогнозируемые метагеномы микробных сообществ с использованием анализа LEfSe метаболических путей пациентов с диспепсией и пациентов с ахалазией. Мы определили ряд путей, которые были значительно дифференцированно представлены в каждой группе, за исключением двенадцатиперстной кишки, где не наблюдалось значительной разницы.

    Перепредставленные предсказанные пути в слюне пациентов с диспепсией включали метаболизм пурина, цистеин-метионина, тиамина и азота, биосинтез убихинона, липополисаккарида, тРНК и терпеноидов, а также ферментов, связанных с аминокислотами (рис. 5). С другой стороны, основные категории Киотской энциклопедии генов и геномов для метаболических путей в слюне пациентов с ахалазией показали значительное обогащение функций, связанных с метаболизмом различных сахаридов, а также белков, участвующих в подвижности бактериальных клеток и хемотаксисе.На уровне желудка пациенты с диспепсией предсказывали пути, включающие цикл трикарбоновых кислот, пептидазы, фолдинг белка и связанный с ним процессинг. Пути, идентифицированные для сообществ микроорганизмов желудка при ахалазии, идентифицировали переносчики и белки, участвующие в репликации, рекомбинации и репарации.

    Рисунок 5

    Метаболический потенциал контрольных групп диспепсии и ахалазии. Прогнозирование метаболической функции, связанной с профилями микробиоты. Анализ линейных измерений размера эффекта (LEfSe), выполненный на метаболических функциях, выведенных филогенетическим исследованием сообществ путем реконструкции ненаблюдаемых состояний (PICRUSt), показывает статистически значимое обогащение категорий KEGG (Киотская энциклопедия генов и геномов) в слюне, желудке и двенадцатиперстной кишке.Результаты LEfSe указывают на значимое ранжирование среди групп (значение альфа = 0,05 для факторного критерия Краскала – Уоллиса среди классов). Порог для логарифмической оценки линейного дискриминантного анализа (LDA) составлял 2,0. CTRL, контроль.

    Микробный состав на основе культуры в образцах двенадцатиперстной кишки

    Чтобы охарактеризовать присутствие живых бактерий в двенадцатиперстной кишке обеих групп, подмножество щеточных образцов двенадцатиперстной кишки культивировали на аэробные и анаэробные бактерии. Хотя это и не является статистически значимым, культивирование бактерий показало более высокое количество анаэробных и аэробных бактерий в образцах с ахалазией по сравнению с образцами с диспепсией (рис. 6А).Соотношение анаэробных / аэробных бактерий в обеих группах не показало статистически значимой разницы. Микробный состав в образцах двенадцатиперстной кишки для каждой группы в соответствии с нашим подходом, основанным на культуре, представлен на рисунке 6B.

    Рисунок 6

    Живая двенадцатиперстная бактериальная культура из образцов диспепсии и ахалазии. (A) Среднее и стандартное отклонение анаэробного, аэробного и общего количества бактерий в восьми образцах диспепсии и шести образцах акахалазии. (B) Распределение видов среди бактериальных культур по системе API.

    Обсуждение

    Понимание функциональных расстройств желудочно-кишечного тракта, таких как диспепсия, всегда было сложной задачей для клиницистов, поскольку они характеризуются неструктурной симптоматикой. Было показано, что микробиота тонкого кишечника играет ключевую роль в функции желудочно-кишечного тракта. Мы стремились изучить изменения в бактериальных сообществах пациентов с симптомами со стороны верхних отделов желудочно-кишечного тракта, рассматривая три разных участка: ротовую полость, желудок и двенадцатиперстную кишку, поскольку уже было показано, что пищевод содержит переходную микробиоту между ртом и желудком.21 год

    Микробиота пациентов с идиопатической ахалазией не была охарактеризована. 22 Исследования микробиоты пациентов с мегаэзофагом болезни Чаги продемонстрировали чрезмерный рост Streptococcus .23 Неизвестно, имеет ли это место также и в случае ахалазии. Мы выбрали пациентов с этим заболеванием в качестве суррогатов для здорового контроля, поскольку ахалазия - это нарушение моторики пищевода, которое объясняется потерей кишечных нейронов в гладких мышцах, что приводит к аперистальтике и нарушению расслабления нижнего сфинктера пищевода.Поскольку нет показаний для выполнения EGD у здоровых людей, существует меньше возможностей для применения инвазивных методов сбора микробов для получения нормальных контрольных данных.

    Мы не наблюдали каких-либо существенных различий в микробном разнообразии верхних отделов ЖКТ в целом между случаями диспепсии и ахалазии. Это сильно контрастирует с тем, что происходит в конце желудочно-кишечного тракта, двигаясь от тонкой кишки к прямой кишке.

    Образцы слюны пациентов с диспепсией показали заметное относительное количество Veillonella по сравнению с пациентами с ахалазией.Из нашего сетевого анализа совместного численности мы обнаружили, что Veillonella подавляла численность различных других бактерий на этом участке. Veillonella и Peptostreptococcus являются частью основного микробиома полости рта25, присутствующего в слюне здоровых людей 21, и наряду с Ruminococcus также обнаруживаются в пищеводе26. Scardovia, Bulleida, Mycobacterium, и Parvimonas также часто встречаются. присутствует в полости рта27. Cohnella была изолирована от пациентов, находящихся на гемодиализе, или пациентов с нейтропенией, а другие бактерии, такие как Sporolactobacillus , могут быть нормальными обитателями желудочно-кишечного тракта.Роль клостридиалов, таких как Propionigenium или Anoxybacter , в организме человека неизвестна.

    Два рода бактерий, которые по-разному представлены в слизистой оболочке желудка пациентов с диспепсией, Pseudoclavibacter и Tannerella , также имеют нишу в глотке. Такие виды, как Sphingomonas , присутствующие в контрольной группе с ахалазией, отрицательно коррелируют с гастритом.28 Увеличение количества Lactobacillus и Bifidobacterium в нашей контрольной группе с ахалазией соответствует более низкому содержанию в желудке пациентов с функциональной диспепсией по сравнению с здоровый контроль.7 8

    Мы обнаружили чрезмерную представленность Clostridium в микробиоте желудка контрольной группы с ахалазией, о чем ранее сообщалось у здоровых людей.21 Clostridium также обычно может присутствовать в двенадцатиперстной кишке, 21 29 однако мы также обнаружили Clostridium на более высоких уровнях в двенадцатиперстной кишке пациентов с диспепсией.

    Большинство родов, обнаруженных в образцах двенадцатиперстной кишки, согласуются с другими сообщениями, 10 11 21 24 29 с высоким присутствием Streptococcus, Prevotella, Veillonela и в меньшей степени Haemophilus, Fusobacterium, Lactobacillus , Gemela, и Бутыривибрио .В двенадцатиперстной кишке пациентов с диспепсией также было обнаружено более высокое присутствие Haemophilus , которое наблюдалось в двенадцатиперстной кишке пациентов с глютеновой болезнью 29, и вместе с Butyrivibrio также увеличивалось у лиц с различными симптомами со стороны желудочно-кишечного тракта (10). из Rothia, , что положительно коррелировало с болью в верхней части живота, 28 также наблюдались. Высокое присутствие Rothia в двенадцатиперстной кишке пациентов с диспепсией, в свою очередь, увеличивает численность других бактерий, таких как Clostridium, Haemophilus, и Actinobacillus на этом участке. Rothia и другие бактерии, чрезмерно представленные в двенадцатиперстной кишке наших пациентов с диспепсией, такие как Pasteurella и Butyrivibrio , могут достигать этого участка из полости рта.

    Увеличение относительной численности Streptococcus при одновременном значительном снижении количества Prevotella, Veillonella, Actinomyces, Aptopobium и Leptotrichia было показано в слизистой оболочке двенадцатиперстной кишки пациентов с функциональной диспепсией по сравнению с с элементами управления.11 12 Мы не обнаружили таких различий в нашем исследовании, но аналогично тому, что было зарегистрировано в двенадцатиперстной кишке пациентов с симптомами желудочно-кишечного тракта, мы наблюдали возникновение орального сдвига, 10 с присутствием различных родов, которые обычно встречаются в оральной кишке. и на уровне желудка, например Scardovia, Bifidobacterium и Lactobacillus .

    Микробиота влияет на физиологию и метаболические функции хозяина, способствуя нормальному развитию и гомеостазу иммунной системы в кишечнике, модулируя пролиферацию эпителиальных клеток и защищая от патогенных бактерий.30 Различные бактерии обогащены оперонами, содержащими гены для различных метаболических функций. 31 Что касается функционального вклада профилей микробиоты, мы наблюдали отличительные функциональные приобретения между пациентами с диспепсией и пациентами с ахалазией. Метаболические пути для метаболизма аминокислот и нуклеотидов, а также биосинтеза грамотрицательного токсина были обогащены слюной пациентов с диспепсией, в то время как контрольные группы ахалазии продемонстрировали ядро ​​метаболических возможностей, связанных с сахаром, наряду с белками, связанными с подвижностью бактериальных клеток и хемотаксисом.Хотя последние могут отражать признаки вирулентности, подвижные комменсальные кишечные бактерии, которые не являются инвазивными, действительно существуют32.

    На состав бактериальных сообществ двенадцатиперстной кишки влияет pH. Более высокая концентрация Streptococcus в двенадцатиперстной кишке, наблюдаемая при диспепсии11, положительно коррелирует с более высоким pH, в то время как анаэробы, такие как Prevotella и Pasteurellaceae , показали отрицательную корреляцию.33 Хотя метаболический функциональный прогноз не обнаружил никакой разницы между двенадцатиперстной кишкой В контрольных выборках пациентов с диспепсией и ахалазией анаэробный метаболизм отличался у пациентов с диспепсией желудка.Большое количество Lactobacillus , Clostridium , Bifidobacterium и Coprococcus в контрольной группе с ахалазией может указывать на недостаточную представленность этих родов при диспепсии.34 35 Оказывают ли эти бактерии какое-либо влияние на время опорожнения желудка в двенадцатиперстную кишку, то, что наблюдали с другим родом, таким как Veillonella , неизвестно.36 Мы не обнаружили никаких различий в использовании ИПП между образцами диспепсии и контролями для любого конкретного рода (данные не показаны).

    Таким образом, мы исследовали микробиоту верхних отделов желудочно-кишечного тракта пациентов с диспепсией и сравнили их с контрольной группой ахалазии и обнаружили различия в их составе в трех оцениваемых участках (например, слюна, желудок и двенадцатиперстная кишка). Изменения, наблюдаемые у пациентов с диспепсией, включали увеличение количества Veillonella в слюне, оральное изменение состава микробиоты желудка и, в некоторой степени, в двенадцатиперстной кишке, где наблюдалось значительное изобилие анаэробов.

    Это исследование закладывает основу для дальнейших исследований с использованием больших групп пациентов для классификации важных подгрупп пациентов с диспепсией, включая тех, кто получает ИПП, гастрит, связанный с H. pylori , и задержку опорожнения желудка для преодоления препятствий гетерогенности у этих пациентов. .

    Разница между язвой двенадцатиперстной кишки и язвой желудка

    Язва двенадцатиперстной кишки против язвы желудка

    Из-за множества обстоятельств и факторов окружающей среды мы не можем помочь или избежать желудочно-кишечных проблем.Ежегодно миллионы людей страдают от этой проблемы из-за различных желудочно-кишечных расстройств.

    Одними из наиболее распространенных желудочно-кишечных заболеваний являются язвы двенадцатиперстной кишки и желудка. Язвы двенадцатиперстной кишки отличаются от язв желудка.

    Во-первых, анатомия обоих заболеваний различна. При язве двенадцатиперстной кишки образование язв происходит в двенадцатиперстной кишке. Двенадцатиперстная кишка - это часть тонкого кишечника. Тонкая кишка включает двенадцатиперстную кишку, подвздошную кишку и тощую кишку. При язве желудка возникает язва желудка.

    Как они диагностируются? Гастроэнтерологи или врачи, специализирующиеся на желудочно-кишечном тракте, советуют пациенту пройти эндоскопию. При проведении эндоскопии пациенту вводят седативные препараты. Затем в рот вводится тонкая трубка с камерой, которая продвигается либо к двенадцатиперстной кишке, либо к желудку. Когда врач видит язву, он может подтвердить, что это язва.

    Каковы причины? Язва желудка в первую очередь вызывается бактерией H. Pylori. Он также вызывает язву двенадцатиперстной кишки.Использование противовоспалительных препаратов и средств против кровотечения также может вызвать образование язв. Курение и ожирение также вызывают образование язв.

    Какие симптомы? Оба типа язвы вызывают боль, особенно боль в желудке, поднимающуюся до пищевода. Однако при язве желудка боль нельзя уменьшить, употребляя пищу. При язве двенадцатиперстной кишки можно избавиться от еды. При язве двенадцатиперстной кишки наблюдается кровотечение из стула, называемое мелена. При язве желудка кровь при рвоте называется гематемезисом.При язве желудка боль возникает через 1-2 часа после еды. При язве двенадцатиперстной кишки боль возникает через 3-4 часа после еды.

    При лечении обеих язв используются антибиотики, снижающие количество бактерий H. pylori. Примерами их являются амоксициллин, кларитромицин и тетрациклин. В случае гиперсекреции кислоты назначают антациды, такие как Zantac, для нейтрализации кислотности желудка. При язве желудка пациентам рекомендуется избегать продуктов, вызывающих повышенную кислотность и раздражение, например, острой пищи; сливочные и молочные продукты, такие как молоко, сыр и мороженое.Также следует избегать шоколадных конфет и кофе. При язве двенадцатиперстной кишки не требуется специальной диеты. Однако есть данные о том, что алкоголь может усугубить язву двенадцатиперстной кишки. Поэтому, чтобы избежать этого явления, они советуют людям отказаться от алкоголя.

    Резюме:

    1.

    Язвы желудка возникают в желудке, а язвы двенадцатиперстной кишки - в двенадцатиперстной кишке.
    2.

    Язвы желудка вызывают боль в желудке через 1-2 часа после еды. Язвы двенадцатиперстной кишки вызывают боль через 3-4 часа.
    3.

    Боль при язве желудка нельзя уменьшить с помощью еды. Боль в желудке при язве двенадцатиперстной кишки можно облегчить после еды.
    4.

    Язвы желудка вызывают гематемезис или рвоту кровью, а язвы двенадцатиперстной кишки вызывают мелену или кровь в стуле.
    5.

    При язве желудка требуется специальная диета, а при язве двенадцатиперстной кишки - нет.


    : Если вам понравилась эта статья или наш сайт. Пожалуйста, расскажите об этом. Поделитесь им с друзьями / семьей.

    Cite
    APA 7
    J, J. (2011, 29 марта). Разница между язвой двенадцатиперстной кишки и язвой желудка. Разница между похожими терминами и объектами. http://www.differencebetween.net/science/health/difference-between-a-duodenal-ulcer-and-gastric-ulcer/.
    MLA 8
    J, Джошуа. «Разница между язвой двенадцатиперстной кишки и язвой желудка». Разница между похожими терминами и объектами, 29 марта 2011 г., http: // www.разница между.net/science/health/difference-between-a-duodenal-ulcer-and-gastric-ulcer/.

    Пептические язвы - MyDr.com.au

    Что такое язвенная болезнь?

    Язвенная болезнь - это поражение или язва на защитной оболочке желудка (где это называется язвой желудка) или двенадцатиперстной кишки. Врачи часто определяют это как разрыв слизистой оболочки желудка или двенадцатиперстной кишки более 3-5 мм с видимой глубиной.

    Пептические язвы - обычное заболевание - раньше они поражали мужчин больше, чем женщин, но теперь их встречаемость у мужчин и женщин одинакова.

    Симптомы

    Язвенная болезнь не всегда вызывает признаки или симптомы, но некоторые из симптомов язвенной болезни включают:

    • Боль в верхней части живота . Обычный симптом язвы - боль в верхней части живота чуть ниже грудины. Часто это жгучая или «похожая на нож» боль, проникающая в спину. Боль обычно возникает, когда желудок пуст (через несколько часов после еды), и часто будит больного в 2 или 3 часа ночи.Боль часто облегчается приемом пищи или антацидными препаратами.
    • Изжога Может возникнуть, хотя чаще это симптом гастроэзофагеального рефлюкса
    • Расстройство желудка .
    • Тошнота (плохое самочувствие).
    • Потеря аппетита .
    • Необъяснимая потеря веса .
    • Анемия может возникнуть из-за кровопотери, которая может происходить медленно. Симптомы анемии включают усталость, одышку при физических нагрузках и бледный цвет кожи.
    • Рвота кровью . Это более серьезный симптом, возникающий при кровотечении из язвы.
    • Кровообращение при дефекации . Также серьезный симптом в результате язвенного кровотечения. Если это происходит, движения приобретают черный, «смолистый» вид.
    • Перфорация . В редких случаях язва может пробить (образовать отверстие) стенку желудка или двенадцатиперстной кишки. Это серьезная неотложная операция, требующая хирургического вмешательства, которая может быть опасной для жизни.

    Факторы риска язвенной болезни

    Язвы - это участки повреждения слизистой оболочки желудка (язва желудка) или верхней части кишечника (язва двенадцатиперстной кишки).

    Два наиболее распространенных фактора риска язвенной болезни - это Helicobacter pylori (бактерия, обитающая в желудке) и длительный прием НПВП (нестероидные противовоспалительные препараты).

    Helicobacter pylori

    Многие люди с язвой заражены инфекцией желудка, вызываемой бактерией, известной как Helicobacter pylori . Инфекция H. pylori особенно важна для развития язв двенадцатиперстной кишки. Бактерии вызывают продолжающееся воспаление слизистой оболочки желудка.

    По оценкам, до 4 из каждых 10 взрослых в мире инфицированы Helicobacter pylori , но не у каждого из них разовьется язва. По оценкам, 30 процентов австралийцев инфицированы, но уровень инфицирования выше среди коренных австралийских общин. Непонятно, почему некоторые люди с H.pylori , по-видимому, устойчивы к развитию язв.

    H. pylori чаще встречается в старших возрастных группах. Заболевание часто передается в детстве, и рост заболеваемости у пожилых людей может отражать условия жизни в более ранние годы, а не возраст.

    НПВП

    Длительное употребление НПВП (нестероидных противовоспалительных препаратов), таких как аспирин, ибупрофен и напроксен, связано с повышенным риском развития язвенной болезни. Это связано с тем, что большинство НПВП связаны с повышенным риском повреждения слизистой оболочки желудочно-кишечного тракта.

    Прочие факторы

    К другим факторам, которые дополнительно могут повысить риск развития пептических язв и затруднить их лечение, относятся курение, алкоголь и стресс.

    Тесты и диагностика

    Ваш терапевт может направить вас к гастроэнтерологу для обследований и лечения, в зависимости от ваших симптомов, возраста и истории болезни.

    Пептические язвы можно диагностировать с помощью эндоскопии, когда гибкая телескопическая трубка вводится через ваш рот в желудок и двенадцатиперстную кишку, позволяя врачу исследовать ткани.Если они обнаруживают язву, они могут взять небольшой образец (биопсию), чтобы проверить наличие бактерий H. pylori .

    Врач, вероятно, также захочет проверить вас на H. pylori - обычно с помощью дыхательного теста. H. pylori также можно проверить с помощью анализа крови или кала .

    Лечение

    Ваш врач, вероятно, порекомендует вам пройти курс эрадикационной терапии H. pylori . Ликвидация H. pylori значительно снижает вероятность рецидива язв и необходимость длительной кислотосупрессивной терапии.Большинство язв хорошо поддаются этой терапии.

    Ликвидация H. pylori принимает форму тройной терапии - ингибитора протонной помпы (эзомепразол) и двух антибиотиков - амоксициллина и кларитромицина - принимаемых в течение недели. Примерами торговых марок тройной терапии являются эзомепразол Sandoz Hp7 и Nexium Hp7.

    Ингибитор протонной помпы подавляет выработку кислоты в желудке и способствует заживлению.

    Существуют альтернативные лекарства для людей с аллергией на пенициллин.

    Тройная терапия излечивает наиболее активные пептические язвы и уничтожает H. pylori в 70–80% случаев. Некоторые более сложные язвы также потребуют короткого поддерживающего курса ингибитора протонной помпы до тех пор, пока не будет подтверждено заживление язвы.

    Людям с язвами, вызванными НПВП, в идеале следует прекратить прием НПВП (по рекомендации врача). Если это невозможно, им может потребоваться длительный прием ингибитора протонной помпы, чтобы подавить избыточное производство кислоты в желудке.

    Людям, чьи язвы связаны с H. pylori , также следует по возможности прекратить прием НПВП. Но всегда посоветуйтесь с врачом.

    Очень редко пептические язвы вызывают осложнения, и для остановки кровотечения необходимо хирургическое вмешательство.

    Что делать при симптомах язвы?

    Если у вас есть симптомы, указывающие на язвенную болезнь, обратитесь к врачу.

    Это распространенное заболевание легко поддается лечению, и серьезные осложнения обычно можно предотвратить.

    1. Терапевтические рекомендации (eTG). Helicobacter pylori и язвенная болезнь. В: Рекомендации по гастроэнтерологии [обновлено 2006 г., сен; по состоянию на 2 октября 2009 г.]. Доступно по адресу: http://www.etg.hcn.net.au/
    2. Форд А., МакНалти С., Делани Б., Моайеди П. Инфекция Helicobacter pylori. BMJ Clinical Evidence 2007; 06: 406

    Уникальная картина перфорированной язвы двенадцатиперстной кишки у женщины в послеродовом периоде: клинический случай | Журнал хирургических историй болезни

    Аннотация

    Болезнь желчного пузыря и язвенная болезнь (ЯБ) могут проявляться очень похоже, и неправильный диагноз часто может быть результатом противоречивых симптомов.ЯБП при беременности встречается относительно редко, отчасти из-за изменений уровня эстрогена и прогестерона. Мы представляем случай послеродовой женщины на 5-й день после операции с признаками / симптомами, физическим осмотром и лабораторными работами, соответствующими острому холециститу, у которого во время операции была обнаружена перфорированная язва двенадцатиперстной кишки. Авторы предполагают, что свищ стал результатом продолжающегося заболевания. Желчно-кишечные свищи часто могут образовываться из-за продолжающегося холелитиаза. Холецистодуоденальные свищи (CDF) - самые распространенные свищи.Возможно, что частота образования CDF, вторичного по отношению к перфорированной язве двенадцатиперстной кишки, недооценена из-за признаков и симптомов, которые не проявляются до тех пор, пока не будет диагностирована желчная кишечная непроходимость.

    ВВЕДЕНИЕ

    Представленный случай уникален тем, что был поставлен неправильный диагноз холецистита у женщины через 5 дней после родов с прободной язвой двенадцатиперстной кишки. Перфорированный сегмент двенадцатиперстной кишки прикрепился к желчному пузырю, эффективно «залатывая» перфорацию.Стенка желчного пузыря показала признаки эрозии, указывающие на ранние фазы формирования холецистодуоденальной фистулы (CDF).

    ДЕЛО

    34-летняя женщина с G2P3 после операции на 5-й день после кесарева сечения обратилась в отделение неотложной помощи нашего учреждения с основной жалобой на боль в правом верхнем квадранте живота (RUQ). Пациент описал боль в RUQ после кесарева сечения, усиливающуюся после еды. Боль резко усилилась за 24 ч до прибытия. Он не излучал и не был похож на боль, которую она испытывала в прошлом.Она приписала усиливающуюся боль газу; однако это не разрешилось. Ночью перед прибытием у нее начались тошнота и рвота из-за невозможности перорального приема. Она обратилась в связи с ухудшением симптомов. У нее нет серьезной истории болезни в прошлом. Ее прошлый хирургический анамнез включает два кесарева сечения и операцию на глазу по методу Лазика. Ее семейный анамнез не связан с настоящим заболеванием. У нее аллергия на сульфамид, она не курит и не пьет.

    По прибытии показатели жизненно важных функций были в пределах нормы.При физикальном осмотре (PE) у нее была локализованная болезненность в области RUQ и эпигастрия с легким вздутием живота. У нее не было ни отскока, ни защиты. Знак Мерфи был положительным. Признаков перитонита нет.

    Гематологическая панель показала WBC только 7,6, H&H 9,0 и 28,9 соответственно. BMP был значимым только для калия 3,4, все остальные значения были нормальными. Пациенту было проведено ультразвуковое исследование RUQ, показавшее утолщение стенки желчного пузыря на 4,5 мм, небольшое количество перихоле-кистозной жидкости. Камни в желчном пузыре отсутствовали, а общий желчный проток был нормального калибра (рис. 1–3).

    Рисунки 1–3

    Это результаты ультразвукового исследования пациента в отделении неотложной помощи. Стенка желчного пузыря составляла 4,5 мм, присутствовало небольшое количество перихоле-кистозной жидкости. Камни в желчном пузыре отсутствуют, общий желчный проток в пределах нормы.

    Рисунки 1–3

    Это результаты ультразвукового исследования пациента в отделении неотложной помощи. Стенка желчного пузыря составляла 4,5 мм, присутствовало небольшое количество перихоле-кистозной жидкости.Камни в желчном пузыре отсутствуют, общий желчный проток в пределах нормы.

    Диагноз холецистита был поставлен на основании анамнеза, ТЭЛА и результатов ультразвукового исследования, и в тот же день пациент был доставлен в операционную для лапароскопической холецистэктомии.

    Эксплуатация

    Были выполнены все стандартные предоперационные меры, пациент был подготовлен и задрапирован для лапароскопической холецистэктомии. Порты размещались обычным образом для этой операции: 12-миллиметровый троакар Хассона располагался над пупком, а 5-миллиметровые троакары располагались в эпигастрии и RUQ x2.После введения лапароскопа матка в тазу все еще была большой, а в брюшной полости было небольшое количество кровянистой жидкости. Дно желчного пузыря было захвачено и отведено в головной части. С помощью этого маневра оказалось, что двенадцатиперстная кишка срослась с воронкой желчного пузыря. После осторожного отделения двенадцатиперстной кишки от желчного пузыря стало очевидно, что в первой части передней двенадцатиперстной кишки имеется перфорированная двенадцатиперстная кишка, и именно желчный пузырь закрывает перфорацию (рис. 4–6).Желчный пузырь показал признаки эрозии в том месте, где он залатал двенадцатиперстную кишку (рис. 6). В это время мы сначала приступили к лапароскопической холецистэктомии, прежде чем лечить двенадцатиперстную кишку. После успешного завершения холецистэктомии мы выполнили лапароскопический пластырь Грэма с нашими существующими портами, которые можно увидеть на рис. 7. Плоский JP # 10 был вставлен в область пластыря Грэма. Брюшную полость промыли, а затем отсосали. Восстановление было подтверждено помещением под воду со сжатой второй частью двенадцатиперстной кишки, в то время как анестезия производила инсуффляцию желудка / двенадцатиперстной кишки через трубку OG.Пациент перенес операцию хорошо, экстубировал и вышел на выздоровление.

    Рисунок 4

    Полный вид желчного пузыря и двенадцатиперстной кишки.

    Рисунок 4

    Полный вид желчного пузыря и двенадцатиперстной кишки.

    Рисунок 5

    Первый отдел двенадцатиперстной кишки с прободной язвой. Желчный пузырь втянут за пределы кадра.

    Рисунок 5

    Первая часть двенадцатиперстной кишки с прободной язвой.Желчный пузырь втянут за пределы кадра.

    Рисунок 6

    Желчный пузырь был аккуратно резецирован из двенадцатиперстной кишки, обнаружив неперфорированную язву на том месте, где она была зашита язвой двенадцатиперстной кишки.

    Рисунок 6

    Желчный пузырь был аккуратно резецирован из двенадцатиперстной кишки, обнаружив неперфорированную язву на том месте, где она была зашита язвой двенадцатиперстной кишки.

    Рис. 7

    Изображение завершенного лапароскопического пластыря Грэма над перфорацией двенадцатиперстной кишки.

    Рис. 7

    Изображение завершенного лапароскопического пластыря Грэма над перфорацией двенадцатиперстной кишки.

    Послеоперационный курс

    В послеоперационном периоде пациентка поправилась. Она возобновила диету на 2-й день после операции и была выписана на 4-й день после операции. Перед выпиской дренаж был удален, боль была под контролем, она передвигалась без затруднений, выдерживала диету и оставалась афебрильной. В заключительном отчете о патологии желчного пузыря обнаружен хронический холецистит.

    ОБСУЖДЕНИЕ

    В этом случае послеродовая женщина с признаками / симптомами, результатами УЗИ и ТЭЛА, соответствующими острому холециститу, была доставлена ​​в операционную для холецистэктомии. Во время операции мы увидели перфорированную язву двенадцатиперстной кишки, которая была закрыта желчным пузырем. Сам желчный пузырь показал признаки эрозии в том месте, где он контактировал с язвой. Авторы считают, что мы визуализировали надвигающийся CDF.

    Язвенная болезнь (ЯБП) у беременных - относительно редкое явление [1].Диагноз осложняется симптоматикой (тошнота, рвота, боль в эпигастрии), которые распространены на протяжении всей беременности. Другая теория о снижении заболеваемости связана с повышенной секрецией желудочной слизи в результате повышения уровня прогестерона [2]. Также отмечается сокращение интервенционной диагностической эндоскопии у беременных с ЯБД из-за повышенного риска перфорации, инфекции и кровотечения [3]. У нашей пациентки возможно, что ранее существовавшая ЯБД усугубилась через 5 дней непрерывного приема НПВП после кесарева сечения.

    Клинические проявления болезни желчного пузыря и ЯБ очень похожи, однако перфорированные язвы обычно проявляются более серьезными симптомами. Хотя есть сообщения о случаях одновременного холелитиаза / холангита с перфорированной язвой двенадцатиперстной кишки, диагноз часто не сразу ставится из-за слияния симптомов [4]. Желчно-кишечные свищи часто являются результатом патологии хронической желчнокаменной болезни и могут привести к развитию многих типов коммуникаций с желчным пузырем.В частности, CDF представляют собой аномальные связи между желчным пузырем и двенадцатиперстной кишкой и являются наиболее распространенным типом свищей [5].

    Как хирурги, мы видим проявления CDF после того, как она перерастает в желчную кишечную непроходимость. На тот момент уже образовался свищ. Патофизиология образования CDF неясна, однако общепринятое мнение состоит в том, что желчные камни разрушаются через стенку желчного пузыря и образуют свищи с двенадцатиперстной кишкой [6]. Авторы предполагают, что, если бы этого пациента не лечили, свищ образовался бы вторично по отношению к перфорированной язве двенадцатиперстной кишки, а не эрозии желчных камней.Хотя в существующей литературе есть задокументированные сообщения о случаях [6–9], данные о ЯБ как причине CDF очень ограничены. Возможно, что частота образования CDF, вторичного по отношению к перфорированным язвам двенадцатиперстной кишки, недооценивается.

    ЗАЯВЛЕНИЕ О КОНФЛИКТЕ ИНТЕРЕСОВ

    Не объявлено.

    ФИНАНСИРОВАНИЕ

    Нет.

    ССЫЛКИ

    1.

    Essilfie

    P

    ,

    Hussain

    M

    ,

    Bolaji

    I

    .

    Прободная язва двенадцатиперстной кишки во время беременности - редкая причина острой боли в животе во время беременности: клинический случай и обзор литературы

    .

    Case Rep Obstet Gynecol

    2011

    ;

    2011

    : 263016.2.

    Барнс

    LW

    .

    Гистаминаза сыворотки при беременности

    .

    Obstet Gynecol

    1957

    ;

    9

    :

    730

    -

    2

    .3.

    Rosen

    C

    ,

    Abenhaim

    HA

    ,

    Mishkin

    D

    ,

    Czuzoj-Shulman

    N

    .

    Ведение и исходы язвенной болезни у беременных [37C]

    .

    Акушерский гинекол

    2019

    ;

    133

    :

    41S

    .4.

    Rahim

    SEG

    ,

    Alomari

    M

    ,

    Khazaaleh

    S

    ,

    Alomari

    A

    ,

    al Momani

    LA

    .

    Острый реактивный бескаменный холецистит на фоне перфорации язвы двенадцатиперстной кишки

    .

    Cureus

    2019

    ;

    11

    : e4331.5.

    Pulido

    J

    ,

    Garcia-Flores

    G

    ,

    Monterrrubio

    J

    ,

    Caballero

    U

    ,

    Zavala

    L

    ,

    M

    ,

    M .

    Лапароскопическая пластика холецистодуоденальной фистулы ручным швом как трансоперационная находка. История болезни

    .

    Surg Endosc Other Interv Tech

    2014

    . DOI: .6.

    Дхармадхикари

    ND

    ,

    Руссель

    B

    ,

    Piascik

    D

    ,

    Adrain

    AL

    .

    Хроническая язвенная болезнь с проявлением холецистодуоденального свища

    .

    Am J Gastroenterol

    2019

    ;

    114

    :

    S697

    -

    8

    .7.

    Meriam

    S

    ,

    Dorra

    T

    ,

    Asma

    O

    ,

    Hela

    E

    ,

    Dalila

    G

    .

    Билио-пищеварительный свищ, вторичный по отношению к язве двенадцатиперстной кишки

    .

    Press Medicale

    2019

    ;

    48

    :

    473

    .8.

    Topal

    U

    ,

    Savci

    G

    ,

    Sadikoglu

    MY

    ,

    Tuncel

    E

    .

    Холедоходуоденальный свищ, вторичный по отношению к язвенной болезни двенадцатиперстной кишки: история болезни

    .

    Acta Radiol

    1997

    ;

    38

    :

    1007

    -

    9

    .9.

    Chaouch

    MA

    ,

    Nacef

    K

    ,

    Ghannouchi

    M

    ,

    Khalifa

    MB

    ,

    Chaouch

    A

    ,

    ,

    , Abdelka

    Холедоходуоденальный свищ, вызванный язвенной болезнью двенадцатиперстной кишки, диагностированной при исследовании бариевой еды: интерес для лечения

    .

    Pan Afr Med J

    2018

    ;

    29

    :

    177

    .

    Опубликовано Oxford University Press и JSCR Publishing Ltd. Все права защищены. © Автор (ы) 2020.

    Это статья в открытом доступе, распространяемая в соответствии с условиями некоммерческой лицензии Creative Commons Attribution (http: // creativecommons.org / licenses / by-nc / 4.0 /), который разрешает некоммерческое повторное использование, распространение и воспроизведение на любом носителе при условии правильного цитирования оригинальной работы. По вопросам коммерческого повторного использования обращайтесь по адресу journals.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *