Спайки в кишечнике после операции последствия: Спайки брюшной полости: операция как причина и решение проблемы

Содержание

Спайки брюшной полости: операция как причина и решение проблемы

Операция – центральное звено лечения, способ избавиться от болезни и решить проблемы со здоровьем. Однако бывают ситуации, когда именно хирургическое вмешательство вынужденно приводит к возникновению нового недуга. Спаечная болезнь – именно тот случай.

Татьяна Владимировна, жительница Запорожской области, проходила хирургическое лечение в одной из больниц города. После операции женщина надеялась вздохнуть спокойно – наконец-то она избавится от проблемы, которая долго не давала ей жить. Но вместо облегчения после лечения ей стало еще хуже: «У меня началась сильная рвота, сутки я мучилась от ужасной боли в животе». Пациентку срочно перевели в отделение хирургии Запорожской областной больницы, где круглосуточно оказывают ургентную помощь жителям Запорожья и области. Специалисты диагностировали у женщины раннюю спаечную болезнь. Чтобы спасти жизнь пациентке, необходима была срочная операция.

Что такое спайки и чем они опасны?

Органы малого таза и брюшной полости покрыты брюшиной – гладкой оболочкой, благодаря которой они могут свободно двигаться и нормально функционировать. Когда в брюшной полости развивается воспаление, организм сам начинает борьбу с ним: чтобы остановить распространение инфекции, выделяется специальное вещество фибрин, которое «склеивает» оболочки. Так формируются спайки.

Спаечная болезнь может возникнуть из-за травм живота, воспаления, в результате приема некоторых препаратов или врожденных аномалий развития. Но чаще всего спайки образовываются из-за хирургических вмешательств. По статистике, спаечная болезнь – самое распространенное осложнение после полостных операций на брюшной полости.

Нарушая естественную подвижность, спайки мешают нормальной работе внутренних органов, вызывают спазмы связок и мышц. В гинекологии спайки могут перекрывать просвет маточной трубы, вызывая бесплодие. Иногда пациент практически не ощущает дискомфорта, вызванного сращениями, но нередко после операций на внутренних органах возникает острая кишечная непроходимость.

Острая непроходимость кишечника: каждая минута на счету

«Острая кишечная непроходимость — самое тяжелое проявление спаечной болезни. Это жизнеугрожающее состояние, которое требует немедленной медицинской помощи,  а зачастую – и экстренного хирургического вмешательства», – комментирует Тарас Гуров, заведующий отделением хирургии с центром проктологии Запорожской областной больницы.

Острая непроходимость кишечника проявляется острой болью в животе, рвотой, повышением температуры. С такими симптомами в областную больницу и поступила Татьяна Владимировна. Как показала диагностика, после недавней хирургической операции у женщины развилась ранняя спаечная болезнь и острая непроходимость кишечника. Благодаря экстренному хирургическому вмешательству, которое провели хирурги Запорожской облбольницы, сейчас пациентка чувствует себя отлично. «Я сама работаю в реанимации, поэтому не раз сталкивалась с такими экстренными ситуациями. Как медик, я знаю, как много в таких случаях зависит от опыта хирургов. Я очень благодарна специалистам областной больницы за квалифицированную помощь, замечательное отношение. Я выписываюсь домой другим человеком – и это полностью их заслуга!», – делится Татьяна Владимировна.

Кишечные спайки:Причины образования кишечных спаек,Распространенность заболевания,Диагностика и лечение спаечной болезни

Причины образования кишечных спаек

Кишечные спайки могут образовываться из-за травм живота и органов брюшной полости. Между моментом травмы и процессом формирования спаек может пройти значительный временной промежуток. Кроме того, формирование спаек кишечника может быть обусловлено хирургическим вмешательством (различными операциями на органах брюшной полости). Одной из причин образования спаек в кишечнике является операция кесарева сечения. Также спайки могут быть вызванными хронической инфекцией или воспалительными процессами в организме.

Распространенность заболевания

Кишечные спайки возникают у людей, которые генетически предрасположены к такому заболеванию. В их организме содержится избыточное количество специфических ферментов. В группу риска входят также те люди, которые перенесли операции на органах брюшной полости.

Симптомы образования кишечных спаек

К основным симптомам кишечных спаек можно отнести:

  • болевые ощущения в области кишечника. Боль может быть ноющей, схваткообразной и сильной;
  • боль может усиливаться после приема пищи или физической нагрузки;
  • запоры;
  • рвота;
  • тошнота;
  • вздутие живота после приема пищи;
  • непроходимость кишечника;
  • резкая потеря веса.

Диагностика и лечение спаечной болезни

Диагностика спаечной болезни предусматривает тщательный общий осмотр, ультразвуковое исследование брюшной полости, кишечника, матки, яичников. Также, проводится пальцевое исследование прямой кишки и внешний осмотр на наличие рубцов после хирургических вмешательств. Наиболее точным исследованием на предмет наличия спаечной болезни является рентгенография брюшной полости.

При диагностике спаечной болезни пациенту требуется прохождение длительного курса терапии, которое может осуществляться как амбулаторно, так и в стационаре. При начальной стадии возможно проведение лечения без хирургического вмешательства. Также, используется специальная диета. При тяжелой форме заболевания необходима операция, в ходе которой рассекаются спайки. Существует два вида операций: открытая и лапароскопическая. Открытая операция проводится через большой разрез.

Если вы чувствуете резкую боль в области кишечника или любые другие симптомы спаечной болезни, вам незамедлительно необходимо обратиться за помощью к хирургу. Записаться к лучшим специалистам вы можете с помощью сервиса Doc.ua.

На онлан-хабе Doc.ua теперь доступна возможность выбора и брони сертифицированных лекарственных препаратов по наиболее выгодным ценам. 

Как избежать развития осложнений после операций?

Один из видов осложнений после оперативных вмешательств — развитие послеоперационного спаечного процесса. О возможности формирования послеоперационных спаек известно с момента зарождения хирургии, но поначалу этому вопросу не уделяли достаточного внимания, поскольку акцент делался на проблеме инфекционных осложнений и выживания пациентов. В 70-е годы прошлого столетия в связи с бурным развитием гинекологической эндокринологии на первый план вышли проблемы бесплодия, начала развиваться хирургия в данной сфере, и вопрос предотвращения формирования послеоперационных спаек стал весьма актуальным.

В ЧЕМ СУТЬ ПРОБЛЕМЫ?

Первые сведения о спаечной болезни и ее осложнениях относятся к концу XIX в. В 1872 г. Томас Браянт (Thomas Bryant), английский хирург, описал случай острой кишечной непроходимости, развившейся на фоне спаечного процесса после удаления опухоли яичника.

Спаечная болезнь — явление образования послеоперационных спаек с выраженным симптомокомплексом нарушения функционирования органов желудочно-кишечного тракта. Основными клинически значимыми последствиями развития данной патологии являются кишечная непроходимость, хроническая боль в брюшной полости и тазе, бесплодие.

Спайки служат наиболее частой причиной непроходимости толстой и тонкой кишки, вызывая примерно от 1/3 до 1/2 всех случаев непроходимости кишечника и 60–70% — непроходимости тонкой кишки (Матвеев Н.Л., Друтюнян Д.Ю., 2007). Кроме этого, данный процесс увеличивает продолжительность течения каждого следующего оперативного вмешательства и риск развития повреждения кишок (Степанян С.А., 2010). Частота образования спаек варьирует от 67 до 93% после хирургических абдоминальных операций и составляет почти 97% случаев после проведения открытых гинекологических вмешательств. В современной абдоминальной хирургии проблема возникновения данной патологии не утрачивает своей актуальности (Бойко В.В. и соавт., 2014).

Формирование спаек между травмированными поверхностями часто рассматривают как локальный процесс, то есть, как воспалительную реакцию, экссудацию и отложение фибрина с последующими фибринолизом и заживлением. Если процесс заживления замедлен вследствие инфицирования либо присутствуют инородные тела, например, шовный материал, начинаются процессы пролиферации клеток и новообразования сосудов, формируются спайки.

Основополагающим аспектом в данной теории является представление о том, что без отложения фибрина между раневыми поверхностями спайки не образуются (Koninckx P. R. et al., 2009).

ЕСТЬ ЛИ ВЫХОД ИЗ СИТУАЦИИ?

Потребность в предупреждении развития послеоперационных спаек очевидна. Основные подходы к профилактике включают соответствующую хирургическую технику с ограничением травмы внутрибрюшных структур и применение вспомогательных средств, уменьшающих спайкообразование. Эти средства подразделяются на 2 категории: продукты, нарушающие спайкообразующий воспалительный каскад, и продукты, разделяющие раневые поверхности на ранней стадии их заживления.

В разное время для прерывания воспалительного каскада в брюшной полости применяли нестероидные противовоспалительные препараты, глюкокортикоидную и антигистаминную терапию, прогестерон/эстрогенные препараты, антикоагулянты, фибринолитики, антибиотики. Однако отсутствие эффекта или негативное системное действие этих лекарственных средств привели к отказу от их применения для профилактики спайкообразования (Матвеев Н.

Л. и соавт., 2008).

Отделение поврежденной зоны — один из основных методов предотвращения образования спаек. В последние десятилетия большой интерес вызывают так называемые противоспаечные (антиадгезивные) барьеры, применяемые для предотвращения соприкосновения и слипания раневых поверхностей, а также спайкообразования между поврежденными органами. Они создают гидрофлотацию (разделение внутренних органов с помощью жидкостного барьера) или, фиксируясь на поврежденных поверхностях, разделяют их и предотвращают образование спаек между ними (Степанян С.А., 2010).

Таким образом, противоспаечные барьеры делятся на 2 основные категории: кристаллоиды и макромолекулярные растворы (например гиалуроновая кислота и средства на ее основе), а также механические барьеры. В последние годы барьеры обеих категорий продемонстрировали реальный прогресс в профилактике формирования спаек.

Идеальный противоспаечный барьер, кроме эффективности и наличия благоприятного профиля безопасности, не должен вызывать развития воспалительной и иммунной реакции, сохраняться в брюшной полости, пока не регенерирует новый мезотелиальный слой, удерживаться на месте без швов и скрепок, оставаться активным в присутствии крови и быть полностью биодеградируемым. Он не должен нарушать заживление, провоцировать развитие инфекционного процесса и вызывать образование спаек (Матвеев Н.Л. и соавт., 2008).

ДЕВИСКАР: ПОСТАВЬ БАРЬЕР НА ПУТИ ОБРАЗОВАНИЯ СПАЕК

Применение противоспаечных барьеров наряду с улучшением хирургической техники является перспективным методом предупреждения образования спаек. Одним из первых барьеров, используемых для профилактики этого процесса, был клей на основе целлюлозы и/или коллагена, который использовался не только для достижения гемостаза, но и улучшения заживления (Попов А.А. и соавт., 2012). Однако с тех пор были разработаны более перспективные средства.

Особого внимание заслуживают противоспаечные (антиадгезивные) барьеры на основе гиалуроновой кислоты. Гиалуроновая кислота представляет собой естественно образующийся гликозаминогликан — основной компонент внеклеточного вещества соединительной ткани. Она биосовместима, неиммуногенна, нетоксична и естественно биоабсорбируема. Гиалуроновая кислота отрицательно заряжена при физиологических значениях рН и легкорастворима.

Она покрывает серозные поверхности и обеспечивает определенную защиту от высыхания и других типов повреждения серозной оболочки (Матвеев Н.Л., Друтюнян Д.Ю., 2007).

Ярким примером противоспаечного (антиадгезивного) барьера является гель медицинский ДЕВИСКАР — прозрачный вязкоэластичный стерильный раствор по 10 мг в 1 мл раствора в шприцах объемом 2,5 мл или 20 мл.

В его состав входит высокоочищенный гиалуронат натрия, разведенный в физиологическом растворе. Данное медицинское изделие на украинском фармацевтическом рынке представляет компания «Zdravo».

Гель действует как временный (медленно рассасывается в течение 148 ч) барьер между поврежденными поверхностями, обеспечивая их эффективное разделение на время заживления. Способствует уменьшению слипания поверхностей органов и тканей, сохранению их подвижности и препятствует образованию спаек.

ДЕВИСКАР может применяться при любых операциях для предотвращения или снижения риска возникновения послеоперационного спаечного процесса.

Для этого до окончания операции, соблюдая правила асептики, необходимо распределить гель, который находится в шприце, тонким равномерным слоем на поверхности обрабатываемых органов в местах риска возникновения послеоперационных спаек. Доза и количество введенного геля зависит от области применения и определяется индивидуально лечащим врачом.

Стоит подчеркнуть, что введение геля должно осуществляться в условиях строгой стерильности. Содержимое шприца следует применить сразу после вскрытия упаковки. Медицинское изделие предназначено для одноразового использования.

Применение антиадгезивного медицинского геля ДЕВИСКАР поможет избежать проблем после операционного вмешательства и предупредить образование спаек.

Подробнее о медицинском геле ДЕВИСКАР можно узнать на сайте: deviscar.in.ua.

Пресс-служба «Еженедельника АПТЕКА»

Цікава інформація для Вас:

Лечение спаек остеопатией без операции – отзывы пациенток, СПб, МЦ Мудрый Доктор

Миллионы людей по всему миру хотя бы раз в жизни оказывались на операционном столе. Как правило, операции – и плановые, и экстренные – проходят успешно, и по истечении периода реабилитации человек возвращается к ведению привычного образа жизни. Тем не менее, врачи-остеопаты отмечают, что любое хирургическое вмешательство – даже если оно было произведено лапароскопическим методом – может негативно сказаться на функционировании внутренних органов в случае развития у пациента спаечного процесса.

Спайки после операции на органах брюшной полости – после аппендицита, операции на кишечнике, удаления матки и других хирургических вмешательств в сфере гинекологии – а также после операций на позвоночнике являются одним из распространенных осложнений. Как показывает практика, именно в первое время после хирургического вмешательства проще всего предотвратить развитие спаечного процесса, а также устранить уже сформировавшиеся спайки.

В первые недели и месяцы после операции лечение спаек остеопатией особенно эффективно! Обычно для этого достаточно одного-двух сеансов у остеопата.

Спайки после операции – механизм формирования

Внутренние органы человека покрывает тонкая полупрозрачная пленка – серозная оболочка. Внутри живота это так называемая брюшина, выстилающая снаружи органы малого таза, желудок и кишечник, в полости грудной клетки это покрывающая легкие плевра. У здорового человека листки серозных оболочек подвижны – мягко скользя, они тем самым дают органам возможность функционировать полноценно.

Тем не менее, механическое повреждение внутренних органов – в том числе, иссечение их частей в ходе операции – или воспалительный процесс способны стать причиной повреждения данных серозных оболочек. В стремлении восстановить их целостность организм начинает замещать поврежденный участок пленки соединительнотканными волокнами, которые стягивают между собой листки серозных оболочек, препятствуя их скольжению друг относительно друга и образуя неэластичные перетяжки. Именно эти перетяжки специалисты и называют спайками.

Что касается внутренних органов, то у них есть собственные связки – гибкие, эластичные, помогающие органам удерживаться на месте и в то же время обеспечивающие должный уровень их физиологической подвижности. Травмы и некоторые заболевания способны стать причиной деформации этих связок – их утолщения, неравномерного распределения плотности по составляющей их ткани и срастания фрагментов связок с органами. Подобные нарушения провоцируют смещение внутренних органов, а также к появлению во внутрибрюшном и/или плевральном пространстве так называемых зон избыточного напряжения. Так, удерживающие желудок связки в патологически натянутом состоянии способны стать причиной появления у пациента болей в области спины. Со временем спаечный процесс может разрастаться, образуя протяженные цепочки неэластичного соединения органов, тканей и связок. И подобная цепочка, направленная, например, от желчного пузыря через печень и диафрагму в область сердца, может спровоцировать появление у человека болей в груди. При этом назначенное кардиологом лечение будет малоэффективным или совсем бесполезным, ведь причиной появления болей в данном случае будет именно проведенное на желчном пузыре несколько лет назад хирургическое вмешательство!

Так, спайки в области малого таза могут образоваться вследствие проведенной операции – аборта, удаления матки или маточной трубы и т. д., а также вследствие воспаления. Выраженным воспалительным процессом могут сопровождаться в том числе такие гинекологические заболевания, как эндометриоз, воспаление придатков, аденомиоз и т.д.

Причины развития спаечного процесса

Основными факторами, провоцирующими образование спаек, являются:

  • воспалительный процесс. И сам процесс, и присоединение к нему бактериального заражения, способны стать причиной повреждения обволакивающих внутренние органы серозных оболочек. Примером может являться развитие спаечного процесса в груди вследствие плеврита, а в брюшной полости – вследствие перитонита;
  • проведенные хирургические вмешательства. И лазер, и скальпель, и радиоволны неизбежно повреждают серозные оболочки внутренних органов, что может стать причиной формирования после операции фиброзных спаек;
  • травмы. Повреждение серозных оболочек в этом случае также способно спровоцировать развитие спаечного процесса;
  • наконец, в ряде случаев спаечный процесс активизируется в отсутствие каких-либо видимых причин. Врачи полагают, что это следствие неблагоприятной в этом смысле наследственности.

Спайки после операции: симптомы

Симптоматика обусловлена тем, какие именно органы вовлечены в патологический процесс. Так, наличие спаек в плевральной полости провоцирует у пациента частые простудные заболевания и/или одышку, которая, в свою очередь, способна значительно снизить его работоспособность, усиливая утомляемость. Другие симптомы спаечного процесса в груди – это боли и давление в области сердца, а также постоянный кашель, медикаментозное лечение которого малоэффективно.

В отсутствие своевременной диагностики и лечения спайки кишечника могут стать причиной грубой деформации его петель, затруднения прохождения через них полупереваренной пищи, проблем с всасыванием стенками кишечника питательных веществ и как следствие – ее постепенным атрофическим изменениям, а в наиболее запущенных случаях даже привести к некрозу части кишечной стенки. Спайки кишечника могут спровоцировать появление у пациента следующих симптомов:

  • спастические боли в животе, которые могут иметь различную интенсивность, и, как правило, становятся более выраженными в момент физической активности или несоблюдении диеты;
  • запоры – следствие деформации кишечных петель;
  • нарушения стула;
  • вздутие живота, метеоризм;
  • нарушение всасывания питательных веществ кишечной стенкой может стать причиной стремительной потери веса пациентом.

Встречается и бессимптомное течение патологии. Тем не менее, можно быть абсолютно уверенным, что если у пациента когда-либо была операция на органах брюшной полости, то в ней гарантированно имеются спайки.

Если говорить о локализованных в области малого таза спайках, то они проявляются прежде всего болезненностью при пальпации. Боль может быть от едва ощутимой до практически нестерпимой – последняя обычно свидетельствует об остром течении патологии. Кроме того, пациент может жаловаться на тошноту, рвоту, нарушения стула. Наконец, у женщин спайки в области малого таза могут стать причиной нарушения менструального цикла, болезненности при половом акте и даже бесплодия.

Лечение спаек у остеопата

Уникальная возможность организма самостоятельно компенсировать различные нарушения его функционирования позволяет ему до определенного момента сохранять серозные оболочки взаимно подвижными, а связки – эластичными. Тем не менее, утрата их функциональных характеристик способна привести к нарушению подвижности внутренних органов.

Лечение спаек без операции методом остеопатии, по отзывам пациентов врачей-остеопатов нашего медицинского центра в Санкт-Петербурге, является высокоэффективным методом, позволяющим буквально за несколько сеансов избавиться от дискомфорта и боли. Это щадящая методика, которая не имеет побочных эффектов и может применяться для пациентов любого возраста и любого состояния здоровья, позволяющая без операции восстановить подвижность и нормальное функционирование внутренних органов.

В ходе сеанса остеопат оказывает бережное воздействие на внутренние органы пациента, тем самым восстанавливая их нормальное положение друг относительно друга и подвижность, одновременно с этим освобождая защемленные нервы и кровеносные сосуды. Подобное мануальное воздействие стимулирует работу внутренних органов, благоприятно сказываясь на их состоянии и стимулируя восстановление целостности покрывающей их поверхность серозной оболочки. Это не только устраняет патологическое натяжение связок, но также и способствует предотвращению развития у пациентов других заболеваний – следствий наличия в теле участков перенапряжения.

Попутно специалист восстанавливает нормальный лимфоток и кровообращение, а также нормализует мышечный тонус. При этом устраняется как атония, так и гипертонус мышц, в том числе и тех, которые входят в структуру внутренних органов.

Практически при любой степени патологического процесса лечение спаек у врача-остеопата позволяет добиться стойкого положительного результата. Разумеется, устранить застарелые спайки без операции не представляется возможным; тем не менее, специалист может восстановить нормальную подвижность и функционирование даже внутреннего органа со спайками.

Использование жидкостей и фармакологических средств (лекарственных препаратов) для профилактики спаечной болезни (тканевых рубцов) после операций в области таза женщин

Обзор вопроса: В этом систематическом обзоре Кокрейн была проведена оценка вех жидкостей и фармакологических средств, используемых для профилактики образования спаек после гинекологических операций (гели были определены как жидкие средства).

Актуальность: Спайки это внутренняя рубцовая ткань, которая может формироваться в процессе восстановления организма после операции. Их появление также может быть вызвано инфекциями таза и эндометриозом. Спайки склеивают вместе ткани и органы, которые обычно не соприкасаются. Спайки обычно возникают после гинекологических операций, и могут вызывать боль в области таза, бесплодие и закупорку кишечника. Женщинам со спайками может потребоваться дальнейшая более сложная операция, что может привести к дополнительным осложнениям. Жидкости вводят во время операции в полость малого таза (в котором находятся все женские репродуктивные органы), и это предотвращает физический контакт заживающих тканей. Эти жидкости можно разделить на гидрофлотационные средства и гели. Гидрофлотационные средства это жидкости, которые помещают в полость малого таза в больших объемах (обычно около литра), гели наносят непосредственно в область хирургического вмешательства. Фармакологические средства действуют путем изменения этапов процесса заживления.

Характеристики исследований В этот обзор мы включили 29 рандомизированных контролируемых испытаний (3227 участников). Результаты 18 испытаний из них были объединены (2740 участников). Результаты оставшихся 11 исследований не могли быть использованы в мета-анализе, потому что исследователи не применяли метод измерения спаек, который позволил бы объединить их результаты с другими данными, или потому, что в них не сообщалось важной статистической информации. Мы провели последний поиск доказательств по апрель 2014 года.

Основные результаты: Только в одном исследовании провели оценку боли в области таза, и не было представлено доказательств того, что существует разница между средствами для предотвращения спаек. Не существует доказательств, что какое-либо из исследованных средств повлияло на частоту живорождения. Если говорить о спайках, то, у участниц, которым применяли жидкие средства во время операции, вероятность образования спаек была меньше, чем у участниц, которые не получили жидкого средства. Когда жидкости и гели сравнивали друг с другом, гели оказались лучше, чем жидкости. Не получено убедительных доказательств существенного влияния фармакологических средств на образование спек. Ни в одном исследовании не рассматривали различия в качестве жизни. Все исследования, за исключением одного, показали, что исследователи планировали провести оценку неблагоприятных исходов, связанных с лекарствами, однако о неблагоприятных эффектах не сообщали.

Результаты использования гелей показывают, что у женщин с 77% -ным риском развития спаек без лечения с помощью геля, риск развития спаек после использования геля будет составлять от 26% до 65%. У женщин с 83% -ным риском обострения спаек после отсутствия лечения при первой операции вероятность улучшения состояния после использования геля составит от 16% до 73%. Аналогичным образом для гидрофлотационных жидкостей – у женщин с 84% -ной вероятностью развития спаек без лечения, риск развития спаек при использовании гидрофлотационных жидкостей будет составлять от 53% до 73%.

Жидкие средства и гели эффективны для уменьшении спаек, однако требуется дополнительная информация, чтобы определить, влияют ли они на боли в области таза, частоту живорождения, качество жизни и долгосрочные осложнения, такие как кишечная непроходимость. Кроме того, следует провести обширные исследования высокого качества, в которых исследователи использовали бы стандартный способ измерения спаек, разработанный Американским обществом репродуктивной медицины (модифицированный счет AFS).

Качество доказательств: Качество доказательств варьировало от низкого до высокого. Основными причинами снижения качества доказательств были неточность (малые размеры выборки и широкие доверительные интервалы), и плохое представление методов исследования.

Спаечная болезнь

Спаечная болезнь брюшной полости

Это состояние, при внутренние органы и ткани срастаются между собой полосками соединительной ткани (фиброзными полосками, или спайками). Сращения могут представлять собой толстые тяжи, иногда с сосудами и нервами, а могут быть тонкими мембранами. Спайки нарушают подвижность органов, прежде всего кишечника, связывая их соединительнотканными “мостиками”. Они могут возникнуть между петлями тонкого и толстого кишечника, в области печени, желчного пузыря, матки и маточных труб, яичников, мочевого пузыря, брюшины.

Причины спаечной болезни

Чаще всего причиной считают операции на органах брюшной полости. Спайки возникают после 93% хирургических вмешательств. Если операция проводилась в области малого таза с вовлечением кишечника или матки с придатками, то риск возникновения спаек растет. Процесс утолщения и уплотнения спаек может продолжаться десятки лет.

Фото: romanzaiets / freepik.com

Возможные причины, провоцирующие образование спаек:

  • повреждение внутренних органов;
  • высыхание поверхности внутренних органов во время хирургического вмешательства;
  • контакт внутренних тканей с инородными объектами, такими как марля, хирургические перчатки, шовный материал, инструменты;
  • кровь, поврежденные ткани или тромбы, инородные тела, не полностью удаленные при операции.

Также причиной могут стать состояния, напрямую не связанные с хирургическим вмешательством:

  • разрыв аппендикса, желчного пузыря;
  • лучевая терапия;
  • гинекологические инфекции;
  • инфекции органов брюшной полости;
  • травмы.

В 4,7% случаев спайки врожденные, их формирование происходит во время закладки органов.

В редких случаях спайки могут возникнуть без видимых причин.

Код по МКБ-10

Коды заболевания в соответствии с классификацией:

  • K66.0 – брюшинные спайки
  • N73.6 – тазовые перитонеальные спайки у женщин
  • Т99.4 – послеоперационные спайки в малом тазу
  • Q43.3 – врожденные аномалии фиксации кишечника.
Спайки после аппендэктомии. Фото: Wikipedia (Public Domain)

Симптомы спаечной болезни

Обычно спаечная болезнь протекает бессимптомно. Реже пациент жалуется на постоянные боли (синдром хронической боли) либо на дискомфорт в области живота.

Боли при спаечной болезни

Часто возникают около пупка, имеют приступообразный, спастический характер. Нередки вздутие живота, метеоризм.

У пациенток повышен риск внематочной беременности. Образование спаек непосредственно в матке может приводить к привычному невынашиванию беременности.

Также могут развиваться бесплодие у женщин или кишечная непроходимость.

Фото: katemangostar / freepik.com

Кишечная непроходимость при спаечной болезни

Состояние требует немедленной медицинской помощи, чаще всего – операции. Срочная консультация врача необходима, если у пациента, когда-либо в жизни перенесшего оперативное вмешательство или воспаление в брюшной полости, появились следующие симптомы:

  • сильная боль схваткообразного характера в животе
  • тошнота, рвота
  • метеоризм, сокращения кишечника, которые сопровождаются звуками (бульканье, переливание)
  • увеличение размера живота – невозможность дефекации или невозможность выпустить газ
  • запор, т.е. дефекация реже трех раз в неделю. Процесс дефекации может быть болезненным.

Диагностика спаечной болезни

К сожалению, спайки нельзя обнаружить лабораторными анализами или стандартными визуализирующими методами исследования (рентгенографией, УЗИ).

Точную диагностику спаечной болезни проводят только при визуальном осмотре брюшной полости во время лапароскопии или открытой операции на брюшной полости.

Рентген и компьютерная томография (КТ) могут помочь в выявлении кишечной непроходимости.

Лечение спаечной болезни

Если спайки не проявляются и не вызывают никаких симптомов, то лечение не нужно.

Хирургическая операция — единственный эффективный метод лечения. Показания:

  • болевой синдром;
  • бесплодие;
  • кишечная непроходимость; при полной кишечной непроходимости операция обязательна, при частичной могут помочь консервативные методы.

Однако повторная операция значительно повышает риск образования новых спаек.

Лечение спаечной болезни народными средствами

В крупных клинических исследованиях народные методы не изучались. Таким образом эффективность их не подтверждена, но и не опровергнута.

Диета при спаечной болезни

Исследования не выявили, что питание, диета или какие-то отдельные питательные вещества играют роль в профилактике спаек. Если диагностирована частичная кишечная непроходимость, то имеет смысл увеличить употребление жидкости и есть меньше клетчатки. Подобные рекомендации по питанию лучше получить у лечащего врача.

Фото: evgeniasheidt / freepik.com

Прогноз

Сама спаечная болезнь обычно не вызывает жалоб, протекает бессимптомно и опасности не представляет. Опасны осложнения. В настоящее время методов, позволяющих полностью удалить все спайки, не существует. Также нет идеального способа лечения, но ученые ведут исследования новых вариантов терапии.

Профилактика спаечной болезни

Фото: SimpleFoto / Depositphotos

Заболевание сложно предотвратить полностью, но можно снизить его риск. Для этого при проведении операций стоит отдавать предпочтение малотравматичному лапароскопическому способу. Если он невозможен и требуется операция с широким разрезом на брюшной стенке, то в конце желательна установка специального разделительного материала между органами или между органами и брюшной стенкой. Этот материал похож на вощеную бумагу и полностью рассасывается в течение недели, он увлажняет поверхность органов и не дает расти соединительной ткани между органами.

Другие способы профилактики спаечной болезни кишечника и органов малого таза во время операции обязательны:

  • использование перчаток, не обработанных крахмалом и тальком
  • аккуратное и бережное обращение с органами
  • сокращение времени операции
  • тщательная остановка кровотечения
  • использование увлажненных тампонов и салфеток
  • адекватное применение физиологического раствора для орошения органов с целью увлажнения.

Мерами профилактики после операции считают раннюю активизацию больного (раннее вставание) и дыхательную гимнастику.

Источники

  1. Abdominal Adhesions What are abdominal adhesions?, NIH — [https://www.niddk.nih.gov/health-information/digestive-diseases/abdominal-adhesions] (https://www.niddk.nih.gov/health-information/digestive-diseases/abdominal-adhesions)
  2. Abdominal Adhesions, Medicine Central — [https://im.unboundmedicine.com/medicine/view/5-Minute-Clinical-Consult/117470/all/Abdominal_Adhesions] (https://im.unboundmedicine.com/medicine/view/5-Minute-Clinical-Consult/117470/all/Abdominal_Adhesions)
  3. Alisher Zh. Dairbekov, Zhandos T. Tileuberdi, Nurbolat E. Kuanyshbaev. Prediction and prevention of adhesion formation of the abdominal cavity [Электрнный ресурс] // International Student’s Journal of Medicine, 2015.
  4. Korell M. Methoden der Adhäsionsprophylaxe [Электронный ресурс] // J GYNÄKOL ENDOKRINOL – 2010.
  5. Boychuk A.V., Kurylo O.U., Tolokova T.I. Prevention Of Adhesions In The Preservation Of Reproductive Health [Электронный ресурс] // Research Journal of Pharmaceutical, Biological and Chemical Sciences, 2017.
  6. C. Brochhausen, V. H. Schmitt. Intraperitoneale Adhäsionen [Электронный ресурс] // BIOmaterialien, 2009.

Лечение спаечного процесса в малом тазу

  • Что такое спаечный процесс? >>
  • Причины образования спаек >>
  • Диагностика >>
  • Лечение >>
  • Осложнения >>
  • Что такое спаечный процесс?

    Спайки – это тонкие пленки из соединительной ткани, которые образуют сращения между органами. Трудность лечения и профилактики образования спаек (спаечного процесса) заключается в том, что само их образование является защитной реакцией организма, т.е. физиологически естественным процессом.

    Причины образования спаек

    Спаечный процесс инициируется различными факторами. Основные причины – последствия операций и воспалительные заболевания. Спаечный процесс в малом тазу может быть вызван хроническим воспалением маточных труб (сальпингитом), эндометриозом, воспалением яичников.

    Немного подробнее рассмотрим физиологические принципы образования спаек. Органы малого таза и брюшной полости отделены от мышечной брюшной стенки специальной прослойкой из тонкой пленки – брюшиной. Благодаря гладкости брюшины и жидкости внутри брюшной полости внутренние органы могут смещаться при необходимости, петли кишечника ложатся в естественном для пищеварения положении. Также, благодаря гладкости брюшины, беспрепятственно происходит процесс движения и оплодотворения яйцеклетки, последующее созревание плода в матке с естественным смещением других органов малого таза по мере увеличения плода.

    Все эти процессы протекают естественно, если между органами и брюшной полостью нет спаек. Образование спаек вызывает смещение органов относительно брюшины, нарушение нормального тока внутренних жидкостей, в том числе выхода яйцеклеток из яичников и перемещения их по маточным трубам.

    Диагностика спаечного процесса

    Во многих случаях заболевание протекает бессимптомно. Частый признак возможного спаечного процесса – боли внизу живота. Они вызываются анатомическими нарушениями, которые происходят, когда спайки образуют плотные тяжи и смещают органы.

    Распространенный в гинекологии метод диагностики УЗИ в данном случае малоэффективен. Однако установленная по картине УЗИ или гистеросальпингографии непроходимость маточных труб с большой вероятностью свидетельствует о наличии спаечного процесса. Качественную картину для диагностики заболевания дает метод магнитно-резонансной томографии (МРТ брюшной полости, малого таза). Но наиболее эффективно показывается себя диагностическая лапароскопия. Во время данной процедуры при необходимости можно от диагностики сразу перейти к операции по удалению спаек.

    Лечение спаечного процесса

    Основной метод лечения спаечного процесса – лапароскопия. Эта операция проводится через небольшие проколы в брюшной стенке под контролем видеокамеры, помещаемой внутрь брюшной полости. Во время операции спайки рассекают механическим способом, либо лазером, либо электрическим ножом. Для предотвращения послеоперационного образования спаек в брюшную полость вводятся барьерные жидкости, либо используют механические барьеры – наложение рассасывающейся пленки на яичники и маточные трубы.


    Лапароскопическая операция проводится в условиях операционной и стационара, но переносится легко и имеет небольшой реабилитационный период. Через 2 недели пациентка может вернуться к привычному образу жизни.

    Подробнее о лечении спаечного процесса различной локализации >>

    Расчет стоимости хирургического лечения спаечного процесса в нашей клинике ведется по государственным расценкам.

    → Узнайте все подробности по телефонам +7 (495) 979 00 00 или +7 (495) 211 71 78.

    → Посмотрите информацию о расчете стоимости лечения.

    Возможные осложнения и последствия спаечного процесса

    Спаечный процесс во многих случаях протекает без выраженных симптомов, лишь иногда пациентки жалуются на боли внизу живота. Но это не значит, что болезнь столь безобидна. На ранней стадии заболевания спаечный процесс вокруг маточных труб и яичников не мешает прохождению яйцеклетки. Беременность еще возможна. На более поздних стадиях спайки препятствуют захвату яйцеклетки, вызывают перекрут маточных труб, наступает бесплодие. Если локализация спаечного процесса в придатках матки односторонняя (слева или справа), то есть вероятность, что во втором, здоровом яичнике сможет пройти нормальный процесс созревания и перемещения яйцеклетки.

    Спаечный процесс после операции

    После операции образование спаек может активизироваться снова, так как происходит травматизация тканей, кровоизлияние в брюшную полость, внедрение микрочастиц инородного вещества. Поэтому обязательно проводится постоперационная медикаментозная терапия. Иногда для профилактики спаечного процесса рекомендуют сделать через некоторое время диагностическую лапароскопию.

    Специалисты нашей клиники помогут диагностировать и вылечить спаечный процесс.
    Позвоните консультанту +7 (495) 211-71-78, 979-00-00 или задайте вопрос доктору.


    Послеоперационные спаечные процессы в брюшной полости: потенциальная причина и возможное лечение

    Я уже писал о спаечных процессах в брюшной полости – тканях из фиброзной ткани, которые связывают внутренние органы вместе или с брюшной стенкой. Спайки – удивительно частое послеоперационное осложнение, которым страдают от 50% до 90% людей, перенесших абдоминальные операции. Хотя большинство из них испытывают незначительные симптомы или вообще не имеют их, другие страдают хронической болью, бесплодием, непроходимостью кишечника и даже смертью.

    Несмотря на то, что эти спайки широко распространены, хорошего лечения этого состояния или способов предотвращения их образования не существует. Тем не менее, группа исследователей из Стэнфордской медицины открыла перспективный метод на лабораторных мышах.

    Докторант Дешка Фостер, MD, PhD; пластический и реконструктивный хирург Майкл Лонгакер, доктор медицины; и патолог Герлинде Верниг, доктор медицины, определили молекулярный путь, участвующий в формировании адгезии у мышей и людей, и обнаружили, что ингибирование активности белка, называемого JUN, может существенно снизить образование спаек в модели на мышах.Недавно они опубликовали свои результаты в Nature Communications

    .

    Как объяснил Фостер:

    Мы узнали, что спайки возникают в основном из тонкого слоя ткани, покрывающего кишечник, называемого висцеральной брюшиной. Это объясняет, почему образование спаек часто бывает более серьезным после открытой абдоминальной хирургии, чем когда хирургическая процедура выполняется лапароскопически. Кроме того, абдоминальные спайки формируются местным типом клеток (а не клетками, рекрутированными из другой части тела), называемыми фибробластами, которые пролиферируют и дифференцируются, образуя гетерогенную популяцию.Наконец, мы идентифицировали специфический ген под названием JUN, который экспрессируется этими фибробластами в ответ на травму (например, хирургическую процедуру) и служит «главным регулятором» образования адгезии.

    Исследователи обнаружили, что чрезмерная экспрессия JUN на мышиной модели этого состояния вызывает более серьезные спайки; и наоборот, применение небольшой молекулы, которая блокирует активность JUN в брюшной полости мышей, резко снижает образование спаек после операции. Ученые надеются, что подобное лечение может помочь предотвратить образование спаек у людей, перенесших абдоминальную операцию.

    Как объяснил Фостер:

    Клинически наши результаты потенциально весьма впечатляющие. В настоящее время нет никаких хороших вариантов предотвращения образования спаек после абдоминальной хирургии. Кроме того, если у пациента возникает непроходимость из спаек, которая не разрешается спонтанно, мы должны вмешаться хирургическим путем и лизировать спайки, но сама операция в конечном итоге приведет к образованию дополнительных спаек.

    Фостер сказал мне, что ингибитор, который они использовали для предотвращения образования спаек у мышей, уже был исследован на людях для лечения артрита, и он хорошо переносился.

    Лонгакер сказал, что следующим шагом команды будет испытание процесса на более крупной модели животных.

    «Послеоперационная внутрибрюшная спайка представляет собой огромную проблему, с которой хирурги общей практики борются каждый день», – сказал мне Лонгакер. «Я надеюсь, что биология, которую мы раскрыли в нашей мышиной модели, поможет нам быстро перейти к будущим методам лечения людей».

    Фото Anut21ng Фото

    Спайки брюшной полости: практический обзор объекта, на который часто не обращают внимания.

    https: // doi.org / 10.1016 / j.amsu.2017.01.021Получить права и контент

    Основные моменты

    Спайки брюшной полости обычно образуются после внутрибрюшных операций, облучения и воспалительных процессов.

    У части пациентов спаечные процессы приводят к проблемным симптомам, таким как боль в животе, вздутие живота и непроходимость кишечника.

    Симптоматические спайки (т. Е. Спаечная болезнь) могут быть диагностически неуловимыми и, следовательно, недооцененными врачами.

    Спаечная болезнь часто требует мультимодальной оценки; у отдельных пациентов оперативное вмешательство может быть диагностическим и терапевтическим.

    Реферат

    Образование внутрибрюшных спаек – частое последствие абдоминально-тазовой хирургии, лучевой терапии и воспалительных процессов. У небольшой, но клинически значимой части пациентов может развиться спаечная болезнь, при которой спаечные процессы приводят к множеству хронических симптомов, таких как вздутие живота, боль, тошнота и патология дефекации, которая может быть ежедневной, прерывистой или эпизодической.Из-за хронического и тревожного характера этих симптомов спаечная болезнь может изменить жизнь многих пациентов, особенно если ее не распознать и не лечить должным образом, что бывает нередко. Кроме того, существует мало литературы, посвященной оценке и ведению пациентов с подозрением на спаечную болезнь брюшной полости. Поэтому в этом кратком обзоре мы даем клинически практический синопсис этиопатогенеза, симптомов, дифференциальной диагностики, оценки и лечения спаечной болезни брюшной полости.

    Ключевые слова

    Лапаротомия

    Лапароскопическая операция

    Кишечная непроходимость

    Адгезиолиз

    Боль в животе

    Рекомендуемые статьиЦитирующие статьи (0)

    © 2017 Авторы. Опубликовано Elsevier Ltd от имени IJS Publishing Group Ltd.

    Рекомендуемые статьи

    Цитирующие статьи

    Послеоперационные спайки вызываются кальциево-зависимыми мембранными мостиками между мезотелиальными поверхностями

    Культура клеток

    Клетки Met-5A культивировались в 10% FBS (Sigma Aldrich, # F9665), F199 (Sigma Aldrich, # M4530), 18 нг / мл EGF (R&D systems, # 236-EG), 400 нМ гидрокортизон (Sigma Aldrich, # h5001), 16 нг / мл инсулин-трансферрин-селен (Gibco, # 41400045), 10 мМ HEPES (Gibco, # 15630080), 2.5 мг / л амфотерицина (Gibco, # 5000980), микроэлементы B (Corning, # 15343641), 50 единиц Penstrep (Gibco, # 15070063). После шока обезвоживания клетки культивировали в «аналитической среде»: 2% FBS, 10 мМ HEPES, микроэлементы B и 50 единиц Penstrep. Клетки культивировали на чашках, покрытых 2% желатином (Sigma Aldrich, # G1393). Клетки пассировали с использованием PBS и трипсин-EDTA (Sigma Aldrich, # T4049).

    Стабильные клеточные линии

    Клетки трансфицировали соответствующими плазмидами PiggyBac- и Helper с использованием Lipofectamine 2000 (Invitrogen, # 11668) в соответствии с инструкциями производителя.Через 48 ч среду заменяли средой, содержащей 10 нг / мл пуромицина (Tebu-Bio, # BIA-P1230). Через день среду заменяли до 2 недель отбора, после чего трансгены стабильно экспрессировались.

    Первичное выделение и культивирование клеток

    5 мл предварительно нагретой среды для диссоциации (среда Игла, модифицированная Дульбекко (DMEM, Life Technologies, # 10565-042), коллагеназа IV (50 мг / мл, Worthington Biochemical) и 20 мкМ CaCl 2 вводили в брюшную полость только что умерщвленных мышей C57BL / 6JIV дикого типа.Через 5 мин полученную суспензию клеток собирали, фильтровали через фильтр 100 мкм, центрифугировали и промывали 2% фетальной бычьей сывороткой (FBS, Sigma Aldrich, # F9665) в PBS. Затем клетки сортировали с использованием MACS® Technology (Miltenyi Biotec). Клетки PDPN + LYVE1- CD31- CD45- культивировали в среде DMEM с добавлением 10% FBS и 50 единиц Penstrep (Gibco, # 15070063).

    Измерение люциферазы и нанолюциферазы

    Клетки инкубировали с ледяным буфером для лизиса люциферазы (25 мМ Tris-HCL pH 7.8, 1% Triton X-100, 15 мМ MgSO 4 , 4 мМ EGTA, 1 мМ DTT) в течение 20 мин. Оба анализа были выполнены в формате 96-луночного планшета. Субстрат люциферазы светлячков растворяли в PBS и состояли из 20 мМ трицина, 2,67 мМ MgSO 4 , 0,1 мМ ЭДТА, 33,3 мМ DTT, 0,52 мМ АТФ, 0,27 мМ ацетил-КоА, 5 мМ NaOH, 50 мМ MgCO 3 и 0,47 мМ d-люциферина (Carl Roth, № CN24.3). Для нанолюциферазы раствор субстрата включал 47,2 мкМ целентеразина (Carl Roth, # 4094.4). Люминесценцию детектировали через 5 мин совместной инкубации субстрата и лизата с использованием модульного многомодового ридера для микропланшетов TriStar² LB 942 (Berthold Technologies).

    Высокопроизводительный анализ адгезии носитель-носитель

    Клетки Met-5A засевали вместе с гранулами микроносителя Cytodex® 3 (Sigma Aldrich, # C3275) в соотношении 500: 1 и оставляли для прилипания и роста в течение 5 дней. Затем покрытые клетками гранулы элюировали из чашки для культивирования с помощью стриптиза на 25 мл. Полученный раствор фильтровали через сетчатый фильтр для клеток 100 мкм (Corning, # 352360). Шок десикации вызывали помещением содержащего гранулы клеточного фильтра в вытяжной шкаф для работающей культуры клеток на 15 мин.После этого шарики элюировали средой для анализа и помещали в чашку для культивирования, покрытую раствором силиката НЕМА (Sigma Aldrich, # P3932), чтобы предотвратить прикрепление клеток. По истечении указанного времени комплексы носителей собирали путем их фильтрации через клеточный фильтр с размером ячеек 200 мкм, который позволяет отдельным носителям проходить, улавливая комплексы носителей. Адгезии измеряли высокопроизводительным способом с использованием клеток Met-5A, стабильно экспрессирующих люциферазу (AF23) или нанолюциферазу (AF1), с использованием пипеток Integra Viaflo.

    Высокопроизводительный анализ адгезии носителя к монослою

    Клетки Met-5A высевали на чашки, покрытые желатином (Sigma Aldrich, # G1393). После образования сливающегося монослоя на монослой засевали гранулы, покрытые стрессовыми клетками. Для экспериментов по ингибированию, если не указано иное, клетки предварительно обрабатывали указанным соединением в течение 30 мин в культуральной среде. После этого был проведен анализ адгезии, как описано выше.

    Маркировка микроносителя

    Микроноситель Cytodex3 был окрашен либо эфиром Alexa Fluor 488 NHS (Thermo; A20000), либо сложным эфиром Alexa Fluor 568 NHS (Thermo; A20003) в соответствии с инструкциями производителя.Меченые микроносители интенсивно промывали полной средой и использовали, как описано выше.

    Анализ передачи Cre-exchange

    Клетки Met-5A, стабильно экспрессирующие Cre-рекомбиназу (AF32), высевали на гранулы микроносителя Cytodex® 3 (Sigma Aldrich, # C3275) и подвергали шоку обезвоживания, как описано, и помещали в Met- 5A монослой, стабильно экспрессирующий репортерную конструкцию dTomato-P2A-NanoLuciferase (AF34). Люминесценцию нанолюциферазы измеряли через 48 ч. Это представляет собой начальную передачу, зависящую от напряжения.

    Клетки Met-5A дикого типа затем высевали на монослой, подвергали шоку иссушения и помещали вместе с покрытыми ненапряженными клетками гранулами, которые стабильно экспрессируют рекомбиназу Cre (AF32) в течение 3 часов. Затем носители отделяли от монослоя и помещали на нестрессированный монослой Met-5A, стабильно экспрессирующий репортерную конструкцию dTomato-P2A-NanoLuciferase (AF34). Люминесценцию нанолюциферазы измеряли через 48 ч. Это первая трансмиссия, не зависящая от напряжений.

    Гранулы, покрытые клетками дикого типа, затем подвергали шоку иссушению и высевали на нестрессированный монослой Met-5A дикого типа в течение 3 часов.Затем носители отделяли от монослоя и помещали на покрытые ненапряженными клетками гранулы, стабильно экспрессирующие Cre-рекомбиназу (AF32), на 3 часа. Затем носители снова выделяли и помещали на нестрессированный монослой Met-5A, стабильно экспрессирующий репортерную конструкцию dTomato-P2A-NanoLuciferase (AF34). Люминесценцию нанолюциферазы измеряли через 48 ч. Это вторая передача, независимая от напряжений.

    Эта процедура была продолжена аналогично для третьей и четвертой передач подряд.

    Анализ распространения адгезии

    Клетки Met-5A, стабильно экспрессирующие нанолуциферазу (AF1), высевали на гранулы микроносителя Cytodex® 3 (Sigma Aldrich, # C3275) и подвергали шоку от высыхания, как описано, и помещали на Met- 5А монослой. Через 24 ч несвязанные носители смывали и измеряли люминесценцию нанолюциферазы. Это представляет собой начальную передаваемую адгезию, зависящую от напряжения.

    Клетки Met-5A дикого типа затем высевали на монослой, подвергали воздействию высыхания и помещали вместе с покрытыми ненапряженными клетками гранулами, которые стабильно экспрессируют нанолюциферазу (AF1) в течение 3 часов.Затем носители отделяли от монослоя и помещали на ненапряженный монослой Met-5A дикого типа. Через 24 ч несвязанные шарики смывали и измеряли люминесценцию нанолюциферазы. Это первая переданная адгезия, не зависящая от напряжения.

    Гранулы, покрытые клетками дикого типа, затем подвергали шоку иссушению и высевали на нестрессированный монослой Met-5A дикого типа в течение 3 часов. Затем носители отделяли от монослоя и помещали на покрытые ненапряженными клетками гранулы, стабильно экспрессирующие нанолюциферазу (AF1), на 3 часа.Затем носители снова выделяли и помещали на нестрессированный монослой Met-5A, стабильно экспрессирующий репортерную конструкцию dTomato-P2A-NanoLuciferase (AF34). Затем несвязанные шарики смывали и через 24 часа измеряли люминесценцию нанолюциферазы. Это представляет собой вторую передающуюся адгезию, не зависящую от напряжения.

    Эта процедура была продолжена аналогично для третьей и четвертой передач подряд.

    Анализ силы отделения клеток на вращающемся диске

    Протокол, используемый для измерения сил отделения клеток, был адаптирован из 36 .Вкратце, клетки Met-5A, стабильно экспрессирующие нанолюциферазу, высевали на стеклянные предметные стекла, покрытые желатином (Sigma Aldrich, # G1393). Через 2 дня клетки подвергали стрессу, как описано выше, и затем выращивали еще 24 часа. Затем слайды вращали, лизировали и измеряли активность нанолюциферазы. Для исходных значений силы отслоения клеток выражали относительно значений нанолюциферазы, полученных из лизированного невращающегося предметного стекла, на котором клетки выращивали до слияния. Для отделения носителя от монослоя тот же протокол выполняли с монослоем клеток Met-5A, засеянным на покрытые желатином стеклянные слайды, на которые были добавлены шарики микроносителя Cytodex® 3, покрытые Met-5A (Sigma Aldrich, # C3275), стабильно экспрессирующие нанолюциферазу.Чтобы получить значимые значения с точки зрения генерируемых сил, использовались значения, как описано в таблице 1.1 36 , которая описывает взаимосвязь между скоростью вращения и напряжением сдвига стенки для ряда радиальных положений поперек вращающегося диска (от оси вращения).

    siRNA-опосредованный нокдаун

    RNAi-опосредованный нокдаун выполняли в соответствии с протоколом трансфекции малой интерферирующей РНК (siRNA) производителя (Santa Cruz). Вкратце, мезотелиальные клетки трансфицировали указанными миРНК на 3-й день при совместном культивировании с микроносителями.Анализ адгезии in vitro проводили, как описано выше.

    Препарат ткани мыши для визуализации

    После удаления органов они фиксировали в течение ночи при 4 ° C в 2% формальдегиде. На следующий день фиксированные ткани промывали трижды в фосфатно-солевом буфере Дульбекко (PBS) (DPBS, GIBCO, # 14190-094) и, в зависимости от цели, погружали, замораживали в соединении OCT (Sakura, # 4583) и хранили. при -20 ° C или хранить при 4 ° C в PBS, содержащем 0,2% желатина (Sigma Aldrich, # G1393), 0.5% тритона X-100 (Sigma Aldrich, # X100) и 0,01% тимеросала (Sigma Aldrich, # T8784) (PBS-GT).

    Трехмерное изображение образцов ткани целиком

    Образцы целиком окрашивали и очищали с помощью модифицированного протокола 3DISCO 37 . Короче говоря, образцы, хранящиеся в PBS-GT, инкубировали с первичными антителами в PBS-GT при встряхивании в течение 36 часов при комнатной температуре. Избыток антител удаляли путем тщательной промывки в PBS-GT в течение 6–12 часов и обновления раствора каждые 1-2 часа. После инкубации с вторичными антителами, связанными с флуорофором (молекулярные зонды), в PBS-GT в течение 36 часов следовала тщательная промывка в PBS-GT, как описано выше.При необходимости образцы дегидратировали в восходящей серии тетрагидрофурана (Sigma, # 186562) (50%, 70%, 3 × 100%; 60 минут каждый), а затем очищали дихлорметаном (Sigma, # 270997) в течение 30 минут, а затем погружают в бензиловый эфир (Sigma, # 108014). Непрозрачные образцы получали в 35-миллиметровых чашках со стеклянным дном (Ibidi, # 81218) с использованием лазерного сканирующего конфокального микроскопа (Zeiss LSM710) или многофотонного микроскопа SP8 (Leica). Очищенные образцы визуализировали при погружении в бензиловый эфир с помощью светового флуоресцентного микроскопа (LaVision BioTec).

    3D многофотонная визуализация

    Для многофотонной визуализации образцы были залиты 4% -ным раствором агарозы NuSieve GTG (Lonza, # 50080). Визуализацию выполняли с помощью объектива с 25-кратным погружением в воду (HC IRAPO L 25 × / 1,00 Вт), соединенного с перестраиваемым импульсным лазером (Spectra Physics, Insight DS +). Изображения с многофотонным возбуждением регистрировались внешними нерассканированными гибридными фотодетекторами (HyD). Для обнаружения использовались следующие полосовые (BP) фильтры: HC 405/150 BP для DAPI / Hoechst и генерации второй гармоники (SHG), ET 525/50 BP для зеленого канала, 585/40 BP для красного канала и 650 / 50 BP (пурпурный) для дальнего красного.Плитки были объединены с использованием пакета приложений Leica Application Suite X (v3.3.0, Leica) с плавным перекрытием, а данные были визуализированы с помощью программного обеспечения Imaris (v9.1, Bitplane).

    Трехмерная визуализация светового листа

    При погружении в бензиловый эфир образцы освещались с двух сторон плоским световым листом с использованием лазера белого света (SuperK Extreme EXW-9; NKT Photonics). EdU и PDPN возбуждали при 640/30 и 576/23 нм соответственно, а испускаемый свет детектировали с использованием фильтров 690/50 и 620/31 нм.Оптические срезы регистрировались перемещением камеры образца вертикально с шагом 5 мм через лазерный световой лист. Трехмерные реконструкции были получены с использованием программного обеспечения Imaris imaging (v9.1, Bitplane).

    Сканирующая электронная микроскопия

    Клетки Met-5A высевали на гранулы микроносителя Cytodex® 3 (Sigma Aldrich, # C3275) и подвергали обезвоживанию, как описано. Затем покрытые клетками гранулы добавляли к клеткам Met-5A, засеянным на стеклянных предметных стеклах, покрытых желатином (Sigma Aldrich, # G1393), и через указанные временные точки стеклянные предметные стекла фиксировали O / N при 4 ° C с использованием 3% глутаральдегида и 0.1% буфер какодилата натрия, pH 7,4 (Электронная микроскопия, № 16538). Для тканей животных спайки индуцировали у мышей, как описано, и умерщвляли через 16 часов. Затем брюшину фиксировали таким же образом, как и на предметных стеклах. Образцы были обезвожены в последовательном разбавлении этанола и высушены методом критической точки с использованием CO 2 в качестве переходной жидкости (Polaron Critical-Point Dryer CPC E3000; Quorum Technologies, Ringmer, UK). Образцы покрывали напылением слоем платины 7 нм с помощью устройства для распыления (Emitech K575; Quorum Technologies) и наблюдали с помощью сканирующей электронной микроскопии (JSM 6300F; JEOL, Eching, Германия).

    3D конфокальная визуализация с отражением.

    Изображения, полученные с помощью отражательной микроскопии, были записаны с помощью микроскопа Leica SP8 с использованием зеленого твердотельного лазера (552 нм). Конфокальные изображения были получены с отверстием размером 44,7 мкм, а сигнал отражения был получен от 547 до 555 нм с использованием ФЭУ (Hamamatsu R 9624). Z -стаки (интервалы 1 мкм) регистрировались каждые 5 мин. Изображения обрабатывались с помощью LAS X (Leica; v3.6.0) и Imaris (Bitplane; v9.3.0), а яркость и контраст были отрегулированы для оптимальной визуализации.

    2D-визуализация срезов тканей мыши и человека

    Фиксированные ткани были встроены в оптимальную температуру резки (OCT) и разрезаны с помощью Microm HM 525 (Thermo Scientific). Для анализа использовались сагиттальные сечения 7 мкм. Короче говоря, срезы фиксировали в ледяном ацетоне в течение 5 минут при -20 ° C, а затем промывали PBS. Затем срезы блокировали для неспецифического связывания 1% BSA и 5% козьей сыворотки в PBS в течение 60 мин при комнатной температуре, а затем инкубировали с первичными антителами в 1% BSA и 5% козьей сыворотке в PBS, O / N при 4 ° С.На следующий день после промывания срезы инкубировали в PBS с флуоресцентным вторичным антителом в течение 120 мин при комнатной температуре. Наконец, срезы промывали и инкубировали с красителем нуклеиновой кислоты Hoechst 33342 (Invitrogen, # h2399), промывали ddH 2 O, устанавливали с Fluoromount-G® (Southern Biotech, # 0100-01) и хранили при 4 ° C. во тьме.

    Окрашивание трихромом по Массону

    Для визуализации отложенного матрикса проводили окрашивание трихромом по Массону (Sigma Aldrich, # HT15). Вкратце, образцы фиксировали в течение 10 минут в ледяном ацетоне при -20 ° C, а затем промывали в dH 2 O в течение 5 минут.Затем образцы инкубировали в течение ночи в растворе Буэна (Sigma Aldrich, # HT10132) при комнатной температуре и на следующий день промывали проточной водопроводной водой в течение 5 минут. Затем образцы погружали в раствор гематоксилина железа Вейгерта (Sigma Aldrich, # HT1079) на 3 минуты и снова промывали проточной водопроводной водой в течение 5 минут. Образцы инкубировали с раствором фуксина Briebrich Scarlet-Acid Fuchsin в течение 5 минут, промывали в dH 2 O и инкубировали с раствором фосфорновольфрамовой / фосфомолибденовой кислоты в течение 5 минут.Наконец, образцы погружали в раствор анилинового синего на 10 мин, промывали 1% уксусной кислотой в течение 2 мин и затем промывали dH 2 O, а затем дегидратировали в градиенте этанола. Затем образцы погружали 8–10 раз и очищали в Roti®-Histol (Carl Roth, # 6640) и закрепляли с помощью Roti®-Histokitt (Carl Roth, # 6638).

    Визуализация покрытых Met-5A комплексов носитель-носитель

    Комплексы носитель-носитель фиксировали в 4% PFA в PBS в течение 20 минут при комнатной температуре. После этого комплексы дважды промывали PBS.Клетки пермеабилизировали в течение 10 минут в 0,1% Triton X-100 (Sigma Aldrich, # X100) в PBS при 4 ° C, после чего их дважды промывали 0,02% Tween-20 (Sigma Aldrich, # 9416) в PBS. Затем носители блокировали для неспецифического связывания с помощью 5% BSA и 0,02% Tween-20 в PBS в течение 60 мин при 4 ° C на качающейся платформе, а затем инкубировали с первичным антителом в 0,02% Tween-20 в PBS O / N. при 4 ° C. На следующий день после отмывки носители инкубировали в PBS с флуоресцентным вторичным антителом в течение 120 мин при 4 ° C на качающейся платформе.Наконец, носители промывали и инкубировали с окрашиванием нуклеиновой кислоты Hoechst 33342 (Invitrogen, # h2399).

    Визуализация образцов Met-5A от носителя к монослою

    Для образцов от носителя к монослою Клетки Met-5A, высеянные на предметные стекла, покрытые желатином (Sigma Aldrich, # G1393). Образцы фиксировали 4% PFA в PBS в течение 20 мин при комнатной температуре. Клетки пермеабилизировали в течение 10 минут в 0,1% Triton X-100 (Sigma Aldrich, # X100) в PBS при 4 ° C, после чего их дважды промывали 0,02% Tween-20 (Sigma Aldrich, # 9416) в PBS.Затем предметные стекла блокировали для неспецифического связывания 5% BSA и 0,02% Tween-20 в PBS в течение 60 мин при 4 ° C, а затем инкубировали с первичным антителом в 0,02% Tween-20 в PBS O / N при 4 ° C. . На следующий день после отмывки носители инкубировали в PBS с флуоресцентным вторичным антителом в течение 120 мин при 4 ° C. Наконец, предметные стекла промывали и инкубировали с окрашиванием нуклеиновой кислотой Hoechst 33342 (Invitrogen, # h2399).

    Мечение мембранным красителем культур микроносителей и монослойных культур

    Клетки Met-5A метили окрашивающим раствором DiO (Invitrogen, # V22886) в соответствии с инструкциями производителя и высевали в виде монослоя на стекло, покрытое желатином (Sigma Aldrich, # G1393). камеры (Там же, №80287).После 3 дней культивирования отдельную популяцию клеток засевали вместе с микроносителями Cytodex® 3 (Sigma Aldrich, # C3275) и метили с использованием набора PKh36 Red Fluorescent Cell Linker kit (Sigma Aldrich, # MINI26-1KT). Затем покрытые клетками гранулы подвергали шоку иссушению, как описано, и добавляли к монослойной культуре.

    Мечение микроносителей первичными мезотелиальными клетками

    Микроносители Cytodex3 окрашивали либо эфиром Alexa Fluor 488 NHS (Thermo Scientific, # A20000), либо эфиром Alexa Fluor 568 NHS (Thermo Scientific, # A20003) в соответствии с инструкциями производителя.

    Предварительная обработка изображений

    Вся обработка изображений и анализ выполнялись с экспортированными изображениями Tif с использованием Fiji (ImageJ 2.0.0 /1.52c, США). Флуоресцентные каналы были разделены, а яркость и контраст были отрегулированы для уменьшения фона, чтобы предотвратить неправильную интерпретацию фона как клеточные структуры на этапе сегментации.

    Предварительная обработка изображения: сегментация

    Анализ протрузии мезотелия был выполнен с использованием плагина Advanced weka segmentation Fiji 38 .Он использует набор алгоритмов машинного обучения для сегментации. В частности, сегментация на основе пикселей основана на функциях изображения, аннотированных для разных классов. Образцы пикселей были нарисованы бесплатно и отнесены к соответствующим классам, например, «филоподии», «тело клетки» или «фон». Последующие раунды обучения были выполнены для распределения соответствующих пикселей и структур по соответствующим классам для улучшения сегментации. Функции обучения, такие как «Размытие по Гауссу», «Фильтр Собеля», «Гессиан», «Разница гауссианов» и «Мембранные проекции», были применены вместе с классификатором по умолчанию «Быстрый случайный лес».Остальные настройки оставлены по умолчанию (толщина мембраны 1, размер участка мембраны 19, минимальная сигма 1,0 и максимальная сигма 16,0). Обученный классификатор и данные были сохранены для анализа других наборов данных «стресс» и «стресс» мезотелия. Был написан макрос для автоматизации вышеуказанных шагов для других наборов данных с паузой на 5 секунд (функция ожидания (5000)) после каждого шага для плавной обработки. Изображения из сегментированных классов были извлечены и подвергнуты постобработке.

    Постобработка изображения: общая площадь поверхности филоподий

    Для количественной оценки общей площади поверхности филоподий были получены сегменты филоподий, как описано в разделе «Сегментация».Яркость и контраст были отрегулированы на основе этих изображений и преобразованы в двоичные изображения. Затем вычисляли среднюю интенсивность флуоресценции.

    Постобработка изображения: длина и ширина филоподий

    Длина и ширина филоподийных выступов рассчитывались с помощью плагина ImageJ «Обнаружение гребней» 39 . Короче говоря, филоподиальные сегменты были получены, как описано в разделе «Сегментация». Были выбраны параметры «Правильное положение», «оценка ширины», «удлинение линии», «отображение результатов» и «добавить в менеджер».Используемые параметры включали необязательные параметры (ширина линии: 10, высокая контрастность: 230, низкая контрастность: 87) и обязательные параметры (сигма: 3,39, нижний порог: 0,51, верхний порог: 1,19, минимальная длина строки: 15,00). Параметры были оптимизированы с использованием функции предварительного просмотра для одного набора данных, а аналогичные значения и настройки были применены для других наборов данных. Значения длины и ширины были извлечены из сводной вкладки и экспортированы в виде файла Excel.

    Мечение EdU in vivo

    Животным внутрибрюшинно вводили 1 мкг EdU (Invitrogen, # A10044), растворенного в 100 мкл PBS, в день операции и умерщвляли на 5-й день.После удаления органа и фиксации в течение ночи в 2% формальдегиде EdU визуализировали с помощью набора для визуализации Click-iT ™ EdU Alexa Fluor ™ 647 (Invitrogen, # C10340) в соответствии с инструкциями производителя. Реакционный коктейль Click-iT® инкубировали с образцами в течение 36 часов при комнатной температуре, чтобы обеспечить достаточное проникновение в ткань. Затем ткани подвергались дальнейшей обработке в соответствии с протоколом визуализации всего образца (см. «Трехмерное изображение образцов ткани целого образца»).

    Локальное лечение местной целлюлозой

    Низкомолекулярные ингибиторы солюбилизировали в стерильной 2% гидроксиэтилцеллюлозе (Sigma Aldrich, # 09368).Соединения добавлялись непосредственно перед операцией и были получены из 100–150 мМ исходного раствора для минимизации конечного содержания ДМСО. Конечный раствор (200 мкл на 30 г веса тела) помещали между висцеральным и париетальным слоями поврежденной слепой кишки и брюшины соответственно.

    Животные

    Все эксперименты на животных проводились в соответствии со строгими правительственными и европейскими директивами и были одобрены местным правительством административного региона Верхняя Бавария под лицензией № 55.2-1-54-2532-150-2015. Свободные от патогенов самцы и самки мышей C57BL / 6 (в возрасте 6–10 недель) были получены из Charles River и помещены в группы в помещениях с контролируемым климатом с циклом 12 часов / 12 часов свет / темнота. Животным давали пищу и воду ad libitum.

    Rosa26 mTmG или Rosa26 tm1 (DTA) Lky , скрещенные с мышами Procr CreERT2-IRES-tdTomato , использовались в этом исследовании (Jackson Laboratories). Для экспериментов по отслеживанию клонов, проведенных у взрослых мышей в течение 6-8 недель, животные получали три внутрибрюшинных инъекции (Z) -4-гидротамоксифена (Sigma Aldrich, # H7904, 2 мг на 25 г веса тела, разведенного в 100 мкл кукурузного масла (Sigma Aldrich, # C8267)) через день, чтобы вызвать активацию рекомбиназы Cre.Для селективного удаления мезотелиальных клеток PROCR + животным однократно вводили (Z) -4-гидротамоксифен (Sigma Aldrich, # H7904, 2 мг на 25 г веса тела, разведенный в 100 мкл кукурузного масла (Sigma Aldrich, # C8267)). сразу после операции перед закрытием живота.

    Модель адгезии мышей

    Мышей анестезировали путем внутрибрюшинной инъекции коктейля медетомидина (500 мкг / кг), мидазолама (5 мг / кг) и фентанила (50 мкг / кг), далее называемого MMF. Мониторинг глубины анестезии оценивался по рефлексу пальцев стопы.Глаза покрывали бепантеном, чтобы избежать обезвоживания, а брюшную полость брили и дезинфицировали бетадином и стерильным PBS. Животных держали на спине на нагревательной пластине при 37 ° C. Лапаротомия по средней линии (1–1,5 см) выполнялась через кожу и брюшину. Четыре крючка, расположенные вокруг разреза и прикрепленные к ретрактору и магнитной опорной пластине, обеспечивали свободный доступ в брюшную полость. С помощью небольшой хирургической щетки аккуратно очистили поверхность брюшины и приложили поверхность слепой кишки.Затем через серозную поверхность брюшины накладывали два хирургических узла с использованием шелковых швов 4-0 (Ethicon). С помощью ватного тампона осторожно нанесли немного талька (Sigma Aldrich, № 243604) на поврежденные поверхности. Перед закрытием разреза в брюшную полость пипеткой вводили бупренорфин (0,1 мг / кг), чтобы обеспечить начальную послеоперационную анальгезию. Для длительного обезболивания ежедневно вводили метамизол (новалгин, 200 мг / кг). Брюшину и кожу закрывали двумя отдельными шелковыми нитями 4-0 (Ethicon).После закрытия разреза мышей просыпали антагонистическим воздействием на раствор MMF посредством подкожной коктейльной инъекции атипамезола (1 мг / кг) и флумазенила (0,25 мг / кг). Мышам давали возможность восстановиться на грелке, после чего их помещали вместе (самки) или по отдельности (самцы) и наблюдали в течение 1–5 дней. Спайки оценивали с использованием общих морфологических признаков, указывающих на развитие спаек. Оценивали пять индивидуальных характеристик адгезии (см. Дополнительную таблицу 1), которые вместе давали совокупное значение, определяющее общую оценку адгезии.В этой системе полное отсутствие спаек было оценено как 0, тогда как максимальная оценка адгезии составила 15.

    Ткань человека

    Все образцы человека были взяты во время хирургического вмешательства в хирургическом отделении Klinikum rechts der Isar Технического университета Мюнхена. , после одобрения местного этического комитета Технического университета Мюнхена, Германия (№ 173/18 S). Спайки были диагностированы во время операции, иссечение соответствующих органов было подготовлено для дальнейшего анализа.Информированное согласие было получено от всех субъектов после операции.

    Секвенирование одноклеточной РНК (Drop-seq)

    Клетки Met-5A выращивали в культуре и подвергали стрессу в течение 15 мин путем высушивания. Затем в указанные моменты времени образцы инкубировали в течение 5 минут в растворе трипсин-ЭДТА при 37 ° C. Трипсин инактивировали ледяной средой для анализа, и клетки дважды промывали ледяным PBS. Эксперименты с методом drop-seq проводили, как описано ранее 20,21 , с небольшими изменениями во время приготовления одноклеточной библиотеки.Вкратце, отдельные клетки разбавляли PBS с добавлением 0,04% бычьего сывороточного альбумина до конечной концентрации 100 клеток / мкл. Используя микрожидкостное устройство PDMS (Nanoshift), отдельные клетки совместно инкапсулировали в капельки с шариками со штрих-кодом (Chemgenes Corporation, Wilmington, MA) до конечной концентрации 120 шариков / мкл. Капли собирали в течение 15 мин / образец. После разрушения капель гранулы собирали, промывали и готовили для обратной транскрипции мРНК на гранулах (Maxima RT, Thermo Fisher).После обработки экзонуклеазой I (New England Biolabs) для удаления неиспользованных праймеров, гранулы были подсчитаны, разделены на аликвоты (2000 гранул на реакцию, что составляет ~ 100 клеток на реакцию) и предварительно амплифицированы с помощью 13 циклов ПЦР (праймеры, химия и условия цикла идентичны ранее описанным в Macosko et al., 20 ). Продукты ПЦР объединяли и дважды очищали с использованием 0,6x очищающих гранул (CleanNA). Перед тегированием образцы кДНК загружали на высокочувствительный чип ДНК на биоанализаторе 2100 (Agilent), чтобы гарантировать целостность, чистоту и количество транскрипта.Для каждого образца 1 нг предварительно амплифицированной кДНК из примерно 1000 клеток был помечен Nextera XT (Illumina) с помощью специального праймера P5 (Integrated DNA Technologies). Одноклеточные библиотеки секвенировали в прогоне парных концов 100 п.н. на Illumina HiSeq4000, используя денатурированный образец 0,2 нМ и добавку 5% PhiX. Для праймирования чтения 1 использовали 0,5 мкМ Read1CustSeqB (последовательность праймера: GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC).

    Биоинформатическая обработка данных секвенирования одноклеточной РНК

    Основной вычислительный конвейер Drop-seq использовался для обработки считываний секвенирования следующего поколения данных scRNA-seq, как описано ранее 20 .Вкратце, STAR (версия 2.5.2a) использовался для отображения 40 . Считывания были сопоставлены с эталоном генома hg19 (предоставленным Drop-seq group, GSE63269). Для фильтрации штрих-кодов мы исключили штрих-коды, в которых обнаружено менее 200 генов. Высокая доля (> 10%) количества транскриптов, полученных из генов, кодируемых митохондриями, может указывать на низкое качество клеток, и мы удалили эти неквалифицированные клетки из последующего анализа. После получения матрицы данных DGE мы использовали Сера для уменьшения размерности, кластеризации и анализа дифференциальной экспрессии генов 20 .

    Анализ главных компонентов

    Используя только вариабельные гены, был проведен анализ главных компонентов (PCA). 15 основных компонентов использовались в качестве входных данных для функции Seurat FindClusters с разрешением 0,5. Этот метод выполняет кластеризацию ячеек, встраивая их в графоподобную структуру. Используется граф ближайших соседей k , в котором любые две ячейки (представленные как узлы), соединенные ребром, имеют вес ребра, который находится среди k наименьших расстояний от первого узла до любого другого.Таким образом, между клетками с похожими паттернами экспрессии генов проводятся границы. Методы оптимизации модульности, такие как алгоритм Лувена, пытаются выявить части графа с различной связностью и, следовательно, разделить граф на отдельные взаимосвязанные модули.

    Метод абстракции графа на основе разделов

    Для визуализации результата кластеризации многомерных данных с одной ячейкой был использован алгоритм Фрухтермана-Рейнгольда из набора инструментов Python Scanpy 41 .Кроме того, для отображения связи между группами ячеек использовался метод абстракции графа на основе разделов (PAGA) 41 . Клетки были сгруппированы в соответствии с моментом извлечения. На графике эти группы представлены как узлы, а ребра между узлами показывают взаимосвязь или родство этих групп, таким образом оценивая их сходство в отношении различий в экспрессии генов.

    Анализ путей с временным разрешением

    Для прогнозирования активности путей и клеточных функций на основе наблюдаемых изменений экспрессии генов мы использовали платформу анализа путей Ingenuity® (IPA®, QIAGEN Redwood City, www.qiagen.com/ingenuity), как описано ранее 42 . В анализе используется набор алгоритмов и инструментов, встроенных в IPA, для вывода и оценки сетей регуляторов перед данными об экспрессии генов на основе крупномасштабной причинно-следственной сети, полученной из базы знаний Ingenuity Knowledge Base. Используя «Анализ нижестоящих эффектов» 43 , встроенный в IPA, мы стремились идентифицировать те биологические процессы и функции, на которые, вероятно, будут причинно влиять усиленные и пониженные гены в наборе данных одноклеточной транскриптомики.В нашем анализе мы считали гены с перекрывающимся значением P > 7 (log10), которые имели активацию Z -балла> 2, как активированные, а гены с активацией Z -балла <-2 как ингибированные.

    Статистика и воспроизводимость

    Все данные представляют собой среднее значение ± стандартная ошибка среднего. Тест Шапиро-Уилка ( p > 0,05), а также визуальный осмотр соответствующих гистограмм, нормальных графиков Q – Q и коробчатых диаграмм были использованы для проверки того, были ли образцы распределены нормально (приблизительно), с использованием IBM SPSS Statistics версии 23.Сравнение двух групп проводилось с использованием непарного критерия Стьюдента t для нормально распределенных данных или критерия Манна-Уитни U в качестве непараметрического эквивалента. Сравнение между тремя или более группами проводилось с использованием одностороннего дисперсионного анализа с последующим апостериорным тестом Тьюки для нормально распределенных данных или с тестом Краскела – Уоллиса H для ненормально распределенных данных. Статистически значимым считалось значение p <0,05, где * p <0.05, ** p <0,01 и *** p <0,001. Анализы выполняли с помощью GraphPad Prism версии 6 (GraphPad Software, Inc.). График направленности / полярных координат был выполнен с использованием библиотеки «ggplot2» № 1234 в R # 5678, версия 3.4.1, 2 44,45 . Все эксперименты были повторены не менее трех раз независимо с аналогичными результатами.

    Краткое изложение отчета

    Дополнительная информация о дизайне исследования доступна в Резюме отчета об исследовании природы, связанном с этой статьей.

    Спайки таза (рубцовая ткань) – Отделение акушерства и гинекологии UNC

    Спайки – это полосы рубцовой ткани, которые могут вызывать слипание внутренних органов, когда этого не должно быть. Чаще всего спаечные процессы возникают в результате предыдущей операции, но некоторые из них могут возникать после инфекции органов малого таза и часто сопровождают более тяжелые стадии эндометриоза. Когда спайки плотные или ограничивают нормальные движения внутренних органов, таких как кишечник, может возникнуть боль.В редких случаях спайки могут вызывать непроходимость кишечника (кишечную непроходимость).

    Спайки, когда они вызывают боль, обычно присутствуют вместе с некоторыми другими болезненными процессами, которые могут вызывать боль, такими как синдром раздраженного кишечника (СРК) или эндометриоз. Они могут сигнализировать о своем присутствии, усугубляя симптомы СРК или вызывая боль во время полового акта. К сожалению, диагностировать наличие спаек таза сложно. За исключением крайних случаев, лечащий врач не может их почувствовать во время обследования органов малого таза, а такие тесты, как УЗИ, МРТ и КТ, не обнаруживают их очень часто.Это означает, что тщательный сбор анамнеза и тазовое обследование врачом, имеющим опыт оценки проблем с болью, являются лучшими инструментами для обнаружения их наличия.

    Когда кажется вероятным, что спайки могут иметь большое значение, можно провести лапароскопию, чтобы увидеть их, а спайки часто можно удалить во время той же лапароскопической процедуры. Здесь есть несколько предостережений.

    Во-первых, лапароскопическое лечение спаек наиболее безопасно и эффективно выполняется лапароскопическими хирургами, специально обученными и имеющими опыт проведения этого типа хирургии.За исключением редких случаев, выполнение лапаротомии (большого открытого разреза) для лечения спаек нецелесообразно, поскольку после открытой операции они гораздо чаще отрастают заново.

    Во-вторых, наличие спаек не означает, что они являются причиной боли! Часто требуется клинический опыт врачей, обученных оценке боли, чтобы знать, когда хирургическое лечение спаек может быть полезным, а когда нет. Операция по устранению спаек лучше всего работает в сочетании с комплексным подходом ко всем компонентам индивидуальной боли.

    В клинике тазовой боли UNC сотрудники имеют более чем 20-летний опыт работы в качестве справочного центра в оценке хронической тазовой боли и выполнении лапароскопических операций высокого уровня по поводу спаечной болезни. Наши показатели безопасности в этих случаях не имеют себе равных в штате. Мы сочетаем хирургическое лечение с множеством других способов обезболивания и лечения, такими как физиотерапия, диета и упражнения, методы снижения стресса, консультирование и прием лекарств.

    спаек – Guts UK

    Каковы обычные симптомы спаек?

    Спайки часто вообще не вызывают никаких симптомов.Однако они могут вызывать перегибы или перекручивания кишечника, уменьшая подвижность кишечника, вызывая непроходимость и другие симптомы, включая повторяющиеся эпизоды колик (спазмов) боли в животе, вздутие живота, тошноту (тошноту), рвоту (тошноту) и другие симптомы. изменение частоты и консистенции стула. Боль от спаек вызвана усилением мышечного сокращения кишечника, пытающегося протолкнуть его содержимое через суженный сегмент. Спайки могут вызывать длительную боль в животе (хронический болевой синдром), которую трудно лечить.Если мочевой пузырь поражен спайками, это может вызвать проблемы с мочеиспусканием, в то время как спайки на яичниках или вокруг них могут привести к проблемам с зачатием или бесплодию.

    Как диагностируется спаечный процесс?

    Если симптомы типичны для спаек и в анамнезе ранее проводились операции на брюшной полости, врач может заподозрить образование спаек и потребовать дальнейшего обследования. Сюда могут входить:

    • МРТ тонкой кишки: включает питье жидкости, которая подчеркивает форму кишечника и может указывать на наличие спаек, выделяя аномальное расширение (увеличение) или изгиб области тонкой кишки.
    • Компьютерная томография: это может быть выполнено, поскольку оно иногда может показывать признаки спаек, хотя важно отметить, что они также могут пропустить наличие спаек, поэтому это обычно выполняется как дополнение к МРТ.
    • Лапароскопическая хирургия: Единственный способ убедиться в наличии спаек – это для хирурга заглянуть внутрь брюшной полости и посмотреть, есть ли спайки и где именно они расположены. Это почти всегда делается с помощью лапароскопической (замочной скважины) хирургии, что означает, что в брюшной полости будет сделано несколько небольших разрезов / разрезов, а не больших разрезов.Однако важно знать, что любая операция увеличивает риск дальнейшего образования спаек, поэтому операция не является лекарством.

    Как спайки могут повлиять на вас?

    В то время как большинство людей со спайками никогда не будут беспокоиться, на других можно повлиять двумя основными способами. Первым и наиболее распространенным является его общее влияние на общее самочувствие, вызванное симптомами. Они могут включать периодическую боль от легкой до сильной, тошноту и тошноту.

    Другой способ, которым ахалазия может повлиять на вас, – это осложнения от фактического состояния.К ним относятся:

    • Частичная или полная обструкция: В случаях частичной (или «подострой») обструкции, такие как вздутие живота, боль и тошнота, могут периодически появляться и исчезать с течением времени. Полная непроходимость – это место, где развитие спаек может привести к сужению кишечника и, в результате, пища и стул не могут свободно перемещаться по кишечнику. В этом случае, скорее всего, пациент будет госпитализирован. В очень тяжелых случаях кишечник полностью закупоривается, и пациенты могут не пропускать стул или ветер, и они будут постоянно испытывать сильную боль с рвотой, которая иногда содержит содержимое кишечника, например фекалии.
    • Удушение: очень редко спайки могут вызывать искривление кишечника, прекращая кровоснабжение («удушение»), что может вызвать внезапную сильную боль в животе и кровотечение из заднего прохода. Это экстренная ситуация, и необходимо немедленно обратиться за медицинской помощью.
    • Хроническая боль: Это редко, но может вызвать серьезное расстройство, разочарование и чувство безнадежности у многих пациентов. Если вы испытываете какое-либо из этих ощущений, важно сообщить об этом своему врачу, чтобы он мог направить вас к специалисту за эмоциональной поддержкой.

    Нужно ли контролировать спайки, и если да, то как?

    После диагностики спаек консультация хирурга поможет решить, требуется ли хирургическое вмешательство. Если операция не рекомендуется, могут потребоваться лекарства и изменение диеты. Поэтому повторный визит к врачу имеет решающее значение для контроля над вашими симптомами. Если боль плохо контролируется, можно обратиться к специалисту по боли.

    Механизмы спаечной непроходимости тонкой кишки и исход операции; популяционное исследование | BMC Surgery

    Пациенты

    В результате поиска медицинских карт было обнаружено 3326 пациентов, возможно, прооперированных по поводу SBO. После исключения была выделена основная группа из 402 пациентов (рис. 1). Всего 240 (60%) женщин и 162 (40%) мужчин. Средний возраст составлял 70 лет (от 18 до 97 лет). Более чем у половины пациентов были сопутствующие заболевания (таблица 1), наиболее распространенными из которых были сердечно-сосудистые заболевания (гипертония и другие артериальные заболевания, сердечные заболевания, цереброваскулярные заболевания).Предоперационная классификация Американского общества анестезиологов (ASA) составляла 3 или 4 для 48% (таблица 1). Тридцать семь пациентов (9%) ранее имели злокачественное заболевание брюшной полости, 23 из них прошли лучевую терапию таза в рамках лечения рака (рака прямой кишки, простаты или гинекологического рака). Абдоминоперинеальная резекция была выполнена семи пациентам, все из которых прошли лучевую терапию. Признаков рецидивирующего рака как причины рецидива SBO не было.

    Таблица 1 Демографические данные и сопутствующие заболевания

    Пятьдесят пациентов (12%) не подвергались абдоминальной хирургии перед индексной операцией, тогда как 189 (47%) ранее перенесли абдоминальную операцию (Таблица 2).Девятнадцати из тех, кому ранее была сделана абдоминальная операция, сделали ее лапароскопически, у одного (5%) из них позже развился SBO, и он был госпитализирован на 2 дня консервативного лечения. Предыдущая операция по поводу SBO выполнена 30 пациентам (7,5%). Не было различий в демографических данных или предыдущих операциях между двумя регионами.

    Таблица 2 Предыдущая абдоминальная операция в связи с индексной операцией для SBO

    Хирургия

    Среднее количество операций SBO в год составило 116 в течение периода исследования, преобладающей причиной была адгезивная SBO, приводящая к 80 операциям в год.Адгезивная хирургия SBO была выполнена 13 на 100 000 жителей в год, и в общей сложности было зарегистрировано 5963 дня пребывания в больнице, связанного с индексной хирургией для SBO.

    Почти все пациенты (391/402, 97%) прошли компьютерную томографию, и большинству также было выполнено последующее контрастирование. Все пациенты, кроме одного, прошли диагностическую радиологию перед операцией.

    Почти все пациенты ( n = 384, 96%) были прооперированы после поступления в отделение неотложной помощи, но 18 (5%) пациентов были прооперированы в послеоперационной фазе после других операций на брюшной полости.В целом, пациенты были прооперированы в среднем через 3,4 дня (0–86) после госпитализации или постановки диагноза SBO. 78 (19%) пациентов были прооперированы в день поступления, еще 120 (30%) оперированы в течение 2 дней после госпитализации.

    Отсрочка операции более чем на 2 дня после госпитализации была связана с большим количеством повторных операций (15% против 8%, p = 0,046) по сравнению с операциями в первые 2 дня. Точно так же операция позже, чем через 4 дня после госпитализации, была связана с большим количеством повторных операций (17% vs.9%, p = 0,024) и большее расхождение раны (9% против 4%, p = 0,037). Кроме того, время операции не было связано со смертностью, краткосрочными или долгосрочными осложнениями или частотой резекции кишечника. Около одной трети ( n = 122) имели период консервативного лечения более 3 дней. Повреждение кишечника было обычным явлением, см. Таблицу 3.

    Таблица 3 Повреждение кишечника, связанное с количеством предыдущих лапаротомий

    Всего у 139 пациентов (35%) были резекции кишечника (137 резекций тонкой кишки и 5 илеоцекальных резекций, у некоторых были обе).Длина резекции варьировала от 2 до 300 см. Несостоятельность анастомоза отмечена у 4 из 139 (2,9%) пациентов с анастомозом. Еще восьми пациентам было выполнено шунтирование, чаще всего из-за плотных диффузных спаек или из-за сложной анатомии.

    Адгезивные механизмы

    Наиболее частым препятствующим механизмом была фиброзная полоса, которая была обнаружена у 226 (56%) пациентов. Это также было доминирующей причиной SBO у пациентов без лапаротомии в анамнезе (44/50, 88%). Пациенты с диффузными спаечными процессами имели более выраженную сопутствующую патологию, большее количество предшествующих абдоминальных операций и более длительный период консервативного лечения перед операцией по сравнению с пациентами со спаечными связями (таблица 4).Более длительное время операции, большее кровотечение и большее количество повреждений кишечника наблюдались в группе с диффузной адгезией (таблица 4).

    Таблица 4 Предоперационные данные, ранние и отдаленные осложнения в отношении бандажных или диффузных спаек как механизма SBO

    Послеоперационное пребывание и общая продолжительность пребывания были значительно дольше в группе с диффузной адгезией. Утечки анастомоза и неуточненное использование антибиотиков были более частыми в этой группе, и больше этих пациентов умерли во время наблюдения (таблица 4).Кроме того, диффузные спайки были связаны с увеличением числа госпитализаций по поводу SBO и более длительным пребыванием в больнице во время последующего наблюдения, но не с хирургическим вмешательством по поводу SBO.

    Ранние осложнения (≤ 30 дней)

    Сто девяносто один (48%) пациент имел раннее послеоперационное осложнение (таблица 5). Наиболее частым осложнением была внутрибрюшная инфекция, от которой пострадали 44 (11%) пациента. Возраст старше 70 лет был связан с увеличением частоты осложнений (таблица 5). Ни пол, ни количество предыдущих лапаротомий не повлияли на осложнения (данные не представлены).Пациенты с классом 3–4 по ASA имели частоту осложнений 122/193 (63%) по сравнению с 69/204 (34%) для класса 1–2 по ASA ( p <0,001).

    Таблица 5 Ранние и поздние осложнения в зависимости от возраста на момент операции

    Сорок один (10%) пациент перенес раннюю повторную операцию, включая запланированный повторный осмотр ( n = 8), абдоминальный сепсис ( n = 11), расхождение раны ( n = 13), рецидивирующее / постоянное SBO ( n = 7), послеоперационное кровотечение (n = 1) и сильная боль в животе (n = 1).

    Пятьдесят один (13%) пациент нуждался в интенсивной терапии, и они находились в среднем 6 (1–40) дней.

    Поздние осложнения (> 30 дней)

    Средняя продолжительность наблюдения составила 66 месяцев (0–122). Общая общая смертность составила 39% ( n = 158), 21 пациент умер в течение 30-дневного послеоперационного периода и 137 пациентов умерли после 30 дней (рис. 2). Средний возраст этих пациентов при проведении индексной операции составлял 78 лет, 83 из них (52%) были старше 80 лет. Большинство (79%) до операции были классифицированы как 3–4 по ASA.Наиболее частыми причинами смерти были сердечно-сосудистые заболевания, злокачественные новообразования и респираторные заболевания. Средний возраст смерти составил 83 года (от 30 до 98). У трех пациентов причина смерти была явно связана с SBO: двое умерли после операции по поводу рецидива SBO и один умер во время пребывания в больнице и консервативного лечения SBO.

    Рис. 2

    Суммарные данные по общей смертности, повторной госпитализации и хирургическому вмешательству для SBO

    При последующем наблюдении 72 пациента (17,9%) были госпитализированы 1–12 раз с симптомами SBO.Из 201 пациента в возрасте до 70 лет 45 были госпитализированы (22,4%) по сравнению с 27 (13,4%) среди пациентов старше 70 лет ( p = 0,019). Тем не менее, последующее наблюдение было более длительным для пациентов с рецидивом SBO (медиана 74 против 64 месяцев, p = 0,0014). Количество предыдущих лапаротомий (1,8 против 1,5, p = 0,013), повреждение кишечника (39/72 против 114/330, p = 0,003), время операции (медиана 95 против 78 мин, p = 0,006) и периоперационное кровотечение (медиана 100 vs.50 мл, p = 0,034) были связаны с повторной госпитализацией по поводу SBO. Двадцати шести пациентам (6,5%) была выполнена повторная лапаротомия по поводу SBO. Послеоперационная грыжа подтвердилась у 24 (6%) пациентов в период наблюдения. Шесть (1,5%) пациентов оперированы по поводу послеоперационной грыжи в период наблюдения.

    % PDF-1.7 % 592 0 объект > эндобдж xref 592 131 0000000016 00000 н. 0000003614 00000 н. 0000003842 00000 н. 0000003884 00000 н. 0000003920 00000 н. 0000004314 00000 н. 0000004422 00000 н. 0000004529 00000 н. 0000004643 00000 п. 0000004757 00000 н. 0000004868 00000 н. 0000004983 00000 н. 0000005098 00000 н. 0000005213 00000 н. 0000005327 00000 н. 0000005442 00000 н. 0000005553 00000 н. 0000005658 00000 н. 0000005763 00000 н. 0000005871 00000 н. 0000005951 00000 п. 0000006031 00000 н. 0000006112 00000 н. 0000006192 00000 п. 0000006271 00000 н. 0000006349 00000 п. 0000006428 00000 н. 0000006508 00000 н. 0000006588 00000 н. 0000006666 00000 н. 0000006745 00000 н. 0000006824 00000 н. 0000006904 00000 н. 0000006984 00000 н. 0000007064 00000 н. 0000007142 00000 н. 0000007221 00000 н. 0000007300 00000 н. 0000007379 00000 н. 0000007458 00000 н. 0000007537 00000 н. 0000007615 00000 н. 0000007693 00000 п. 0000007773 00000 н. 0000007854 00000 п. 0000007935 00000 п. 0000008015 00000 н. 0000008095 00000 н. 0000008175 00000 н. 0000008255 00000 н. 0000008381 00000 п. 0000008415 00000 н. 0000008487 00000 н. 0000008620 00000 н. 0000008666 00000 н. 0000008712 00000 н. 0000009136 00000 п. 0000009391 00000 п. 0000009831 00000 н. 0000010034 00000 п. 0000010444 00000 п. 0000010998 00000 н. 0000011194 00000 п. 0000011639 00000 п. 0000012109 00000 п. 0000012404 00000 п. 0000012622 00000 п. 0000012802 00000 п. 0000013292 00000 п. 0000013361 00000 п. 0000013424 00000 п. 0000013576 00000 п. 0000013754 00000 п. 0000014017 00000 п. 0000014359 00000 п. 0000014663 00000 п. 0000015043 00000 п. 0000015121 00000 п. 0000015418 00000 п. 0000015822 00000 п. 0000017641 00000 п. 0000019509 00000 п. 0000021161 00000 п. 0000023081 00000 п. 0000024674 00000 п. 0000026269 00000 п. 0000026740 00000 п. 0000027181 00000 п. 0000028777 00000 п. 0000030412 00000 п. 0000031981 00000 п. 0000035126 00000 п. 0000035503 00000 п. 0000039856 00000 п. 0000041273 00000 п. 0000043620 00000 н. 0000045876 00000 п. 0000049140 00000 п. 0000050203 00000 п.

    Добавить комментарий

    Ваш адрес email не будет опубликован.